Metabolic health and genetic predisposition in inflammatory bowel disease: Insights from a prospective cohort study.

BACKGROUND: Metabolic disorders exhibit strong inflammatory underpinnings and vice versa. This study aimed to investigate the association between metabolic health status, genetic predisposition, and the risk of inflammatory bowel disease (IBD), and to explore the potential benefits of maintaining ideal metabolic status for individuals with a predetermined genetic risk of IBD. METHOD: This population-based prospective study included 385,820 unrelated European descent participants from the UK Biobank. Using multivariable Cox regression, we assessed the relationship of metabolic phenotypes with risk of IBD and its subtypes. We also developed a polygenic risk score to examine how metabolic health status interacted with genetic risk in relation to IBD risk. RESULTS: During the follow-up period of 4,328,895 person-years, 2,044 newly-diagnosed IBD cases were identified. Higher genetic risk and an increasing number of abnormal metabolic phenotypes were associated with elevated IBD risk (p-trend <0.001). Individuals with high genetic risk and poor metabolic health had a significantly higher risk of IBD (HR=4.56, 95 % CI=3.27-6.36) compared to those with low genetic risk and ideal metabolic health. These results remained consistent for IBD subtypes. Maintaining ideal metabolic status reduced IBD risk within each genetic risk category and jointly decreased subsequent risk by 40 % in high genetic risk individuals. CONCLUSION: Our study reveals a combined impact of poor metabolic health and genetic risk on IBD incidence. Those with low genetic risk and optimal metabolic health exhibit the lowest IBD risk, offering insights into potential management strategies for individuals at predefined genetic risk.

First report of Root-Knot Nematode Meloidogyne hapla infecting Siegesbeckia orientalis L. in Shaanxi, China.

Siegesbeckia orientalis L., belonging to the family of Asteraceae and also known as 'Xi-Xian Cao' or Herba Siegesbeckiae, has been an important traditional Chinese medicine since the Tang Dynasty (Wang et al., 2021). As the dried aerial parts have medicinal values, S. orientalis is widely grown in China, Japan, Korea, and Vietnam. One almost 600 m2 block of S. orientalis plants with stunting and leaf withering symptoms was found in Luonan County (110.26 E, 34.06 N), Shaanxi Province, in August 2022. Many galls were observed on the roots of these plants, and densities of second-stage juveniles (J2s) were 260~370 per 100 cm3 of soil. Females and eggs were dissected from infected roots, and J2s and males were extracted from the soil for species identification. The perineal patterns of females (n=20) were oval-shaped, with minor dorsal arches, distinct lateral fields, and tiny punctations around anus. The head caps of males were high and obviously narrower than head region which broadened out of the first body annuli. Morphological measurements of females (n=20) were: body length (L) = 897.66 ± 50.89 (860.96-949.74) µm, body width (BW) = 577.69 ± 51.01 (489.91-638.65) µm, stylet length (ST) = 14.03 ± 0.63 (13.25-14.97) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 4.96 ± 0.47 (4.08-5.37) µm, vulval slit length = 18.82 ± 1.97 (17.24-22.02) µm, vulval slit to anus distance = 13.62 ± 1.22 (12.34-16.18) µm. Measurements of males (n=10) were: L = 1298.73 ± 95.96 (1202.77-1394.69) µm, BW = 28.24 ± 2.38 (25.93-30.55) µm, ST = 20.23 ± 0.78 (19.42-21.04) µm, DGO = 4.89 ± 0.44 (4.56-5.22) µm, spicule length = 28.98 ± 1.68 (26.94-31.02) µm. Measurements of J2s: L = 375.35 ± 14.02 (341.01-400.46) µm, BW = 15.09 ± 1.47 (12.02-16.82) µm, ST = 12.74 ± 0.61(11.46-13.84) µm, DGO = 2.58 ± 0.59 (1.61-3.7) µm, tail length= 74.15 ± 13.73 (50.92-95.09) µm, hyaline tail terminus= 11.36 ± 2.27 (9.53-17.85) µm. These morphological characteristics were consistent with those of Meloidogyne hapla Chitwood, 1949 as described by Whitehead (1968). The DNA of single females (n=10) was isolated using the Proteinase K method for molecular identification (Kumari and Subbotin, 2012). The sequence of rDNA-ITS region was amplified and sequenced with the primers rDNA-F/R (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al., 1992). The 768 bp sequence (GenBank OP542552) was 99.74% identical to the rDNA-ITS sequences of M. hapla (JX024147 and OQ269692). Then the D2/D3 fragments of the 28S rRNA were amplified and sequenced with the primers D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (McClure et al., 2012). The 762 bp fragment (OP554218) showed 100% identical to sequences of M. hapla (MN752204 and OM744204). To confirm the pathogenicity of the population, six 2-week-old healthy S. orientalis seedlings cultured in sterilized sand were each inoculated with 2,000 J2s hatched from egg masses. Four non-inoculated seedlings served as negative controls. After maintenance at 25°C for 60 days, galls appeared on the roots of inoculated plants, being consistent with the symptoms observed in field, while the negative controls showed no symptoms. Females collected from inoculated plants were identified as M. hapla with species-specific primer JWV1/ JWV (Adam et al., 2007), which amplified a fragment of 440 bp. Parasitism was also confirmed by the average recovery of 3,814 J2s per inoculated plant with the reproductive factor of 1.91. This is the first report of S. orientalis being a host of M. hapla. The disease reduces the quality and yield of S. orientalis, and much more efforts would be made for its control in production.

Nickel-Catalyzed Multicomponent Assembly of Alkynes toward α-CF3-Alkenes.

We disclose an efficient nickel catalytic system for expediting the coupling of alkynes with fluoroalkyl hydrazones and boronic acids, thus facilitating the synthesis of stereospecific α-fluoroalkyl-alkene derivatives. 3H-Pyrazoles might be involved as key intermediates through a nitrogen-releasing process, enabling subsequent coupling with boronic acids to afford 1,2-difunctional alkenes in a highly efficient and step-economical fashion. This tandem platform demonstrates broad functional group tolerance, including complex natural products and drug-like molecules.

Enhancement of Calcium Chelating Activity in Peptides from Sea Cucumber Ovum through Phosphorylation Modification.

Recently, phosphorylation has been applied to peptides to enhance their physiological activity, taking advantage of its modification benefits and the extensive study of functional peptides. In this study, water-soluble peptides (WSPs) of sea cucumber ovum were phosphorylated in order to improve the latter's calcium binding capacity and calcium absorption. Enzymatic hydrolysis methods were screened via ultraviolet-visible absorption spectroscopy (UV-Vis), the fluorescence spectrum, and calcium chelating ability. Phosphorylated water-soluble peptides (P-WSPs) were characterized via high-performance liquid chromatography, the circular dichroism spectrum, Fourier transform infrared spectroscopy (FTIR), UV-Vis spectroscopy, surface hydrophobicity, and fluorescence spectroscopy. The phosphorus content, calcium chelation rate and absorption rate were investigated. The results demonstrated that phosphorylation enhanced the calcium chelating capacity of WSPs, with the highest capacity reaching 0.96 mmol/L. Phosphate ions caused esterification events, and the carboxyl, amino, and phosphate groups of WSPs and P-WSPs interacted with calcium ions to form these bonds. Calcium-chelated phosphorylated water-soluble peptides (P-WSPs-Ca) demonstrated outstanding stability (calcium retention rates > 80%) in gastrointestinal processes. Our study indicates that these chelates have significant potential to develop into calcium supplements with superior efficacy, bioactivity, and stability.

Personalized therapy guided by longitudinal liquid biopsies for treatment of leptomeningeal disease from lung adenocarcinoma: A case report.

Molecular-based targeted therapies have significantly benefited certain patients with cancer; however, those with leptomeningeal disease (LMD) persistently exhibit a poor prognosis and are often excluded from clinical trials. Tumor-derived cell-free (cf)DNA, found in the cerebrospinal fluid (CSF) of patients with LMD, can assist in diagnosis and tracking of disease progression. However, the utilization of CSF to direct targeted cancer therapy has yet to be extensively explored. The present study reported the case of a patient with lung adenocarcinoma and LMD who was monitored by performing a series of liquid biopsies of CSF and blood. Targeted sequencing was performed on cfDNA from the CSF and plasma, and the variant allele frequencies (VAFs) of BRAF and NRAS mutations were assessed and analyzed in conjunction with the clinical presentation of the patient. The patient then underwent serial chemotherapy, radiation therapy, immunotherapy and targeted treatment based on the results of the liquid biopsies. Upon the LMD diagnosis, a BRAF p.V600E mutation was detected in plasma cfDNA. Consequently, the patient was treated with vemurafenib and responded favorably to this consolidation treatment for 13 months. After a relapse in July 2018, both BRAF p.V600E and NRAS p.Q61K mutations were detected in CSF supernatant and sediment cell samples, suggesting drug resistance. Therefore, the treatment strategy for the patient changed to cobimetnib plus vemurafenib. Notably, the changes of VAF in the CSF supernatant samples were associated with the clinical status of the patient. The patient survived for 33 months post-LMD diagnosis. The present case report highlights the potential use of liquid biopsy in personalized therapy, as it was instrumental in informing the combinational treatment plan of the patient, which ultimately proved beneficial.

Hydraulic properties and drought response of a tropical bamboo (Cephalostachyum pergracile).

Bamboo plants are an essential component of tropical ecosystems, yet their vulnerability to climate extremes, such as drought, is poorly understood due to limited knowledge of their hydraulic properties. Cephalostachyum pergracile, a commonly used tropical bamboo species, exhibited a substantially higher mortality rate than other co-occurring bamboos during a severe drought event in 2019, but the underlying mechanisms remain unclear. This study investigated the leaf and stem hydraulic traits related to drought responses, including leaf-stem embolism resistance (P50leaf; P50stem) estimated using optical and X-ray microtomography methods, leaf pressure-volume and water-releasing curves. Additionally, we investigated the seasonal water potentials, native embolism level (PLC) and xylem water source using stable isotope. We found that C. pergracile exhibited strong resistance to embolism, showing low P50leaf, P50stem, and turgor loss point, despite its rapid leaf water loss. Interestingly, its leaves displayed greater resistance to embolism than its stem, suggesting a lack of effective hydraulic vulnerability segmentation (HVS) to protect the stem from excessive xylem tension. During the dry season, approximately 49% of the water was absorbed from the upper 20-cm-deep soil layer. Consequently, significant diurnal variation in leaf water potentials and an increase in midday PLC from 5.87 ± 2.33% in the wet season to 12.87 ± 4.09% in the dry season were observed. In summary, this study demonstrated that the rapid leaf water loss, high reliance on surface water, and a lack of effective HVS in C. pergracile accelerated water depletion and increased xylem embolism even in the typical dry season, which may explain its high mortality rate during extreme drought events in 2019.

Venetoclax combined chemotherapy versus chemotherapy alone for acute myeloid leukemia: a systematic review and meta-analysis.

Objective: To compare the efficacy and safety of venetoclax (VEN) in combination with chemotherapy (chemo) versus chemo alone in the treatment of acute myeloid leukemia (AML). Method: To compare the efficacy and/or safety of VEN+chemo versus chemotherapy alone for AML, PubMed, Embase, Web of Science, and the Cochrane Library were used to searching up to June 2023. Comparisons included complete remission (CR), CR with incomplete hematologic recovery (CRi), morphologic leukemia-free state (MLFS), overall response rate (ORR), and adverse events (AEs). Result: A total of 9 articles were included, including 3124 patients. The baseline characteristics between two patient groups were similar. The combined analysis showed that compared with the group receiving chemo alone, the VEN+chemo group exhibited higher rates of CR, CRi, MLFS and ORR. Additionally, the VEN+chemo group had longer event-free survival (EFS) and overall survival (OS) durations. The incidence rates of AEs and serious AEs (SAEs) were similar between the two groups, but the early 30-day mortality rate was lower in the VEN+chemo group than in the chemo alone group. Conclusion: The VEN+chemo therapy demonstrates significant efficacy and safety profile in AML patients. However, more prospective studies are needed in the future to provide more accurate and robust evidence for treatment selection in patients. Systematic Review Registration: https://www.crd.york.ac.uk/prospero/display_record.php?ID=CRD42023439288, identifier CRD42023439288.

Impact of cod skin peptide-ι-carrageenan conjugates prepared via the Maillard reaction on the physical and oxidative stability of Antarctic krill oil emulsions.

This research aimed to construct an emulsifier by the Maillard reaction at various times using cod fish skin collagen peptide (CSCP) and ι-carrageenan (ι-car) to stabilize an Antarctic krill oil (AKO) emulsion. This emulsion was then investigated for physicochemical stability, oxidative stability, and gastrointestinal digestibility. The emulsion stability index and emulsifying activity index of Maillard reaction products (MRPs) were increased by 36.32 % and 66.30 %, respectively, at the appropriate graft degree (25.58 %) compared with the mixture of ι-car and CSCP. In vitro digestibility suggested the higher release of free fatty acids (FFAs) of 10d-MRPs-AKO-emulsion, and the highest bioavailability of AST in 10d-MRPs-AKO was found to be 28.48 %. The findings of this study showed the potential of MRPs to improve peptide function, serve as delivery vehicles for bioactive chemicals, and possibly serve as a valuable emulsifier to be used in the food industry.

First report of Root-Knot Nematode Meloidogyne enterolobii infecting coriander in Shaanxi, Northern China.

Coriander (Coriandrum sativum), which can be used for its root, stem, and leaf as both food and medicine (Prachayasittikul et al. 2018), is widely cultivated in China. The coriander cultivation area of Guanzhong region, including Xi' an, Xianyang, and Weinan, is 20 million m2, which accounts for 85.7% of the total cultivation area in Shaanxi. In September 2022, obvious galls were observed on the roots of coriander plants (cv. Xiaoye) growing in a field in Huyi District, Xi' an City (34°1'26.4"N, 108°31'58.8"E). The diseased plants did not show obvious above-ground symptoms. To identify the species, second-stage juveniles (J2s) and males were collected from soil in the root zone, and adult females were isolated from galls of diseased roots. The perineal patterns of adult females (n = 20) were round to oval, with high dorsal arches and no obvious lateral lines were observed. Morphological measurements of females (n = 20) included body length (L) = 682 ± 56 (554 to 780) µm, body width (BW) = 522 ± 45 (420 to 597) µm, stylet = 14.9 ± 0.9 (13.4 to 16.3) µm, dorsal pharyngeal gland orifice to stylet base (DGO) = 5.3 ± 0.5 (4.3 to 6.3) µm, vulval slit length = 26 ± 2.8 (20 to 32) µm, vulval slit to anus distance = 21 ± 1.7 (18.5 to 26) µm. Measurements of males (n = 8) were L = 1398 ± 57 (1308 to 1450) µm, BW = 28 ± 2.9 (23 to 32) µm, stylet = 16.1 ± 0.8 (15.3 to 17.3) µm, DGO = 4.5 ± 0.5 (3.5 to 4.9) µm, spicules = 27 ± 1.1 (26 to 29) µm. Measurements of J2s (n = 20) were as follows: L = 434 ± 16.8 (391 to 477) µm, BW = 15.6 ± 0.9 (13.7 to 17.3) µm, stylet = 12.6 ± 0.6 (11.3 to 13.6) µm, DGO = 3.9 ± 0.3 (3.4 to 4.5) µm, tail = 52 ± 4.0 (47 to 60) µm, hyaline tail length = 15.6 ± 1.3 (13.6 to 18.6) µm. These morphological characteristics were consistent with those described for Meloidogyne enterolobii (Yang and Eisenback 1983). Ten females were put in 10 tubes for DNA extraction following Htay et al. (2016). The ITS-rDNA sequence was amplified using the primers 18S/26S (Vrain et al. 1992). A 765 bp fragment was obtained and the sequence (GenBank OR789453) was 99.87% identical to sequences of M. enterolobii (MT406251 and MT067559). The mtDNA CoxII-16S sequence was amplified using primers C2F3/1108 (Powers and Harris, 1993). The sequence was 705 bp (OR795028) and 100% identical to sequences of M. enterolobii (MK455870 and MZ643270). A single 236 bp fragment was amplified using species-specific primers Me-F/Me-R, confirming the species as M. enterolobii (Long et al. 2006). The infection test was conducted in a greenhouse at 27 ± 2℃. Eight 2-week-old coriander plants (cv. Xiaoye) were individually grown in pots filled with sterilizer soil and inoculated with 800 J2s hatched from collected M. enterolobii egg masses. Forty-five days after nematode inoculation, the inoculated plants had galled roots like those observed in the field. The reproduction factor (final population density/initial population density) was 11.9 ± 2.0, indicating coriander was a suitable host for M. enterolobii. No symptoms were observed in controls. To our knowledge, this is the first known natural infection of coriander with M. enterolobii in China. M. enterolobii has been reported on various crops in southern provinces of China (EPPO, 2023). Considering the high level of agricultural trade between different regions, there is a high risk of M. enterolobii transmission to Guanzhong region through infested soil and susceptible plant materials. Further monitoring and research on effective control strategies are needed to prevent the spread of this nematode.

First Report of Meloidogyne incognita on Coral dealbatus in Shaanxi, China.

Coral dealbatus belonging to Crassulaceae, is a new kind of health care vegetable as both medicine and food (Qin et al., 2022). Because of its obvious health care function, C. dealbatus was widely cultivated in China and market demand increased quickly. In August of 2022, a large number of C. dealbatus showed the symptoms of stunting and leaf yellowing in Dali county, Weinan, Shaanxi province, China (109°43'E, 34°36'N). Many galls were observed on the roots of infected plants, and females were observed under the plant epidermis. Infected roots and soil samples were collected, the females, males and second-stage juveniles (J2s) were isolated. The female had a spherical body with a protruding neck, the stylet of females was slender and curved toward the back slightly. The perineal pattern of female (n=20) was round or elliptical, with high and squared dorsal arch, without obvious lateral lines. Morphological measurements of females (n=20): body length (L)=782.09±54.54 ( 518.52 to 1137.76) µm, body width (W)=439.51±19.23 (336.51 to 551.74 ) µm, stylet length (ST)=15.39±0.67 (12.55 to 18.80) µm, stylet knob height (STKH)=2.02±0.09 (1.88 to 2.46) µm, stylet knob width (STKW)=3.69±0.15 (2.91to 4.58) µm, distance from dorsal esophageal gland orifice to base of stylet (DGO)=2.32±0.17 (1.77 to 3.48) µm, vulval slit length (V)=23.99±0.75 (20.71 to 28.83) µm, and vulval slit to anus distance (V') = 18.62±0.55 (14.95 to 21.20) µm. The males showed a trapezoidal labial region, with a high head cap and concaved at the center of the top end in lateral view; and had blunt tail that bended slightly towards the abdomen, stylet knobs were prominent, speculum were in pairs and acicular. Measurements of females (n=10) were: L=1377.82±198.09 (1040.66 to 1726.59) µm, W=37.32±4.49 (28.35 to 41.90) µm, ST=21.48±1.23 (19.69 to 23.51) µm, STKH=2.99±0.12 (2.82 to 3.23) µm, STKW=5.34±0.41 (4.64 to 6.06) µm, DGO=2.54±0.13 (2.31 to 2.77) µm. J2s had the following characteristics: L=435.57±40.75 (414.92 to 462.14) µm, W=16.73±2.62 (12.76 to 21.95) µm, ST=12.66±1.02 (10.68 to 14.76) µm, STKH=1.58±0.29 (1.07 to 1.98) µm, STKW=2.22±0.38 (1.63 to 2.70) µm, DGO=2.26±0.18 (2.03 to 2.70) µm, tail length(T)= 87.97±9.71 (72.98 to 92.53) µm, hyaline tail terminus (HT) = 12.44±2.21 (9.59 to 13.90) µm. The nematode had uniform morphological characteristics with Meloidogyne incognita (Orton Williams, 1973). DNA was extracted from ten single females, and the species-specific primers Mi2F4/Mi1R1 (ATGAAGCTAAGACTTTGGGCT/TCCCGCTACACCCTCAACTTC) were used for identification of M. incognita (Kiewnick et al., 2013), and a 300bp fragment was amplified by this pair of primers, confirming the nematode was M. incognita. 18S rDNA gene was amplified using the primer pair 18S/26S (TTTCACTCGCCGTTACTAAGG/TTGATTACGTCCCTGCCCTTT) (Vrain et al.,1992), and the sequence was submitted to GenBank (GenBank Accession No. OR477177). Sequence aligment was conducted and showed 100% identical with the known sequence of M. incognita (GenBank Accession Nos. MH113856 and OQ269709). The result of identification was also confirmed by amplifying the sequence of NADH dehydrogenase subunit 5 (nad5) from mitochondrial DNA region using primers: NAD5-F/R(TATTTTTTGTTTGAGATATATTAG/TCGTGAATCTTGATTTTCCATTTTT) (Janssen et al. 2016). A611bp fragment was amplified and the sequence (GenBank Accession No. OR520436) showed 100% identical with other M. incognita sequences (GenBank Accession Nos. OP753345 and MT683461). In order to determine the pathogenicity of the nematode, infestation test was conducted in greenhouse. Ten 20-day-old healthy plants were cultured in pots with sterilized soil respectively and 2000 J2 hatched from egg masses of M. incognita were inoculated to the root of the plant. Five non-inoculated healthy C. dealbatus were used as negative control. After cultured at 25℃ for 60 days, roots were galled as observed in the field, and the symptoms of the root inoculated artificially with M. incognita were the same as those in the field. The nematodes were collected from inoculated roots, and identified as M. incognita with the species-specific primers Mi2F4/Mi1R1. An average of 7362 J2 was recovered and the reproduction factor value was 3.68. No galls were observed in control plants. These results suggested that C. dealbatus is a host for M. incognita. To our knowledge, this is the first report of M. incognita parasitizing C. dealbatus. This finding may be important to C. dealbatus industry and appropriate strategies should be taken to deal with the spreading of M. incognita.

Unbiased Single-Cell Sequencing of Hematopoietic and Immune Cells from Aplastic Anemia Reveals the Contributors of Hematopoiesis Failure and Dysfunctional Immune Regulation.

Aplastic anemia (AA) is a bone marrow (BM) failure syndrome mediated by hyperactivated T-cells with heterogeneous pathogenic factors. The onset of BM failure cannot be accurately determined in humans; therefore, exact pathogenesis remains unclear. In this study, a cellular atlas and microenvironment interactions is established using unbiased single-cell RNA-seq, along with multi-omics analyses (mass cytometry, cytokine profiling, and oxidized fatty acid metabolomics). A new KIR+ CD8+ regulatory T cells (Treg) subset is identified in patients with AA that engages in immune homeostasis. Conventional CD4+ T-cells differentiate into highly differentiated T helper cells with type 2 cytokines (IL-4, IL-6, and IL-13), GM-SCF, and IL-1ß. Immunosuppressive homeostasis is impaired by enhanced apoptosis of activated Treg cells. Pathological Vδ1 cells dominated the main fraction of γδ T-cells. The B/plasma, erythroid, and myeloid lineages also exhibit substantial pathological features. Interactions between TNFSF12-TNFRSF12A, TNF-TNFRSF1A, and granzyme-gasdermin are associated with the cell death of hematopoietic stem/progenitor (HSPCs), Treg, and early erythroid cells. Ferroptosis, a major driver of HSPCs destruction, is identified in patients with AA. Furthermore, a case of twins with AA is reported to enhance the persuasiveness of the analysis. These results collectively constitute the cellular atlas and microenvironment interactions in patients with AA and provide novel insights into the development of new therapeutic opportunities.

A variant of the venom allergen-like protein, DdVAP2, is required for the migratory endoparasitic plant nematode Ditylenchus destructor parasitism of plants.

The potato rot nematode, Ditylenchus destructor, poses a serious threat to numerous root and tuber crops, yet the functional characterization of effectors from this migratory endoparasitic plant nematode remains limited. Despite inhabiting distinct habitats, sedentary and migratory plant parasitic nematodes share the structurally conserved effectors, such as venom allergen-like proteins (VAPs). In this study, a variant of DdVAP2 was cloned from D. destructor. The transcription profile analysis revealed that DdVAP2 was higher expressed in D. destructor feeding on either potato or sweet potato compared to on fungus via qRT-PCR. And DdVAP2 was highly expressed at all life stages feeding on sweet potato, except for eggs. DdVAP2 was confirmed to be specifically expressed in the subventral esophageal glands of D. destructor through in situ hybridization assays. Combined with functional validation of the signal peptide of DdVAP2, it suggested that DdVAP2 could be secreted from nematode into host. Heterologous expression of DdVAP2 in Nicotiana benthamiana revealed that the protein localized in both cytosol and nuclei of plant cells. Knocking down DdVAP2 by RNAi in D. destructor resulted in infection and reproduction defects on plants. All the results suggest that DdVAP2 plays a crucial role in the interaction between D. destructor and plants by facilitating the nematode infection.

Lipidomics identified novel cholesterol-independent predictors for risk of incident coronary heart disease: Mediation of risk from diabetes and aggravation of risk by ambient air pollution.

INTRODUCTION: Previous lipidomics studies have identified various lipid predictors for cardiovascular risk, however, with limited predictive increment, sometimes using too many predictor variables at the expense of practical efficiency. OBJECTIVES: To search for lipid predictors of future coronary heart disease (CHD) with stronger predictive power and efficiency to guide primary intervention. METHODS: We conducted a prospective nested case-control study involving 1,621 incident CHD cases and 1:1 matched controls. Lipid profiling of 161 lipid species for baseline fasting plasma was performed by liquid chromatography-mass spectrometry. RESULTS: In search of CHD predictors, seven lipids were selected by elastic-net regression during over 90% of 1000 cross-validation repetitions, and the derived composite lipid score showed an adjusted odds ratio of 3.75 (95% confidence interval: 3.15, 4.46) per standard deviation increase. Addition of the lipid score into traditional risk model increased c-statistic to 0.736 by an increment of 0.077 (0.063, 0.092). From the seven lipids, we found mediation of CHD risk from baseline diabetes through sphingomyelin (SM) 41:1b with a considerable mediation proportion of 36.97% (P < 0.05). We further found that the positive associations of phosphatidylcholine (PC) 36:0a, SM 41:1b, lysophosphatidylcholine (LPC) 18:0 and LPC 20:3 were more pronounced among participants with higher exposure to fine particulate matter or its certain components, also to ozone for LPC 18:0 and LPC 20:3, while the negative association of cholesteryl ester (CE) 18:2 was attenuated with higher black carbon exposure (P < 0.05). CONCLUSION: We identified seven lipid species with greatest predictive increment so-far achieved for incident CHD, and also found novel biomarkers for CHD risk stratification among individuals with diabetes or heavy air pollution exposure.

Toxic elements pollution risk as affected by various input sources in soils of greenhouses, kiwifruit orchards, cereal fields, and forest/grassland.

Increasing food demand has led to more intensive farming, which threatens our ecosystem and human health due to toxic elements accumulation. This study aimed to estimate the vulnerability of different agricultural systems with unequal high fertilizer input practices regarding toxic element pollution in the greenhouse, kiwifruit orchard, cereal field, and forest/grassland. Soil samples were collected from 181 sites across Shaanxi Province, China, and analyzed for selected characteristics and toxic elements (As, Cd, Cr, Cu, Hg, Pb, and Zn). The contamination factor (CFx) represents the ratio of the measured value of the toxic element in the soil over the soil background values. The CFx values of all the toxic elements were above background values, while Cd and Hg contamination levels were more severe than those of Zn, Cu, As, Cr, and Pb. Kiwifruit orchards and greenhouse soils were contaminated with Cd, Hg, Cu, and Zn, but cereal fields and forest/grassland soils were contaminated with As, Cd, Hg, and Hg. Overall, the cumulative pollution load (PLI) of toxic elements indicated moderate contamination. The cumulative ecological risk (RI) results indicated that greenhouse (178.81) and forest/grassland (156.25) soils were at moderate ecological risks, whereas kiwifruit orchards (120.97) and cereal field (139.72) soils were at low ecological risks. According to a Pearson correlation analysis, Cd, Hg, Cu, and Zn were substantially linked with soil organic matter (SOM), total nitrogen (TN), total phosphorous (TP), and total potassium (TK). The primary sources of toxic elements were phosphate and potash fertilizers, manure, composts, and pesticides in a greenhouse, kiwifruit orchards, and cereal fields, whereas, in forest/grassland soils parent material and atmospheric deposition were the sources identified by positive matrix factorization (PMF). Furthermore, the partial least square structural equation model (PLS-SEM) demonstrated that agriculture inputs largely influenced toxic elements accumulation. We conclude that high fertilizer inputs in greenhouse soils should be considered carefully so that toxic element pollution may be minimized.

Identification of Meloidogyne species on traditional Chinese medicine plants in the Qinling mountain area of China and their aggressiveness to different medicinal herbs.

Root-knot nematodes (Meloidogyne spp.) are plant-parasitic nematodes that cause serious damage on a worldwide basis. There are many species of traditional Chinese medicine (TCM) plants, but only a few have been reported to be infected by Meloidogyne species. From 2020 to 2022, a survey was conducted in the Qinling mountain area, which is the main producing region of TCM plants in China. Obvious galling symptoms were observed on the root systems of fifteen species of TCM plants. Females were collected from diverse diseased TCM plants and subsequently identified at morphological and molecular level. Among the twenty diseased root samples collected, Meloidogyne hapla populations were identified in twelve samples (60%) and Meloidogyne incognita populations were identified in eight samples (40%). Among the fifteen species of diseased TCM plants, eight of them, namely Scutellaria baicalensis, Leonurus japonicus, Dioscorea zingiberensis, Cornus officinalis, Viola philippica, Achyranthes bidentata, Senecio scandens, and Plantago depressa were reported to be infected by Meloidogyne species for the first time. The host status of five species of TCM plants for two M. hapla isolates and one M. incognita isolate from TCM plants in this study was then evaluated. Differences in TCM plants' response to nematode infection were apparent when susceptibility was evaluated by the egg counts per gram fresh weight of root and the reproduction factor of the nematodes. Among the five species of TCM plants tested, Salvia miltiorrhiza and Gynostemma pentaphyllum were the most susceptible, while S. baicalensis and V. philippica were not considered suitable hosts for M. hapla or M. incognita.

Effect of low-temperature stress on the survival of Meloidogyne incognita and its application in greenhouse of northern China.

We examined the effects of low temperature on egg hatching and killing rate of the 2nd instars of Meloi-dogyne incognita (J2) in the laboratory. We further evaluated the effects of two soil treatment methods on the survival rate of M. incognita in northern China in a field experiment. The results of laboratory experiment showed that survival rate of J2 was 0 after being subjected to -7 ℃ for 24 hours, and that egg hatching was completely inhibited 24 hours after being subjected to -9 ℃. The survival rate of J2 was 0 after being subjected to -1, -2, -3, and -4 ℃ for 8, 5, 3, and 1.5 d, respectively. Egg hatching was completely inhibited after being subjected to -2, -3, -4, and -5 ℃ for 9, 6, 4, and 1 d, respectively. Results of the fitting analysis showed that both the relationships between the temperature and the lethal time of J2 as well as the temperature and the non-hatching time of the eggs followed exponential functions. The results of field test showed that death rate of M. incognita in 0-50 cm soil layer after ridging treatment and 0-30 cm soil layer after leveling treatment could reach 100%, while the disease index of the former in 30-40 cm and 40-50 cm was 84.9% and 75.8%, respectively, which was lower than that in the greenhouse. Our results suggest that preventing and controlling M. incognita in greenhouses through low-tempe-rature in winter could achieve a better control effect in Yulin City and the northward region. The proposed technique is convenient and has high potential for popularization.

Advances in the preparation and application of microencapsulation to protect food functional ingredients.

Functional ingredients have multiple health benefits for humans, but are sensitive to oxidative degradation during manufacture and storage, and have poor chemical stability and reduced bioaccessibility. Therefore, microcapsules are prepared by encapsulating the active ingredient in a matrix to enhance the stability of the active ingredient. Their use as microcapsule carriers in the food industry is now an effective and promising technology. This paper reviews the preparation of microcapsules based on different principles. It summarizes the protein and polysaccharide bioactive substances commonly used for encapsulation. It also discusses the practice of modifying the wall material by chemical reactions (Maillard reaction) to obtain excellent properties. Finally, the applications of microcapsules in the production of beverages, baked goods, meat, dairy products, probiotic delivery and food preservation are discussed as well as their feasibility as effective protective bioactive substance delivery systems. The microencapsulation process can improve the storability of food products, make bioactive compounds stable over time and apply co-microencapsulation in the formulation of co-effective functional foods, which is a direction for future research.

Single-cell RNA-seq Revealed that Altered Tumor Infiltrating Lymphocytes in Cirrhotic Liver Indicate Development of Hepatocellular Carcinoma.

Background and Aims: Cirrhosis is the precursor lesion for most hepatocellular carcinoma (HCC) cases. However, no biomarker effectively predicted HCC initiation before diagnosis by imaging. We aimed to investigate the hallmarks of immune microenvironments in healthy, cirrhotic livers and HCC tumor tissues and to identify immune biomarkers of cirrhosis-HCC transition. Methods: Expression matrices of single-cell RNA sequencing studies were downloaded and integrated with Seurat package vignettes. Clustering was performed to analyze the immune cell compositions of different sample types. Results: The cirrhotic liver and HCC tumors had distinct immune microenvironments, but the immune landscape of cirrhotic livers was not markedly modified compared with healthy livers. Two subsets of B cells and three subsets of T cells were identified in the samples. Among the T cells, naïve T cells were more prominent in the cirrhotic and healthy liver samples than in the HCC samples. In contrast, the neutrophil count was lower in cirrhotic livers. Two macrophage clusters were identified, one that actively interacted with T cells and B cells and was enriched in cirrhotic blood compared with HCC blood samples. Conclusions: Decreased naïve T cell infiltration and increased neutrophil infiltration in the liver may indicate the development of HCC in cirrhotic patients. Alterations in blood-resident immune cells may also be a sign of HCC development in cirrhotic patients. The dynamics of the immune cell subsets may serve as novel biomarkers to predict the transition from cirrhosis to HCC.

Nontargeted Metabolomics Revealed Novel Association Between Serum Metabolites and Incident Acute Coronary Syndrome: A Mendelian Randomization Study.

Background This study was performed to identify metabolites associated with incident acute coronary syndrome (ACS) and explore causality of the associations. Methods and Results We performed nontargeted metabolomics in a nested case-control study in the Dongfeng-Tongji cohort, including 500 incident ACS cases and 500 age- and sex-matched controls. Three metabolites, including a novel one (aspartylphenylalanine), and 1,5-anhydro-d-glucitol (1,5-AG) and tetracosanoic acid, were identified as associated with ACS risk, among which aspartylphenylalanine is a degradation product of the gut-brain peptide cholecystokinin-8 rather than angiotensin by the angiotensin-converting enzyme (odds ratio [OR] per SD increase [95% CI], 1.29 [1.13-1.48]; false discovery rate-adjusted P=0.025), 1,5-AG is a marker of short-term glycemic excursions (OR per SD increase [95% CI], 0.75 [0.64-to 0.87]; false discovery rate-adjusted P=0.025), and tetracosanoic acid is a very-long-chain saturated fatty acid (OR per SD increase [95% CI], 1.26 [1.10-1.45]; false discovery rate-adjusted P=0.091). Similar associations of 1,5-AG (OR per SD increase [95% CI], 0.77 [0.61-0.97]) and tetracosanoic acid (OR per SD increase [95% CI], 1.32 [1.06-1.67]) with coronary artery disease risk were observed in a subsample from an independent cohort (152 and 96 incident cases, respectively). Associations of aspartylphenylalanine and tetracosanoic acid were independent of traditional cardiovascular risk factors (P-trend=0.015 and 0.034, respectively). Furthermore, the association of aspartylphenylalanine was mediated by 13.92% from hypertension and 27.39% from dyslipidemia (P<0.05), supported by its causal links with hypertension (P<0.05) and hypertriglyceridemia (P=0.077) in Mendelian randomization analysis. The association of 1,5-AG with ACS risk was 37.99% mediated from fasting glucose, and genetically predicted 1,5-AG level was negatively associated with ACS risk (OR per SD increase [95% CI], 0.57 [0.33-0.96], P=0.036), yet the association was nonsignificant when further adjusting for fasting glucose. Conclusions These findings highlighted novel angiotensin-independent involvement of the angiotensin-converting enzyme in ACS cause, and the importance of glycemic excursions and very-long-chain saturated fatty acid metabolism.

The effect of different ferrule heights and crown-to-root ratios on fracture resistance of endodontically-treated mandibular premolars restored with fiber post or cast metal post system: an in vitro study.

BACKGROUND: This study aimed to investigate the effects of different ferrule heights and crown-to-root ratios on the fracture resistance of endodontically-treated premolars restored with fiber post or cast metal post system. METHODS: Eighty extracted human mandibular first premolars with single root canal were treated endodontically and cut from 2.0 mm above the buccal cemento-enamel junction, to create horizontal residual roots. The roots were randomly divided into two groups. The roots in group FP were restored with a fiber post-and-core system, while the roots in group MP were restored with a cast metal post-and-core system. Each group was divided into five subgroups with different ferrule heights (0: no ferrule; 1: 1.0 mm ferrule; 2: 2.0 mm ferrule; 3: 3.0 mm ferrule; 4: 4.0 mm ferrule). All specimens were subsequently restored with metal crowns and embedded in acrylic resin blocks. The crown-to-root ratios of the specimens were controlled at approximately 0.6, 0.8, 0.9, 1.1, and 1.3 of the five subgroups, respectively. Fracture strengths and fracture patterns of the specimens were tested and recorded by a universal mechanical machine. RESULTS: Mean fracture strengths (mean ± standard deviation (kN)) of FP/0 to FP/4 and MP/0 to MP/4 were: 0.54 ± 0.09, 1.03 ± 0.11, 1.06 ± 0.17, 0.85 ± 0.11; 0.57 ± 0.10, 0.55 ± 0.09, 0.88 ± 0.13, 1.08 ± 0.17, 1.05 ± 0.18 and 0.49 ± 0.09, respectively. Two-way ANOVA revealed significant effects of different ferrule heights and crown-to-root ratios on the fracture resistance (P < 0.001), but no difference in fracture resistance between two post-and-core systems (P = 0.973). The highest fracture strengths of the specimen were found with the ferrule length of 1.92 mm in group FP and 2.07 mm in group MP, the crown-to-root ratio of which in 0.90 and 0.92 respectively., there is a significant difference in fracture patterns among the groups(P < 0.05). CONCLUSIONS: When a certain height of ferrule is prepared and a cast metal or fiber post-and-core system is restored for the residual root, the clinical crown-to-root ratio of the tooth after restoration should be kept within 0.90 to 0.92, so as to improve the fracture resistance of endodontically-treated mandibular first premolars.