Aristaless-related homeobox gene, the gene responsible for West syndrome and related disorders, is a Groucho/transducin-like enhancer of split dependent transcriptional repressor.

Aristaless-related homeobox gene (ARX) is an important paired-type homeobox gene involved in the development of human brain. The ARX gene mutations are a significant contributor to various forms of X-chromosome-linked mental retardation with and without additional features including epilepsy, lissencephaly with abnormal genitalia, hand dystonia or autism. Here we demonstrate that the human ARX protein is a potent transcriptional repressor, which binds to Groucho/transducin-like enhancer of split (TLE) co-factor proteins and the TLE1 in particular through its octapeptide (Engrailed homology repressor domain (eh-1) homology) domain. We show that the transcription repression activity of ARX is modulated by two strong repression domains, one located within the octapeptide domain and the second in the region of the polyalanine tract 4, and one activator domain, the aristaless domain. Importantly, we show that the transcription repression activity of ARX is affected by various naturally occurring mutations. The introduction of the c.98T>C (p.L33P) mutation results in the lack of binding to TLE1 protein and relaxed transcription repression. The introduction of the two most frequent ARX polyalanine tract expansion mutations increases the repression activity in a manner dependent on the number of extra alanines. Interestingly, deletions of alanine residues within polyalanine tracts 1 and 2 show low or no effect. In summary we demonstrate that the ARX protein is a strong transcription repressor, we identify novel ARX interacting proteins (TLE) and offer an explanation of a molecular pathogenesis of some ARX mutations, including the most frequent ARX mutations, the polyalanine tract expansion mutations, c.304ins(GCG)7 and c.428_451dup.

Molecular genetics of X-linked mental retardation: a complex picture emerging.

Mental retardation or intellectual disability is a heterogeneous group of disorders of the human brain affecting 2-3% of the general population. It is becoming evident that a large proportion of mental retardation is genetically determined, which means that it can be molecularly defined and thus precisely diagnosed. Building knowledge and understanding about molecular processes leading to 'malfunction of human brain' will clearly bring benefits to patient management, disease prevention and ultimately disease treatment and will also assist in tackling much harder questions of the molecular basis of human cognitive ability. In this review the current knowledge of the molecular genetics of X-chromosome-linked mental retardation and its nonspecific forms in particular is discussed, together with limitations affecting diagnosis and likely new approaches that need to be implemented.

Common chromosomal fragile site FRA16D sequence: identification of the FOR gene spanning FRA16D and homozygous deletions and translocation breakpoints in cancer cells.

Fluorescence in situ hybridization of a tile path of DNA subclones has previously enabled the cyto-genetic definition of the minimal DNA sequence which spans the FRA16D common chromosomal fragile site, located at 16q23.2. Homozygous deletion of the FRA16D locus has been reported in adenocarcinomas of stomach, colon, lung and ovary. We have sequenced the 270 kb containing the FRA16D fragile site and the minimal homozygously deleted region in tumour cells. This sequence enabled localization of some of the tumour cell breakpoints to regions which contain AT-rich secondary structures similar to those associated with the FRA10B and FRA16B rare fragile sites. The FRA16D DNA sequence also led to the identification of an alternatively spliced gene, named FOR (fragile site FRA16D oxidoreductase), exons of which span both the fragile site and the minimal region of homozygous deletion. In addition, the complete DNA sequence of the FRA16D-containing FOR intron reveals no evidence of additional authentic transcripts. Alternatively spliced FOR transcripts (FOR I, FOR II and FOR III) encode proteins which share N-terminal WW domains and differ at their C-terminus, with FOR III having a truncated oxidoreductase domain. FRA16D-associated deletions selectively affect the FOR gene transcripts. Three out of five previously mapped translocation breakpoints in multiple myeloma are also located within the FOR gene. FOR is therefore the principle genetic target for DNA instability at 16q23.2 and perturbation of FOR function is likely to contribute to the biological consequences of DNA instability at FRA16D in cancer cells.

Chromosomal fragile site FRA16D and DNA instability in cancer.

It has been proposed that common aphidicolin-inducible fragile sites, in general, predispose to specific chromosomal breakage associated with deletion, amplification, and/or translocation in certain forms of cancer. Although this appears to be the case for the fragile site FRA3B and may be the case for FRA7G, it is not yet clear whether this association is a general property of this class of fragile site. The major aim of the present study was to determine whether the FRA16D chromosomal fragile site locus has a role to play in predisposing DNA sequences within and adjacent to the fragile site to DNA instability (such as deletion or translocation), which could lead to or be associated with neoplasia. We report the localization of FRA16D within a contig of cloned DNA and demonstrate that this fragile site coincides with a region of homozygous deletion in a gastric adenocarcinoma cell line and is bracketed by translocation breakpoints in multiple myeloma, as reported previously (Chesi, M., et al., Blood, 91: 4457-4463, 1998). Therefore, given similar findings at the FRA3B and FRA7G fragile sites, it is likely that common aphidicolin-inducible fragile sites exhibit the general property of localized DNA instability in cancer cells.

FRA10B structure reveals common elements in repeat expansion and chromosomal fragile site genesis.

A common mechanism for chromosomal fragile site genesis is not yet apparent. Folate-sensitive fragile sites are expanded p(CCG)n repeats that arise from longer normal alleles. Distamycin A or bromodeoxyuridine-inducible fragile site FRA16B is an expanded AT-rich approximately 33 bp repeat; however, the relationship between normal and fragile site alleles is not known. Here, we report that bromodeoxyuridine-inducible, distamycin A-insensitive fragile site FRA10B is composed of expanded approximately 42 bp repeats. Differences in repeat motif length or composition between different FRA10B families indicate multiple independent expansion events. Some FRA10B alleles comprise a mixture of different expanded repeat motifs. FRA10B fragile site and long normal alleles share flanking polymorphisms. Somatic and intergenerational FRA10B repeat instability analogous to that found in expanded trinucleotide repeats supports dynamic mutation as a common mechanism for repeat expansion.

A high-resolution genetic map of the familial Mediterranean fever candidate region allows identification of haplotype-sharing among ethnic groups.

Familial Mediterranean fever (FMF) is a recessive disorder of inflammation caused by mutations in a gene (designated MEFV) on chromosome 16p13.3. We have recently constructed a 1-Mb cosmid contig that includes the FMF critical region. Here we show genotype data for 12 markers from our physical map, including 5 newly identified microsatellites, in FMF families. Intrafamilial recombinations placed MEFV in the approximately 285 kb between D16S468/D16S3070 and D16S3376. We observed significant linkage disequilibrium in the North African Jewish population, and historical recombinants in the founder haplotype placed MEFV between D16S3082 and D16S3373 (approximately 200 kb). In smaller panels of Iraqi Jewish, Arab, and Armenian families, there were significant allelic associations only for D16S3370 and D16S2617 among the Armenians. A sizable minority of Iraqi Jewish and Armenian carrier chromosomes appeared to be derived from the North African Jewish ancestral haplotype. We observed a unique FMF haplotype common to Iraqi Jews, Arabs, and Armenians and two other haplotypes restricted to either the Iraqi Jewish or the Armenian population. These data support the view that a few major mutations account for a large percentage of the cases of FMF and suggest that some of these mutations arose before the affected Middle Eastern populations diverged from one another.

Genetic heterogeneity in familial acute myelogenous leukemia: evidence for a second locus at chromosome 16q21-23.2.

The identification of genes responsible for the rare cases of familial leukemia may afford insight into the mechanism underlying the more common sporadic occurrences. Here we test a single family with 11 relevant meioses transmitting autosomal dominant acute myelogenous leukemia (AML) and myelodysplasia for linkage to three potential candidate loci. In a different family with inherited AML, linkage to chromosome 21q22.1-22.2 was recently reported; we exclude linkage to 21q22.1-22.2, demonstrating that familial AML is a heterogeneous disease. After reviewing familial leukemia and observing anticipation in the form of a declining age of onset with each generation, we had proposed 9p21-22 and 16q22 as additional candidate loci. Whereas linkage to 9p21-22 can be excluded, the finding of a maximum two-point LOD score of 2.82 with the microsatellite marker D16S522 at a recombination fraction theta = 0 provides evidence supporting linkage to 16q22. Haplotype analysis reveals a 23.5-cM (17.9-Mb) commonly inherited region among all affected family members extending from D16S451 to D16S289. In order to extract maximum linkage information with missing individuals, incomplete informativeness with individual markers in this interval, and possible deviance from strict autosomal dominant inheritance, we performed nonparametric linkage analysis (NPL) and found a maximum NPL statistic corresponding to a P-value of .00098, close to the maximum conditional probability of linkage expected for a pedigree with this structure. Mutational analysis in this region specifically excludes expansion of the AT-rich minisatellite repeat FRA16B fragile site and the CAG trinucleotide repeat in the E2F-4 transcription factor. The "repeat expansion detection" method, capable of detecting dynamic mutation associated with anticipation, more generally excludes large CAG repeat expansion as a cause of leukemia in this family.

Construction of a 1-Mb restriction-mapped cosmid contig containing the candidate region for the familial Mediterranean fever locus (MEFV) on chromosome 16p 13.3.

In this paper we describe the assembly and restriction map of a 1.05-Mb cosmid contig spanning the candidate region for familial Mediterranean fever (FMF), a recessively inherited disorder of inflammation localized to 16p13.3. Using a combination of cosmid walking and screening for P1, PAC, BAC, and YAC clones, we have generated a contig of genomic clones spanning approximately 1050 kb that contains the FMF critical region. The map consists of 179 cosmid, 15 P1, 10 PAC, 3 BAC, and 17 YAC clones, anchored by 27 STS markers. Eight additional STSs have been developed from the approximately 700 kb immediately centromeric to this genomic region. Five of the 35 STSs are microsatellites that have not been previously reported. NotI and EcoRI mapping of the overlapping cosmids, hybridization of restriction fragments from cosmids to one another, and STS analyses have been used to validate the assembly of the contig. Our contig totally subsumes the 250-kb interval recently reported, by founder haplotype analysis, to contain the FMF gene. Thus, our high-resolution clone map provides an ideal resource for transcriptional mapping toward the eventual identification of this disease gene.

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Dynamic mutation loci: allele distributions in different populations.

To assess the relative contributions of trans-acting factors (replication and repair functions) and cis-acting elements (repeat and flanking DNA composition) to the mechanism of trinucleotide repeat sequence mutation we have analysed the distribution of copy number polymorphisms at 12 loci associated with dynamic mutations in 15 populations of different ethnic origins. Genome wide instability of repeats in a particular population would be evidence of trans-acting factor instigation of the mutation process, whereas instability at a particular locus (perhaps even in several populations) would be evidence that the composition of the particular locus was the most significant factor contributing to mutation. The FRA16A locus is highly polymorphic in only the European population. Some other loci exhibit distinct distributions of alleles between different populations. Therefore sequences in the vicinity of the repeat -- the cis component of a particular locus -- appear(s) to be more important in the mutation mechanism than sporadic genome-wide instability induced by trans-acting factors such as the DNA mismatch repair enzymes.

Molecular basis of p(CCG)n repeat instability at the FRA16A fragile site locus.

Rare, folate-sensitive fragile sites are the result of the unstable expansion of trinucleotide p(CCG)n repeats, which are normally polymorphic in copy number. Differences in the number and frequency of alleles of the fragile site FRA16A p(CCG)n repeat were observed between different ethnic populations suggesting that certain alleles might be predisposed to instability. Sequence analysis demonstrated that the longer and more variable alleles were associated with loss of repeat interruption. Perfect repeat configuration therefore appears to be a necessary precondition for the instability associated with fragile site genesis.