Conocimientos, prácticas y actitudes de enfermería para la atención de personas con tuberculosis / Nursing knowledge, practices, and attitudes regarding the attention of persons with tuberculosis / Conhecimentos, práticas e atitudes de enfermagem para a atenção de pessoas com tuberculose

Resumen Introducción: La tuberculosis es un padecimiento con una gran carga económica y social; representa una de las 10 causas principales de mortalidad a nivel mundial. Múltiples factores intervienen en la adherencia al tratamiento y cura de la enfermedad. La atención de enfermería estudiada desde 3 indicadores (conocimiento, práctica y actitud), que son determinantes cruciales para el cumplimiento de una atención de calidad y para la implementación de nuevas tecnologías de cuidados; es imprescindible. Objetivo: Evaluar los conocimientos, prácticas y actitudes de enfermería relacionados con la atención de pacientes con tuberculosis. Metodología: Estudio cuantitativo, descriptivo, muestra no probabilística de 19 enfermeras(os) del primer nivel de atención. Se evaluaron los conocimientos básicos generales, los relacionados con el diagnóstico y con el tratamiento. Las prácticas comprendieron la identificación de recursos para el registro, las visitas, la elaboración de planes de cuidados de enfermería, además del uso de una herramienta digital que se brindó para facilitar la elaboración de dichos planes. En actitudes, se evaluaron tres componentes: cognitivo, conductual y afectivo. Resultados: Se identificó una base débil de conocimientos en tuberculosis; la mayor parte mostró un nivel de conocimiento medio y bajo. Poco más de la mitad de los participantes se ubicó con una práctica regular y, de manera general, la actitud al brindar los cuidados fue buena. Conclusiones: Se requiere fortalecer la atención de enfermería en tuberculosis desde los tres indicadores evaluados. Sin una base consolidada de conocimientos sobre la enfermedad es difícil alcanzar los objetivos de los programas y las políticas en salud pública; esto, a su vez, repercute de manera directa en la práctica y actitud de los profesionales.

Abstract Introduction: Being one of the 10 main causes of mortality worldwide, tuberculosis causes a great economic and social burden to societies. Considering that diverse factors are involved in the treatment adherence, and consequent cure, nursing attention, assessed through the related knowledge, practices, and attitudes, becomes of paramount importance. Objective: To assess the tuberculosis-related knowledge, practices, and attitudes among nurses. Methodology: This is a quantitative and descriptive study with a non-probabilistic sample of 19 nurses in primary care. Regarding knowledge, the basic general, and diagnosis and treatment related were assessed. Regarding practices, the resources identification, visits, care plans, and digital tools use were assessed. Regarding attitudes, the cognitive, behavioral, and affective areas were assessed. Results: The majority of nurses demonstrated a fair or low level of tuberculosis related knowledge. A little more than half of the participants demonstrated a regular or fair level of tuberculosis related practice. In general, the attitudes towards providing tuberculosis care were good. Conclusions: It is necessary to strengthen the tuberculosis related nursing attention in terms of the 3 indicators assessed in this study. Without a sound base of knowledge, an expertised practice, and a good attitude related to addressing the problem of tuberculosis, it is hard to accomplish the objectives, programs, and policies of Public Health, a situation which indirectly, can also have negative impacts on the health professionals.

Resumo Introdução: A tuberculose é uma doença com uma grande carga económica e social, representa uma das 10 causas principais de mortalidade a nível mundial. Múltiplos fatores intervêm na aderência ao tratamento e cura da doença. A atenção de enfermagem estudada desde 3 indicadores (conhecimento, prática e atitude), que são determinantes cruciais para o cumprimento de uma atenção de qualidade e para a implementação de novas tecnologias de cuidados, é imprescindível. Objetivo: Avaliar os conhecimentos, práticas e atitudes de enfermagem relacionados com a atenção de pacientes com tuberculose. Metodologia: Estudo quantitativo, descritivo, amostra não probabilística de 19 enfermeiras (os) do primeiro nível de atenção. Avaliaram-se os conhecimentos básicos gerais, os relacionados com o diagnóstico e, com o tratamento. As práticas compreenderam a identificação de recursos para o registro, as visitas, a elaboração de planos de cuidados de enfermagem, além disso do uso de uma ferramenta digital que se proporcionou para facilitar a elaboração desses planos. Em atitudes avaliaram-se três componentes: cognitivo, comportamental e afetivo. Resultados: Identificou-se uma base de conhecimentos em tuberculose fraca, a maior parte mostrou um nível de conhecimento médio e baixo. Pouco mais da metade dos participantes situou-se com uma prática regular e de maneira geral, a atitude de proporcionar os cuidados foi adequada. Conclusões: É preciso fortalecer a atenção de enfermagem em tuberculose desde os três indicadores avaliados. Sem uma base consolidada de conhecimentos sobre a doença é difícil atingir os objetivos dos programas e as políticas em saúde pública; isto por sua vez, repercute de forma direta na prática e atitude dos professionais.

Prevención de extubación no programada en pacientes con ventilación mecánica invasiva / Prevention of non-programed tube-extractions among patients with invasive mechanical ventilation / Prevenção de extubação não programada em pacientes com ventilação mecânica invasiva

Introducción Las extubaciones no programadas constituyen un evento adverso frecuente y de alto impacto, en la mayoría de los casos la presencia de este evento se relaciona con factores como la vía aérea, ventilación mecánica, nivel de sedación, estado y actividad mental del paciente, entre otros también prevenibles. Por ello, se establece un indicador de calidad para prevenir extubaciones no programadas en pacientes con ventilación mecánica invasiva y tubo endotraqueal. Objetivo Realizar la validación de contenido del indicador y describir el nivel de cumplimiento para la prevención de extubaciones no programadas en pacientes con ventilación mecánica invasiva en un hospital de tercer nivel de la Ciudad de México, con el propósito de dar a conocer nuevos aportes en materia de prevención. Metodología Estudio cuantitativo y descriptivo, con una muestra no probabilística a conveniencia conformada por 46 procesos observados durante el turno matutino en tres servicios de hospitalización. Resultados Se encontró que el 96% de los procesos observados arrojaron un nivel de prevención medio para las extubaciones no programadas. Al evaluar el índice de eficiencia global del indicador, se obtuvo un resultado del 59.8%, lo cual muestra que las acciones para prevenir una extubación no programada se cumplen en un porcentaje muy bajo. Conclusiones Se detectó una omisión de funciones por los profesionales de la salud en la prevención de este evento, por lo que se propuso un plan de mejora para la institución con el propósito de disminuir los eventos relacionados a las extubaciones.

Introduction Non-programed extubation, constitute a frequent high impact adverse event involving issues on the airway, mechanical ventilation, sedation level, patient´s mental activity, among others. Because of this, a quality indicator is established in order to help prevent non-programed extubation among patients with invasive mechanical ventilation and endotracheal tube. Objective To perform a validation of content on this indicator in a third level hospital of the City of Mexico, and describe the level of adherence to its components in order to prevent non-programed extubation among patients with invasive mechanical ventilation and endotracheal tube, and share the resulting contributions in the area of prevention. Methodology This is a quantitative and descriptive study with a non-probabilistic sample by convenience of 46 processes which were observed during the morning shifts in three hospitalization services. Results It was found that 96% of the processes observed showed an insufficient level of prevention of non-programed extubation. The assessment of the efficiency related to indicator´s components showed a 59.8% compliance, suggesting that the actions to prevent non-programed extubation are not sufficiently taken. Conclusions An important related omission by health professionals regarding the prevention of this kind of adverse events was detected, and thus, a corresponding improvement plan for the institution was proposed.

Introdução As extubaçãos não programadas constituem um evento adverso frequente e de alto impacto, na maioria dos casos, a presença deste evento relaciona-se com fatores como a via aérea, ventilação mecânica, nível de sedação, estado e atividade mental do paciente, entre outros, também preveníeis. Por isso, estabelece-se um indicador de qualidade para prevenir extubaçãos não programadas em pacientes com ventilação mecânica invasiva e tubo endotraqueal. Objetivo Realizar a validação de conteúdo do indicador e descrever o nível de cumprimento para a prevenção de extubaçãos não programadas em pacientes com ventilação mecânica invasiva em um hospital de terceiro nível da Cidade do México, com o propósito de dar a conhecer novas contribuições em matéria de prevenção. Metodologia Estudo quantitativo e descritivo, com uma amostra não probabilística a conveniência, conformada por 46 processos observados durante o turno matutino em três serviços de hospitalização. Resultados Encontrou-se que o 96% dos processos observados revelaram um nível de prevenção médio para as extubaçãos não programadas. Avaliando o índice de eficiência global do indicador, obteve-se um resultado do 59.8%, o qual mostra que as ações para prevenir uma extubação não programada cumprem-se em uma porcentagem muito baixa. Conclusões Identificou-se uma omissão de funções pelos profissionais da saúde na prevenção deste evento, pelo que se propus um plano de melhora para a instituição com o propósito de diminuir os eventos relacionados às extubaçãos.

Migración intraarticular del bloqueo óseo tibial tras la reconstrucción del ligamento cruzado anterior con injerto hueso-tendón-hueso / Intra-articular migration of a tibial bone block after an anterior cruciate ligament reconstruction using a bone-tendon-bone graft

Resumen: Presentamos el caso de una paciente que tras una reconstrucción del ligamento cruzado anterior (LCA) con injerto hueso-tendón-hueso (HTH) presentó una protrusión intraarticular del bloque óseo tibial en la radiografía postoperatoria de control. Se postuló la divergencia entre el túnel óseo tibial y el tornillo de interferencia como causa fundamental de la migración del injerto. Varios trabajos en modelos animales asocian dicho supuesto a una menor resistencia a la tracción. No se ha encontrado en la bibliografía médica publicada hasta la fecha ningún reporte clínico que describa esta complicación.

Abstract: We report the case of a patient that presented an intra-articular protrusion of the tibial bone block after an arthroscopically-assisted ACL reconstruction using a bone-patellar tendon-bone graft. The divergence between the tunnel and the screw was thought to be the reason of the migration. There are several animal-model studies that evidence a relationship between the decreased fixation of the graft and the tunnel-screw divergence. To the best of our knowledge, this is the first report of this complication.

[Intra-articular migration of a tibial bone block after an anterior cruciate ligament reconstruction using a bone-tendon-bone graft]. / Migración intraarticular del bloqueo óseo tibial tras la reconstrucción del ligamento cruzado anterior con injerto hueso-tendón-hueso.

We report the case of a patient that presented an intra-articular protrusion of the tibial bone block after an arthroscopically-assisted ACL reconstruction using a bone-patellar tendon-bone graft. The divergence between the tunnel and the screw was thought to be the reason of the migration. There are several animal-model studies that evidence a relationship between the decreased fixation of the graft and the tunnel-screw divergence. To the best of our knowledge, this is the first report of this complication.

Presentamos el caso de una paciente que tras una reconstrucción del ligamento cruzado anterior (LCA) con injerto hueso-tendón-hueso (HTH) presentó una protrusión intraarticular del bloque óseo tibial en la radiografía postoperatoria de control. Se postuló la divergencia entre el túnel óseo tibial y el tornillo de interferencia como causa fundamental de la migración del injerto. Varios trabajos en modelos animales asocian dicho supuesto a una menor resistencia a la tracción. No se ha encontrado en la bibliografía médica publicada hasta la fecha ningún reporte clínico que describa esta complicación.

Combining ability of S3 progenies for key agronomic traits in popcorn: comparison of testers in top-crosses.

The successful development of hybrid cultivars depends on the reliability of estimated combining ability of the parent lines. The objectives of this study were to assess the combining ability of partially inbred S3 families of popcorn derived from the open-pollinated variety UENF 14, via top-crosses with four testers, and to compare the testers for their ability to discriminate the S3 progenies. The experiment was conducted in the 2015/2016 crop season, in an incomplete-block (Lattice) design with three replications. The following agronomic traits were evaluated: average plant height, grain yield (GY), popping expansion (PE), and expanded popcorn volume per hectare. The top-cross hybrid, originating from the BRS-Angela vs S3 progeny 10 combination, was indicated as promising, showing high values for specific combining ability for GY and PE. For the S3 progenies that showed high and positive GCA values for GY and PE, the continuity of the breeding program is recommended, with the advance of self-pollination generations. Fasoulas' differentiation index discriminated the BRS-Angela tester as the most suitable for identifying the superior progenies.

PP078. Total antioxidant capacity in patients with pregnancy induced hypertension: Its relation to maternal and/or perinatal complications.

INTRODUCTION: Pregnancy-induced hypertension (PIH) is a major cause of maternal and perinatal mortality and morbidity, particularly in under-resourced countries, like Mexico. Studies on PIH have shown increased oxidative stress products such as malondialdehyde and decrease of total antioxidant capacity (TAC). In this research we measured one marker of oxidative stress (OS) the TAC in patients with PIH and we associated it with the development of maternal and/or fetal complications. OBJECTIVES: Determine whether the plasma level of total antioxidant capacity (as a marker of oxidative stress) influences the development of maternal and/or perinatal complications in patients with PIH. METHODS: A observational, analytical, clinical study was conducted in patients with gestational hypertension (GH), mild preeclampsia (MP), severe preeclampsia (SP) and normal pregnancy (NP) > or = 28weeks gestational age. Serum samples were collected and stored at -70°C until use for the determination of total antioxidant capacity. It was associated with the development of maternal and/or perinatal complications. RESULTS: TAC level in normotensive patients (NP) was mean of 2679 +/- 2014mEq/L while in hypertensive patients (GH, MP, SP) was on mean of 1502 +/-1340mEq/L (p<0.05), in the GH group was 1620 +/-1042mEq/L, in the MP group was 1977 +/-1865mEq/L, in the SP was 819 +/-305meq/L The mean TAC level in the 29 patients who had maternal and/or perinatal complications was 1521mEq/L, while in the 38 patients who showed no maternal and/or perinatal complications the mean was 2355mEq/L (p<0.05). Of the 29 patients who had complications 15 (52%) had greatly diminished TAC levels (less than 1000mEq/L), 9 (31%) had between 1000 and 2500mEq/L and only 5 (17%)>2500mEq/L. 72% (28/39) of PIH group had one or more maternal and/or perinatal complications, while only 1 patient (3.6%) of 28 patients with NP had one or more maternal and/or perinatal complications (p<0.05). CONCLUSION: Patients with decreased TAC level had a higher percentage of maternal and/or perinatal complications. Patients with PIH classified as mild preeclampsia, showing reduced TAC level should be in close observation as they have the risk of developing life-threatening complications since management is usually as outpatient.

First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica.

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5'-TGGATCTCACTGGTTGCTTG-3')-ToCVp22RQR (5'-TAGTGTTTCAGCGCCAACAG-3') primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5'-CATTGGTTGGGGATTACGTC-3')-ToCVCPmRQR (5'-TCTCAGCCTTGACTTGAGCA-3') primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

First Report of Tomato chlorosis virus in Tomato in Costa Rica.

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5'-ATGGATCTCACTGGTTGCTTGC-3') and ToCV-p22-R (5'-TTATATATCACTCCCAAAGAAA-3') specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5'-TCTGGCAGTACCCGTTCGTGA-3') and ToCVCPmR (5'-TACCGGCAGTCGTCCCATACC-3') designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5'-GGCGGTACTTTCGACACTTCTT-3') and ToCVHSP70R (5'-ATTAACGCGCAAAACCATCTG-3') designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Buschke-Löwenstein tumor in childhood: a case report.

Buschke-Löwenstein tumor or giant condyloma is a warty verrucous lesion, characterized by slow growth, locally infiltrating and disfiguring lesions. Despite its benign histological appearance and low risk of metastasis, Buschke-Löwenstein tumor is an intermediate lesion between condyloma acuminatum and verrucous carcinoma. It has been linked to human papilloma virus, mainly subtypes 6 and 11. Other factors implicated in this disease include poor hygiene, chronic irritation, promiscuity, and cellular immunocompromised states. It rarely occurs in children. The first line of treatment is radical surgical excision with or without adjuvant chemotherapy. We report the case of a 12-year-old girl with a giant perianal condyloma that was treated with surgical excision and a 6-week course of 5-fluorouracil beginning 6 weeks after surgery, with excellent functional and cosmetic results.

First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica.

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5' GAGCGCCGCACAAGTCATC 3' and CYHSPR 5' TACCGCCACCAAAGTCATACATTA 3') of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5' GGCTGGCAACATGGAAACTGA 3' and MYVR 5' CTGAAAAGGCGATGAACTA TTGTG 3') were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

Effect of organic carbon shock loading on endogenous denitrification in sequential batch reactors.

This work was focused on the performance evaluation of sequential batch reactors (SBR) treating sewage, through a process of endogenous biological denitrification. Different operational conditions were carried out, and the behaviour under the effects of organic shock loading was examined. Three laboratory scale reactors were operated simultaneously and fed with similar wastewater. The substratum was molasses and nitrate, as carbon and nitrogen sources, respectively. The three reactors were operated during different aeration periods (0, 15 and 30 min). Sudden changes (shock loading) in organic matter concentration were performed during the experiment. Thus, influent load was quickly increased threefold in relation to the original concentration. Results indicated that SBR reactors withstand adequately moderate shock loading. With regard to substratum degradation, nitrate elimination achieved was approximately 80%, while denitrification rate was approximately 0.87 mgg(-1)h(-1).

Real-time ECG transmission via Internet for nonclinical applications.

Telemedicine is producing a great impact in the monitoring of patients located in remote nonclinical environments such as homes, elder communities, gymnasiums, schools, remote military bases, ships, and the like. A number of applications, ranging from data collection, to chronic patient surveillance, and even to the control of therapeutic procedures, are being implemented in many parts of the world. As part of this growing trend, this paper discusses the problems in electrocardiogram (ECG) real-time data acquisition, transmission, and visualization over the Internet. ECG signals are transmitted in real time from a patient in a remote nonclinical environment to the specialist in a hospital or clinic using the current capabilities and availability of the Internet. A prototype system is composed of a portable data acquisition and preprocessing module connected to the computer in the remote site via its RS-232 port, a Java-based client-server platform, and software modules to handle communication protocols between data acquisition module and the patient's personal computer, and to handle client-server communication. The purpose of the system is the provision of extended monitoring for patients under drug therapy after infarction, data collection in some particular cases, remote consultation, and low-cost ECG monitoring for the elderly.

Atrial activity enhancement by Wiener filtering using an artificial neural network.

This paper describes a novel technique for the cancellation of the ventricular activity for applications such as P-wave or atrial fibrillation detection. The procedure was thoroughly tested and compared with a previously published method, using quantitative measures of performance. The novel approach estimates, by means of a dynamic time delay neural network (TDNN), a time-varying, nonlinear transfer function between two ECG leads. Best results were obtained using an Elman TDNN with nine input samples and 20 neurons, employing a sigmoidal tangencial activation in the hidden layer and one linear neuron in the output stage. The method does not require a previous stage of QRS detection. The technique was quantitatively evaluated using the MIT-BIH arrhythmia database and compared with an adaptive cancellation scheme proposed in the literature. Results show the advantages of the proposed approach, and its robustness during noisy episodes and QRS morphology variations.

Tratamiento específico del infarto cerebral agudo. Presente y futuro / Specific treatment of acute cerebral infarction. Present and future

Las estrategias farmacológicas específicas en el tratamiento de la fase aguda del infarto cerebral se orientan a potenciar la reperfusión (antitrombóticos o trombolíticos) y la neuroprotección lo más precozmente posible. Desarrollo: los antitrombóticos son anticoagulantes, hipofibrinogemiantes (Ancrod) y antiagregantes. Con anticoagulantes se realizó el IST, empleando heparinas que causó un aumento de hemorragias sin beneficio neto evidente. Otros usaron heparinoides (TOAST) o heparinas de bajo peso molecular (FISS y FISS bis) y tampoco demostraron ningún beneficio y si un exceso de hemorragia en el primerio. En cuanto a Ancrod, acaba de concluir en ensayo en Norteamérica (STAT) con administración en < 3 horas que ha indicado beneficio significativo a los tres meses. Continúa otro europeo (ESTAT). Respecto a los antiagregantes, con ácido acetilsalicílico se realizaron el IST y el CAST en los que ha aprecido una reducción de recurrencias precoces y un aumento de las repercusiones, por lo que se ha recomendado su uso en las primeras 48 horas. Existen estudios con abcximab, un antagonista de receptores glicoproteína IIb-IIIa, uno en fase II en AVC ha demostrado que es seguro y que los paceintes tratados tienden a evolucionar mejor. Está en desarrollo otro fase III. Los trombolíticos han sido evaluados en diversos ensayos. Por vía IA el estudio PROACT valoró por-UK frente a placebo y demostró repermeabilización significativa en oclusiones de la arteria cerebral media, pero con mayor númer de hemorragias y sin una reducción de mortalidad. En PROACT II aparece mejor evolución en los pacientes tratados. Por vía IV, el ensayo NINDS con rt-PA (0.9 mg/kg en <3h) demostró una mejoría a los tres meses que se contrarrestó con un aumento de hemorragias cerebrales y mortalidad. El ECASS-II, con dosis similares al NINDS e idéntica ventaja que el ECASS, demostró un tendencia favorable en la evolución del grupo tratado sin aumento de las hemorragias intracraneales sintomáticas.

Etiological characterization of 512 severely mentally retarded institutionalized patients in havana.

OBJECTIVE: To investigate etiological factors in severe mental retardation (SMR). METHODS: An etiological study is presented of 512 SMR patients in five specialized institutions in Havana. RESULTS: Prenatal, perinatal and postnatal causes were apparent in 58.0, 24.8 and 11.1% of the patients, respectively; infantile psychosis was determined in only 0.4%. The remaining 5.6% were classified as having SMR of undeterminable origin, i.e. patients with apparently normal pre-, peri- and postnatal histories who had neither dysmorphism nor affected first-degree relatives, and had a normal karyotype and metabolic screen. Among prenatal causes, genetic factors were the most frequent (82.8%), while environmental factors were apparent in only 5.3% of these cases. Of the cases with prenatal genetic etiology, chromosomal aberrations were present in 86.5% (Down syndrome 96.2% and 3.7% other chromosomal aberrations), monogenic disorders in 11.3% [neurocutaneous diseases (32.1%) and fragile X syndrome (25%) were the most frequent], and multifactorial disorders in 2.0%. Thirty-five patients (11.7%) presented multiple congenital anomalies of 'prenatal unknown' causes. The latter group may include unidentifiable chromosomal aberrations, uniparental disomy, de novo mutations and multifactorial or teratogenic factors. CONCLUSION: Accurate determination of the etiology of SMR is important not only for genetic counseling purposes, but also in identifying prenatal events which make infants more vulnerable to perinatal risk factors.

[High resolution ECG signals in Chagas patients: SEARCH project]. / Señales Electrocardiográficas de Alta Resolución en Chagas: el proyecto SEARCH.

This work presents contributions to the study of a public health problem known as Chagasic Myocarditis. The results of the efforts done in Venezuela to understand the evolution of this disease through a novel technique called High Resolution Electrocardiography (HRECG) are discussed. A review of this methodology is presented and also its potential as a tool to study Chagas disease and to diagnose its different myocardial manifestations is discussed in detail. Several research approaches are presented as well as the results obtained, new techniques for HRECG interpretation such as the analysis of signals from the P-R segment, the intra QRS potentials, and late potentials. This method contributes to early detection and follow up of Chagas myocarditis. The collection and the organization of a HRECG data base that served as the basis for SEARCH, which is a valuable resource for new research lines is also described.

Bartter syndrome in Costa Rica: a description of 20 cases.

Bartter syndrome involves an overlapping set of closely related renal tubular disorders which can be subdivided into at least three clinical phenotypes: (1) classic Bartter syndrome (2) Gitelman syndrome, and (3) a neonatal variant of Bartter syndrome. In contrast to classic Bartter syndrome and Gitelman syndrome, the neonatal variant of Bartter syndrome has both the features of renal tubular hypokalemic alkalosis as well as profound systemic manifestations. Specifically, neonatal Bartter syndrome is characterized by intrauterine polyhydramnios, premature delivery, and life-threatening episodes of fever and dehydration. Most of these infants also have severe hypercalciuria with associated nephrocalcinosis and osteopenia. Over a 22-year period, 20 Costa Rican patients with a congenital syndrome that resembles neonatal Bartter syndrome have been identified and characterized. While these patients exhibit some of the clinical characteristics previously described for neonatal Bartter syndrome, this cohort also has a set of distinct features. They are predominantly female, have a later age of diagnosis, manifest a relatively unique set of physical traits, and appear to have milder clinical disease. Given these differences, it will be important to apply the emerging molecular tools to determine whether the phenotypic variability indicates genetic heterogeneity in neonatal-onset Bartter syndrome.