Role of umbilical cord mesenchymal stromal cells in skin rejuvenation.

Aging is the main cause of many degenerative diseases. The skin is the largest and the most intuitive organ that reflects the aging of the body. Under the interaction of endogenous and exogenous factors, there are cumulative changes in the structure, function, and appearance of the skin, which are characterized by decreased synthesis of collagen and elastin, increased wrinkles, relaxation, pigmentation, and other aging characteristics. skin aging is inevitable, but it can be delayed. The successful isolation of mesenchymal stromal cells (MSC) in 1991 has greatly promoted the progress of cell therapy in human diseases. The International Society for Cellular Therapy (ISCT) points out that the MSC is a kind of pluripotent progenitor cells that have self-renewal ability (limited) in vitro and the potential for mesenchymal cell differentiation. This review mainly introduces the role of perinatal umbilical cord-derived MSC(UC-MSC) in the field of skin rejuvenation. An in-depth and systematic understanding of the mechanism of UC-MSCs against skin aging is of great significance for the early realization of the clinical transformation of UC-MSCs. This paper summarized the characteristics of skin aging and summarized the mechanism of UC-MSCs in skin rejuvenation reported in recent years. In order to provide a reference for further research of UC-MSCs to delay skin aging.

Traditional, complementary and integrative medicine for fatigue post COVID-19 infection: A systematic review of randomized controlled trials.

Background: Chronic fatigue is a predominant symptom of post COVID-19 condition, or long COVID. We aimed to evaluate the efficacy and safety of Traditional, Complementary and Integrative Medicine (TCIM) for fatigue post COVID-19 infection. Methods: Ten English and Chinese language databases and grey literature were searched up to 12 April 2023 for randomized controlled trials (RCTs). Cochrane "Risk of bias" (RoB) tool was applied. Evidence certainty was assessed using Grading of Recommendations Assessment, Development, and Evaluation (GRADE). Effect estimates were presented as risk ratio (RR) or mean difference (MD) with 95% confidence interval (CI). Results: Thirteen RCTs with 1632 participants were included. One RCT showed that Bufei Huoxue herbal capsules reduced fatigue (n=129, MD -14.90, 95%CI -24.53 to -5.27), one RCT reported that Ludangshen herbal liquid lowered fatigue (n=184, MD -1.90, 95%CI -2.38 to -1.42), and the other one RCT shown that fatigue disappearance rate was higher with Ludangshen herbal liquid (n=184, RR 4.19, 95%CI 2.06 to 8.53). Compared to traditional Chinese medicine rehabilitation (TCM-rahab) alone, one RCT showed that fatigue symptoms were lower following Qingjin Yiqi granules plus TCM-rehab (n=388, MD -0.48, 95%CI -0.50 to -0.46). Due to concerns with RoB and/or imprecision, the certainty in this evidence was low to very low. No serious adverse events was reported. Conclusions: Limited evidence suggests that various TCIM interventions might reduce post COVID-19 fatigue. Larger, high quality RCTs of longer duration are required to confirm these preliminary findings. Study Registration: The protocol of this review has been registered at PROSPERO: CRD42022384136.

3D-Bioprinted Hepar-on-a-Chip Implanted in Graphene-Based Plasmonic Sensors.

Precise three-dimensional (3D) bioprinting designs enable the fabrication of unique structures for 3D-cell culture models. There is still an absence of real-time detection tools to effectively track in situ 3D-cell performance, hindering a comprehensive understanding of disease progression and drug efficacy assessment. While numerous bioinks have been developed, few are equipped with internal sensors capable of accurate detection. This study addresses these challenges by constructing a 3D-bioprinted hepar-on-a-chip embedded with graphene quantum dot-capped gold nanoparticle-based plasmonic sensors, featuring strong surface-enhanced Raman scattering (SERS) enhancement, biostability, and signal consistency. Such an integrated hepar-on-a-chip demonstrates excellent capability in the secretion of liver function-related proteins and the expression of drug metabolism and transport-related genes. Furthermore, the on-site detection of cell-secreted biomarker glutathione transferase α (GST-α) was successfully achieved using the plasmonic probe, with a dynamic linear detection range of 20-500 ng/mL, showcasing high anti-interference and specificity for GST-α. Ultimately, this integrated hepar-on-a-chip system offers a high-quality platform for monitoring liver injury.

Whole-transcriptome profiling reveals potential biomarkers for the reversal of thymic epithelial cell senescence by umbilical cord mesenchymal stem cells.

BACKGROUND: Reduced numbers and dysfunction of thymic epithelial cells (TECs) are important factors of thymic degeneration. Previous studies have found that umbilical cord mesenchymal stem cells (UCMSCs) reverse the structure and function of the senescent thymus in vivo. However, the transcriptomic regulation mechanism is unclear. METHODS: TECs were cultured with H2O2 for 72 hours to induce senescence. UCMSCs were cocultured with senescent TECs for 48 hours to detect SA-ß-gal, P16 and Ki67. The cocultured TECs were collected for lncRNA, mRNA and miRNA sequencing to establish a competitive endogenous regulatory network (ceRNA). And RT-qPCR, immunofluorescence staining, and western blot were used to identified key genes. RESULTS: Our results showed that H2O2 induced TEC aging and that UCMSCs reversed these changes. Compared with those in aged TECs, 2260 DE mRNAs, 1033 DE lncRNAs and 67 DE miRNAs were differentially expressed, and these changes were reversed by coculturing the cells with UCMSCs. Differential mRNA enrichment analysis of ceRNA regulation revealed that the PI3K-AKT pathway was a significant signaling pathway. UCMSC coculture upregulated VEGFA, which is the upstream factor of the PI3K-AKT signaling pathway, and the expression of the key proteins PI3K and AKT. Thus, the expression of the cell cycle suppressor P27, which is downstream of the PI3K-AKT signaling pathway, was downregulated, while the expression of the cell cycle regulators CDK2 and CCNE was upregulated. CONCLUSION: UCMSC coculture upregulated the expression of VEGFA, activated the PI3K-AKT signaling pathway, increased the expression of CDK2 and CCNE, decreased the expression of P27, and promoted the proliferation of TECs.

Mechanisms of Stem Cells and Their Secreted Exosomes in the Treatment of Autoimmune Diseases.

Stem cells play a therapeutic role in many diseases by virtue of their strong self-renewal and differentiation abilities, especially in the treatment of autoimmune diseases. At present, the mechanism of the stem cell treatment of autoimmune diseases mainly relies on their immune regulation ability, regulating the number and function of auxiliary cells, anti-inflammatory factors and proinflammatory factors in patients to reduce inflammation. On the other hand, the stem cell- derived secretory body has weak immunogenicity and low molecular weight, can target the site of injury, and can extend the length of its active time in the patient after combining it with the composite material. Therefore, the role of secretory bodies in the stem cell treatment of autoimmune diseases is increasingly important.

Cellular and molecular mechanisms of highly active mesenchymal stem cells in the treatment of senescence of rhesus monkey ovary.

BACKGROUND: Recent studies have shown that umbilical cord mesenchymal stem cells have an anti-aging effect in ovaries, but the cellular and molecular mechanisms of HA-MSC ovarian anti-aging remain to be studied. Therefore, we conducted a 10X Genomics single-nucleus transcriptome sequencing experiment on the ovaries of macaque monkeys after HA-MSC treatment. METHODS: The results of cell subgroup classification were visualized by 10X Genomics single nuclear transcriptome sequencing. The aging model of hGCs was established, and the migration ability of the cells was determined after coculture of HA-MSCs and aging hGCs. The genes screened by single nuclear transcriptional sequencing were verified in vitro by qPCR. RESULTS: Compared with the aging model group, the number of cell receptor pairs in each subgroup of the HA-MSC-treated group increased overall. Treatment with 200 µmol/L H2O2 for 48 h was used as the optimum condition for the induction of hGC senescence. After coculture of noncontact HA-MSCs with senescent hGCs, it was found that HA-MSCs can reverse the cell structure, proliferation ability, senescence condition, expression level of senescence-related genes, and expression level of key genes regulating the senescence pathway in normal hGCs. CONCLUSIONS: HA-MSC therapy can improve the tissue structure and secretion function of the ovary through multiple cellular and molecular mechanisms to resist ovarian aging. In vitro validation experiments further supported the results of single-cell sequencing, which provides evidence supporting a new option for stem cell treatment of ovarian senescence.

Application and challenges of stem cells in cardiovascular aging.

With the rapid development of society and the economy, population aging has become a common challenge faced by many countries in the world today. Structural and functional changes in the cardiovascular system can occur with age, increasing the incidence and severity of cardiovascular diseases in older adults. Due to the limited regenerative capacity of myocardial cells, myocardial infarction and its resulting heart failure and congenital heart disease have become the number one killer of human health. At present, the treatment of cardiovascular diseases includes drug therapy and nondrug therapy. Nondrug therapy mainly includes minimally invasive interventional therapy, surgical diagnosis and treatment, and cell therapy. Long-term drug treatment may cause headache due to vasodilation, lower blood pressure, digestive system dysfunction and other side effects. Surgical treatment is traumatic, difficult to treat, and expensive. In recent years, stem cell therapy has exhibited broad application prospects in basic and clinical research on cardiovascular disease because of its plasticity, self-renewal and multidirectional differentiation potential. Therefore, this paper looks at stem cell therapy for diseases, reviews recent advances in the mechanism and clinical transformation of cardiovascular aging and related diseases in China, and briefly discusses the development trend and future prospects of cardiovascular aging research.

Identification of functional genes regulating gastric cancer progression using integrated bioinformatics analysis.

BACKGROUND: Gastric cancer (GC) is one of the most common cancers and has a poor prognosis. Treatment of GC has remained unchanged over the past few years. AIM: To investigate the potential therapeutic targets and related regulatory biomarkers of GC. METHODS: We obtained the public GC transcriptome sequencing dataset from the Gene Expression Omnibus database. The datasets contained 348 GC tissues and 141 healthy tissues. In total, 251 differentially expressed genes (DEGs) were identified, including 187 down-regulated genes and 64 up-regulated genes. The DEGs' enriched functions and pathways include Progesterone-mediated oocyte maturation, cell cycle, and oocyte meiosis, Hepatitis B, and the Hippo signaling pathway. Survival analysis showed that BUB1, MAD2L1, CCNA2, CCNB1, and BIRC5 may be associated with regulation of the cell cycle phase mitotic spindle checkpoint pathway. We selected 26 regulated genes with the aid of the protein-protein interaction network analyzed by Molecular Complex Detection. RESULTS: We focused on three critical genes, which were highly expressed in GC, but negatively related to patient survival. Furthermore, we found that knockdown of BIRC5, TRIP13 or UBE2C significantly inhibited cell proliferation and induced cell apoptosis. In addition, knockdown of BIRC5, TRIP13 or UBE2C increased cellular sensitivity to cisplatin. CONCLUSION: Our study identified significantly upregulated genes in GC with a poor prognosis using integrated bioinformatics methods.

Palladium-catalyzed Heck/aminocarbonylation of alkene-tethered carbamoyl chlorides with nitro compounds for the synthesis of carbamoyl-substituted oxindoles.

A straightforward and efficient approach for the synthesis of carbamoyl-substituted oxindoles has been developed via a palladium-catalyzed Heck cyclization and reductive aminocarbonylation reaction of alkene-tethered carbamoyl chlorides with nitro compounds. The reaction showed good compatibility toward versatile functional groups, and both nitroarenes and nitroalkanes were well tolerated. Using Mo(CO)6 as a solid CO source, without external reductants, a broad range of carbamoyl-substituted oxindoles were obtained in moderate to high yields.

Secular Trends in Sleep Conditions in Chinese Elderly Individuals: A National Population-Based Study.

Purpose: As one of the most rapidly aging countries in the world, the elderly population is expected to reach over 400 million in China by 2032. Many studies have suggested a positive association between sleep duration and adverse health events among elderly individuals. This study aimed to investigate the sleep conditions of Chinese elderly individuals between 2005 and 2018. Patients and methods: Data for 53,013 elderly individuals were taken from five cycles of the Chinese Longitudinal Healthy Longevity Survey (CLHLS) during 2005-2018. Sex- and age-specific means and 95% confidence intervals (95% CIs) were used to estimate sleep duration trends. Changes in sleep patterns were explored during this period. The prevalence of short and long sleep durations was assessed and age-standardized by the 2010 census. Finally, self-reported sleep quality was used to determine sleep conditions from another perspective among elderly individuals. Results: The mean sleep duration decreased from 7.87 (95% CI: 7.83-7.91) to 7.29 (95% CI: 7.25-7.33) hours between 2005 and 2018. Changes in sleep duration patterns were found during the study period. The proportion of the elderly population who slept ≤6 hours increased and that of those who slept ≥9 hours decreased noticeably over the past 13 years. The age-standardized prevalence of short sleep duration increased from 32.7% (95% CI: 32.7-32.9%) to 38.4% (95% CI: 38.3-38.5%). A significant decrease was observed in the prevalence of long sleep duration. Conclusion: Sleep conditions are gradually shifting toward a shorter sleep duration and poorer sleep quality among Chinese elderly individuals.

Surface Electronic Structure Engineering of Manganese Bismuth Tellurides Guided by Micro-Focused Angle-Resolved Photoemission.

Modification of the electronic structure of quantum matter by ad atom deposition allows for directed fundamental design of electronic and magnetic properties. This concept is utilized in the present study in order to tune the surface electronic structure of magnetic topological insulators based on MnBi2 Te4 . The topological bands of these systems are typically strongly electron-doped and hybridized with a manifold of surface states that place the salient topological states out of reach of electron transport and practical applications. In this study, micro-focused angle-resolved photoemission spectroscopy (microARPES) provides direct access to the termination-dependent dispersion of MnBi2 Te4 and MnBi4 Te7 during in situ deposition of rubidium atoms. The resulting band structure changes are found to be highly complex, encompassing coverage-dependent ambipolar doping effects, removal of surface state hybridization, and the collapse of a surface state band gap. In addition, doping-dependent band bending is found to give rise to tunable quantum well states. This wide range of observed electronic structure modifications can provide new ways to exploit the topological states and the rich surface electronic structures of manganese bismuth tellurides.

Real-world dose escalation of biologics for moderate-to-severe psoriasis in the United States.

AIM: To compare real-world dose escalation of risankizumab with other US Food and Drug Administration (FDA)-approved biologic treatments for management of moderate-to-severe psoriasis (PsO) in the United States. METHODS: The Merative® MarketScan® Research Database was used to identify adults with ≥2 medical claims for PsO, ≥3 claims of the index biologic medication in the maintenance period, and ≥6 months continuous enrollment pre-induction and ≥6 months after initiation of the maintenance period. Dose escalation was defined as ≥2 dosing intervals where the average daily dose was ≥30% higher than the expected daily dose (per FDA-approved dosing). Comparisons between risankizumab and other cohorts were made using chi-square tests and logistic regression models. RESULTS: At the 30% threshold, the percentage of patients with dose escalation in the full maintenance period was significantly lower with risankizumab (2.0%) compared with other drug classes (tumor necrosis factor, interleukin (IL)-12/23, IL-17, or other IL-23 inhibitors: 17.6%, 10.0%, 18.3%, or 7.1%, respectively; p < 0.0001 for each) and individual biologics (adalimumab, ustekinumab, secukinumab, ixekizumab, and guselkumab; 17.9%, 10.0%, 15.7%, 18.0%, and 7.2%, respectively; p < 0.0001). CONCLUSION: A significantly lower proportion of risankizumab-treated patients with PsO had dose escalations compared with patients treated with other biologics.

Combinations of Digital Breast Tomosynthesis and Full-field Digital Mammography for Different Density Types of Breasts.

BACKGROUND: The combination of FFDM and DBT can significantly improve the diagnostic efficiency of breast cancer, but with the increase of breast radiation absorbed dose. OBJECTIVES: To compare and analyze the radiation dose and diagnostic performance of different mammography positions combinations of digital breast tomosynthesis (DBT) and full-field digital mammography (FFDM) for different density types of breasts. METHODS: This retrospective study involved 1,195 patients who underwent simultaneous breast DBT and FFDM. The mammography combinations were Group A, FFDM(CC+MLO); Group B, FDM(CC)+DBT(MLO); Group C, FFDM(MLO)+DBT(CC); Group D, DBT(CC+MLO); and Group E, FFDM(CC+MLO)+DBT(CC+MLO). An intergroup comparative analysis of radiation dose and diagnostic performance of different combinations of mammography positions for different breast density types was performed using the pathologic and 24-month follow-up results as the diagnostic basis. RESULTS: Overall, 2,403 mammograms indicated 477 cases of non-dense breast tissues and 1,926 cases of dense breast tissues. Differences in the mean radiation dose for each non-dense and dense breast group were statistically significant. The areas under the diagnostic receiver operating characteristic (ROC) curves for the non-dense breast group were not statistically significant. In the dense breast group, the z-values were 1.623 (p = 0.105) and 1.724 (p = 0.085) for the area under the ROC curve in Group C compared with Groups D and E, respectively, and 0.724 (p = 0.469) when comparing Group D with Group E. The differences between the remaining groups were statistically significant. CONCLUSION: Group A had the lowest radiation dose and no significant difference in diagnostic performance compared with the other non-dense breast groups. Group C had high diagnostic performance in the dense breast group considering the low radiation dose.

Van der Waals Engineering of Ultrafast Carrier Dynamics in Magnetic Heterostructures.

Heterostructures composed of the intrinsic magnetic topological insulator MnBi2Te4 and its nonmagnetic counterpart Bi2Te3 host distinct surface electronic band structures depending on the stacking order and exposed termination. Here, we probe the ultrafast dynamical response of MnBi2Te4 and MnBi4Te7 following near-infrared optical excitation using time- and angle-resolved photoemission spectroscopy and disentangle surface from bulk dynamics based on density functional theory slab calculations of the surface-projected electronic structure. We gain access to the out-of-equilibrium charge carrier populations of both MnBi2Te4 and Bi2Te3 surface terminations of MnBi4Te7, revealing an instantaneous occupation of states associated with the Bi2Te3 surface layer followed by carrier extraction into the adjacent MnBi2Te4 layers with a laser fluence-tunable delay of up to 350 fs. The ensuing thermal relaxation processes are driven by phonon scattering with significantly slower relaxation times in the magnetic MnBi2Te4 septuple layers. The observed competition between interlayer charge transfer and intralayer phonon scattering demonstrates a method to control ultrafast charge transfer processes in MnBi2Te4-based van der Waals compounds.

Community centered public safety resilience under public emergencies: A case study of COVID-19.

During public emergencies, the level of public safety will be resilient and follow a process from decline to rise. Regarding the concept and influencing factors of public safety resilience, a three-level public safety resilience framework that includes personal, community, and government levels was proposed in this study. It provided the overall metrics that used the resistance and recovery ability to describe the dynamic characteristics of public safety resilience as well as the resilience assessment indexes on three levels. In the context of the Coronavirus Disease 2019 (COVID-19) pandemic, this study applied the proposed framework in a case study on public safety resilience at the Beihang community, Beijing, China through descriptive statistics, structural equation model, and principal component regression analysis of questionnaire data. The data analysis results showed that community resilience was the most important of the three levels of public safety resilience. In addition, community resilience could improve personal resilience, and government resilience had a positive effect on community and personal resilience. Compared with the resistance ability, the recovery ability was influenced more by the operation and improvement of the community. This study is conducive to understanding and improving public safety resilience on the personal, community, and government levels and can help relevant parties improve their ability to respond to the COVID-19 pandemic. Furthermore, the methods used in this study can be extended to other studies on public emergencies.

Increased Expression of Pluripotent Factors in Human Umbilical Cord Mesenchymal Stem Cells Transfected with Three tRF Molecules.

tRFs and tiRNAs are small noncoding RNA molecules that are widespread in eukaryotic and prokaryotic transcriptomes with extremely powerful functions. We screened three tRF molecules whose expression was stably elevated in reprogrammed cells by tRF and tiRNA sequencing, synthesized these three molecules and transfected them into human umbilical cord mesenchymal stem cells. We detected the pluripotent factor OCT4 by Western Blot (WB) after transfection. The gene and protein expression of the pluripotent genes OCT4 and NANOG increased significantly, and telomere (TEL) expression increased significantly. Cell activity was increased, apoptosis was decreased, and the cell cycle had also changed to some extent. These results showed that the three tRF molecules, tRF-16-K87965D (sequence: CCCGGGTTTCGGCACC), tRF-17-K879652 (sequence: CCCGGGTTTCGGCACCA), and tRF-22-WD8YQ84V2 (sequence: TCGACTCCTGGCTGGCTCGCCA), can promote cell rejuvenation and increase pluripotency.

Structural insights into caspase ADPR deacylization catalyzed by a bacterial effector and host calmodulin.

Programmed cell death and caspase proteins play a pivotal role in host innate immune response combating pathogen infections. Blocking cell death is employed by many bacterial pathogens as a universal virulence strategy. CopC family type III effectors, including CopC from an environmental pathogen Chromobacterium violaceum, utilize calmodulin (CaM) as a co-factor to inactivate caspases by arginine ADPR deacylization. However, the molecular basis of the catalytic and substrate/co-factor binding mechanism is unknown. Here, we determine successive cryo-EM structures of CaM-CopC-caspase-3 ternary complex in pre-reaction, transition, and post-reaction states, which elucidate a multistep enzymatic mechanism of CopC-catalyzed ADPR deacylization. Moreover, we capture a snapshot of the detachment of modified caspase-3 from CopC. These structural insights are validated by mutagenesis analyses of CopC-mediated ADPR deacylization in vitro and animal infection in vivo. Our study offers a structural framework for understanding the molecular basis of arginine ADPR deacylization catalyzed by the CopC family.

Analysis of Maternal and Infant Outcomes and Related Factors of Vaginal Delivery of Second Pregnancy after Cesarean Section.

Objective: To explore the clinical effect of different delivery methods and the safety of vaginal delivery of second pregnancy after cesarean section and analyze the related factors. Methods: A total of 738 eligible pregnant women who underwent cesarean section from September 2018 to August 2020 were randomly selected from our hospital. Among them, 527 pregnant women successfully delivered vaginally were selected as the observation group, and 211 pregnant women who failed vaginal delivery were selected as the control group. To analyze the factors that influence the success of vaginal delivery of second pregnancy after cesarean section and compare the outcomes of mother and infant in two groups. Results: There was no significant difference in age, prenatal body mass index (BMI), and thickness of lower uterine segment between the two groups (P > 0.05). There were significant differences in fetal head orientation, fetal abdominal circumference, fetal biparietal diameter, uterine height, premature rupture of membranes, Bishop score, and epidural anesthesia during labor between the two groups (P < 0.05). Multivariate logistic regression analysis showed that fetal abdominal circumference, fetal head orientation, Bishop score, and epidural anesthesia during labor were independent factors affecting the success of VBAC (P < 0.05). There was no significant difference in the incidence of uterine rupture between the two groups (P > 0.05). The amount of postpartum hemorrhage in the observation group was significantly lower than that in the control group (P < 0.05). There was no significant difference in Apgar score, asphyxia rate, and hospitalization rate between the two groups (P > 0.05). There was no significant difference in the incidence of complications between the two groups (P > 0.05). Conclusion: There are many factors that influence the success of vaginal delivery after cesarean section. Through prenatal comprehensive evaluation of vaginal delivery conditions, we can guide the parturient to choose a reasonable mode of delivery, reduce the incidence of complications, and improve the outcome of mother and baby.