The complete reference genome for grapevine (Vitis vinifera L.) genetics and breeding.

Grapevine is one of the most economically important crops worldwide. However, the previous versions of the grapevine reference genome tipically consist of thousands of fragments with missing centromeres and telomeres, limiting the accessibility of the repetitive sequences, the centromeric and telomeric regions, and the study of inheritance of important agronomic traits in these regions. Here, we assembled a telomere-to-telomere (T2T) gap-free reference genome for the cultivar PN40024 using PacBio HiFi long reads. The T2T reference genome (PN_T2T) is 69 Mb longer with 9018 more genes identified than the 12X.v0 version. We annotated 67% repetitive sequences, 19 centromeres and 36 telomeres, and incorporated gene annotations of previous versions into the PN_T2T assembly. We detected a total of 377 gene clusters, which showed associations with complex traits, such as aroma and disease resistance. Even though PN40024 derives from nine generations of selfing, we still found nine genomic hotspots of heterozygous sites associated with biological processes, such as the oxidation-reduction process and protein phosphorylation. The fully annotated complete reference genome therefore constitutes an important resource for grapevine genetic studies and breeding programs.

Comparison of physicochemical characteristics, antioxidant and immunomodulatory activities of polysaccharides from wine grapes.

In this study, an efficient ultrasonic-assisted extraction method was used for the extraction and optimization of four wine grape polysaccharides. A three-level, three-factor Box Behnken Design combined with the response surface approach was used to optimize the extraction conditions. Their physicochemical properties, molecular structure, antioxidant activity, immunomodulatory activity and hepatoprotective effects were examined and compared. These findings suggest that the four wine grape polysaccharides share similar basic structural features and monosaccharide composition. Furthermore, four wine grape polysaccharides exhibited antioxidant and immunomodulatory activities in a concentration-dependent manner. Moldova (MD) polysaccharide displayed better antioxidant activity and immunomodulatory ability. Furthermore, MD polysaccharide has a significant therapeutic effect on CCl4-induced rat liver injury by improving the antioxidant defense system and inhibiting oxidative stress, indicating that MD has a hepatoprotective effect. Taken together, the MD wine grape polysaccharide may have potential applications in prevention of liver disease in the functional food and pharmaceutical industries.

Assessment of 'Cabernet Sauvignon' Grape Quality Half-Véraison to Maturity for Grapevines Grown in Different Regions.

Grapes are widely cultivated around the world and their quality has distinct regional characteristics. In this study, the qualitative characteristics of the 'Cabernet Sauvignon' grape variety in seven regions, from half-véraison to maturity, were analyzed comprehensively at physiological and transcriptional levels. The results indicated that the quality traits of 'Cabernet Sauvignon' grapes in different regions were significantly different with obvious regionality. Total phenols, anthocyanins, and titratable acids were the main factors of the regionality of berry quality, which were very sensitive to changes in the environment. It should be noted that the changes in titrating acids and total anthocyanin of berries vary greatly from half-véraison to maturity between regions. Moreover, the transcriptional analysis showed that the co-expressed genes between regions characterized the core transcriptome of berry development, while the unique genes of each region reflected the regionality of berries. The differentially expressed genes (DEGs) between half-véraison and maturity can be used to demonstrate that the environment of the regions could promote or inhibit gene expression. The functional enrichment suggested that these DEGs help to understand the interpretation of the plasticity of the quality composition of grapes according to the environment. Taken together, the information generated by this study could contribute to the development of viticultural practices aimed at making better use of native varieties for the development of wines with regional characteristics.

Physicochemical Properties and In Vivo Hepatoprotective Effect of Polysaccharides from Grape Pomace.

Here, the polysaccharides from grape pomace, a by-product in the wine industry, were characterized and evaluated in vitro and in vivo. The polysaccharides were extracted and studied using spectroscopic and chemical methods. The results revealed that GPPs are rich in arabinose, galactose and glucuronic acid and are heteropolysaccharides without protein and nucleic acid, containing α-glycoside bonds with irregular clusters on the surface. In vitro antioxidant activity assays indicated that GPPs have concentration-dependent antioxidant activity. In vivo, GPPs markedly decreased the levels of TNF-a, IL-6, ALT, AST and MDA in serum and liver tissues and restored the levels of SOD, CAT and GSH. Additionally, further histopathological examination confirmed that GPPs could mitigate the injury of liver induced by CCl4. Our results demonstrate that GPPs had antioxidant and hepatoprotective effects, and they are expected to be a potential ingredient for functional foods or hepatoprotective drugs.

Physicochemical characteristics and biological activities of grape polysaccharides collected from different cultivars.

In this study, four wine grape polysaccharides were extracted and optimized by using an efficient ultrasound-assisted extraction. A three-level, three-factor Box Behnken Design (BBD) combining with response surface methodology (RSM) was employed to optimize the extraction conditions including ultrasonic power, ultrasonic time and liquid-to-solid ratio. Furthermore, their physicochemical structures, antioxidant and liver protective activity were investigated and compared. Results revealed that the functional groups and monosaccharide compositions of these grape polysaccharides collected from different varieties were similar. Nevertheless, their molecular weights, molar ratios of monosaccharide compositions and surface morphological features were different. And the antioxidant activities of these polysaccharides were screened by free radical scavenging test. 'Beichun' (BC) and 'Benni fuji' (BF) polysaccharides possessed better antioxidant function. Further, the in vivo evaluation indicated that the polysaccharides of BC and BF have a protective effect against myocardial I/R injury in mice by inhibiting myocardial necroptosis mediated by mitochondrial ROS generation. Therefore, BC and BF grapes have potential applications in the medical and food industries.

Transcriptome and metabolite integrated analysis reveals that exogenous ethylene controls berry ripening processes in grapevine.

Although grapevine (Vitis vinifera L.) is generally classified as a non-climacteric fruit, the regulatory mechanisms of ethylene in the ripening of non-climacteric fruit are still poorly understood. In this study, exogenous ethephon (ETH) strongly stimulated fruit color and anthocyanin accumulation, which was consistent with the increased expression of anthocyanin structural, regulatory, and transport genes. ETH application increased ABA content and decreased IAA content by coordinating ABA and auxin biosynthesis regulatory network. ETH treatment also accelerated sugar (glucose and fructose) accumulation by enhancing the gene expression involved in sugar transport and sucrose cleavage. ETH treatment blocked the synthesis of cellulose and accelerated the degradation of pectin, which was strongly associated with berry softening. To further confirm the function of ethylene biosynthesis and signaling genes, transient overexpression of VvACO4 and VvEIL3 were performed in both in tomato and strawberry fruits. These findings of the ethylene cascade add to our understanding of ethylene in non-climacteric berry ripening regulation and revealed a complex involvement of ethylene and its interplay with phytohormones during grapevine berry ripening.

Effects of ethylene on berry ripening and anthocyanin accumulation of 'Fujiminori' grape in protected cultivation.

BACKGROUND: Although the grape berries are deliberated as a non-climacteric fruit, ethylene seems to be involved in grape berry ripening. However, the precise role of ethylene in regulating the ripening of non-climacteric fruits is poorly understood. RESULTS: Exogenous ethephon (ETH) can stimulate the concentration of internal ethylene and accelerate the accumulation of anthocyanins in berries of 'Fujiminori', including malvidin-, delphinidin-, and petunidin-derivatives (3',4',5'-trihydroxylated anthocyanins) and cyanidin-derivatives (3',4'-dihydroxylated anthocyanins). The content of 3',4',5'-trihydroxylated anthocyanins was extremely higher than 3',4'-dihydroxylated anthocyanins, and ethylene did not affect the composition of anthocyanins in grape. Furthermore, we observed the expression of anthocyanin structural and regulatory genes as well as ethylene biosynthesis and response genes in response to ETH treatment. The anthocyanins accumulation is significantly associated with increased expression of anthocyanin structural (VvPAL, Vv4CH, VvCHS, VvCHI, VvF3H, and VvUFGT) and regulatory genes (VvMYBA1, VvMYBA2, and VvMYBA3), which persisted over the 12 days. In addition, exogenous ETH affected the endogenous ethylene biosynthesis (VvACO2 and VvACO4) and the downstream ethylene regulatory network (VvERS1, VvETR2, VvCTR1, and VvERF005). CONCLUSIONS: These findings bring new insights into the physiological and molecular function of ethylene during berry development and ripening in grapes. © 2021 Society of Chemical Industry.

Profiling Analysis of Volatile and Non-volatile Compounds in Vitis Vinifera Berries (cv. Chardonnay) and Spontaneous Bud Mutation.

A novel clonal variety of Vitis vinifera was identified from "Chardonnay" using inter-simple sequence repeat (ISSR) markers and called "bud mutation. " The metabolomic profiles in Chardonnay and bud mutation berries indicated essential differences in the expression of key genes in the pathways of 2-C-methyl-D-erythritol-4-phosphate (MEP) and lipoxygenase-hydroperoxide lyase (LOX-HPL). Bud mutation fruits also matured 10 days earlier than Chardonnay and have higher carotenoid, sugar, and acidic compound contents. Furthermore, the gene expression was examined in the biosynthetic pathways of two ripening-associated hormones, abscisic acid (ABA) and jasmonic acid (JA), which significantly increased in bud mutation compared with the Chardonnay fruit. The synthesis and metabolism of amino acids, terpenes, fatty acids, volatile components, and specialized metabolites significantly increased in bud mutation. Therefore, in comparison with Chardonnay, bud mutation is considered a highly aroma-producing grape variety for an improvement in the beverage industry.

The role of VvMYBA2r and VvMYBA2w alleles of the MYBA2 locus in the regulation of anthocyanin biosynthesis for molecular breeding of grape (Vitis spp.) skin coloration.

In grape, MYBA1 and MYBA2 at the colour locus are the major genetic determinants of grape skin colour, and the mutation of two functional genes (VvMYBA1 and VvMYBA2) from these loci leads to white skin colour. This study aimed to elucidate the regulation of grape berry coloration by isolating and characterizing VvMYBA2w and VvMYBA2r alleles. The overexpression of VvMYBA2r up-regulated the expression of anthocyanin biosynthetic genes and resulted in higher anthocyanin accumulation in transgenic tobacco than wild-type (WT) plants, especially in flowers. However, the ectopic expression of VvMYBA2w inactivated the expression of anthocyanin biosynthetic genes and could not cause obvious phenotypic modulation in transgenic tobacco. Unlike in VvMYBA2r, CA dinucleotide deletion shortened the C-terminal transactivation region and disrupted the transcriptional activation activity of VvMYBA2w. The results indicated that VvMYBA2r positively regulated anthocyanin biosynthesis by forming the VvMYBA2r-VvMYCA1-VvWDR1 complex, and VvWDR1 enhanced anthocyanin accumulation by interacting with the VvMYBA2r-VvMYCA1 complex; however, R44 L substitution abolished the interaction of VvMYBA2w with VvMYCA1. Meanwhile, both R44 L substitution and CA dinucleotide deletion seriously affected the efficacy of VvMYBA2w to regulate anthocyanin biosynthesis, and the two non-synonymous mutations were additive in their effects. Investigation of the colour density and MYB haplotypes of 213 grape germplasms revealed that dark-skinned varieties tended to contain HapC-N and HapE2, whereas red-skinned varieties contained high frequencies of HapB and HapC-Rs. Regarding ploidy, the higher the number of functional alleles present in a variety, the darker was the skin colour. In summary, this study provides insight into the roles of VvMYBA2r and VvMYBA2w alleles and lays the foundation for the molecular breeding of grape varieties with different skin colour.

Genome-Wide Identification and Expression Analysis of VviYABs Family Reveal Its Potential Functions in the Developmental Switch and Stresses Response During Grapevine Development.

Plant-specific YABBY (YAB) transcription factors play multiple roles in plant growth and development process. However, no comprehensive study has been performed in grapevines, especially to determine their roles in berry development and abiotic stress response. A total of seven VviYABs allocated to six chromosomal positions in grapevines were identified and classified into five subfamilies based on phylogenetic and structural analysis. Promoter element analysis and tissue-specific transcriptional response of VviYABs suggested that VviYABs might play vital roles in plant growth and development. VviYAB1, 2, 3, and 5 showed significantly higher expression levels in vegetative/green organs than in mature/woody tissues, implying that VviYABs might be involved in the regulatory switch from immature to mature developmental phases. The expression of VviYAB1, 2, 3, and VviFAS were gradually downregulated during berry developmental and ripening, which can be considered as putative molecular biomarkers between vegetative/green and mature/woody samples, and were used to identify key developmental and metabolic processes in grapevines. Furthermore, VviYAB1 expression was not markedly increased by gibberellic acid (GA3) treatment alone, but displayed significant upregulation when GA3 in combination with N-(2-chloro-4-pyridyl)-N'-phenylurea (CPPU) were applied, suggesting an involvement of VviYAB1 in fruit expansion by mediating cytokinin signaling pathway. Additionally, microarray and RNA-seq data suggested that VviYABs showed transcriptional regulation in response to various abiotic and biotic stresses, including salt, drought, Bois Noir, Erysiphe necator, and GLRaV-3 infection. Overall, our results provide a better understanding of the classification and functions of VviYABs during berry development and in response to abiotic and biotic stresses in grapevines.

Characterization of the regulation mechanism of grapevine microRNA172 family members during flower development.

BACKGROUND: Grapevine (Vitis vinifera L.), which has important nutritional values and health benefits, is one of the most economically important fruit crops cultivated worldwide. Several studies showed a large number of microRNAs (VvmiRNAs) involved in the modulation of grape growth and development, and many VvmiRNA families have multiple members. However, the way by which various members from the same miRNA family work is unclear, particularly in grapes. RESULTS: In this study, an important conserved VvmiR172 family (VvmiR172s) and their targets were set as a good example for elucidating the interaction degree, mechanism, and spatio-temporal traits of diverse members from the same miRNA family. miR-RACE and Stem-loop RT-PCR were used to identify the spatio-temporal expressions of various members of VvmiR172s; together with RLM-RACE, PPM-RACE, Western blot, transgenic technologies, their interaction degree, and regulation mechanism were further validated. The expression of VvmiR172c was significantly higher than that of VvmiR172a, b, and d and showed a positive correlation with the abundance of VvAP2 cleavage products. These findings indicated that VvmiR172c might be one of the main action factors of the VvmiR172 family in flower development. The ability of VvmiR172c to cleave target genes differed due to divergence in complementary degree with VvAP2 and expression levels of various members. In VvmiR172 transgenic lines, we observed that 35S::VvmiR172c resulted in the earliest and abundant flowering, indicating the strong function of VvmiR172c. In contrast, the non-significant phenotypic changes were detected in the VvAP2 transgenic lines. The qRT-PCR and Western bolt results demonstrated that VvmiR172c plays a major role in targeting VvAP2. CONCLUSIONS: VvmiR172 up-regulated the expression of NtFT and decreased the expression of NtFLC. The up/down regulation of VvmiR172c was the most pronounced. The functions of four VvmiR172 members in grape differed, and miR172c had the strongest regulation on AP2.

Genome-wide identification of the class III POD gene family and their expression profiling in grapevine (Vitis vinifera L).

BACKGROUND: The class III peroxidases (PODs) are involved in a broad range of physiological activities, such as the formation of lignin, cell wall components, defense against pathogenicity or herbivore, and abiotic stress tolerance. The POD family members have been well-studied and characterized by bioinformatics analysis in several plant species, but no previous genome-wide analysis has been carried out of this gene family in grapevine to date. RESULTS: We comprehensively identified 47 PODs in the grapevine genome and are further classified into 7 subgroups based on their phylogenetic analysis. Results of motif composition and gene structure organization analysis revealed that PODs in the same subgroup shared similar conjunction while the protein sequences were highly conserved. Intriguingly, the integrated analysis of chromosomal mapping and gene collinearity analysis proposed that both dispersed and tandem duplication events contributed to the expansion of PODs in grapevine. Also, the gene duplication analysis suggested that most of the genes (20) were dispersed followed by (15) tandem, (9) segmental or whole-genome duplication, and (3) proximal, respectively. The evolutionary analysis of PODs, such as Ka/Ks ratio of the 15 duplicated gene pairs were less than 1.00, indicated that most of the gene pairs exhibiting purifying selection and 7 pairs underwent positive selection with value greater than 1.00. The Gene Ontology Enrichment (GO), Kyoto Encyclopedia of Genes Genomics (KEGG) analysis, and cis-elements prediction also revealed the positive functions of PODs in plant growth and developmental activities, and response to stress stimuli. Further, based on the publically available RNA-sequence data, the expression patterns of PODs in tissue-specific response during several developmental stages revealed diverged expression patterns. Subsequently, 30 genes were selected for RT-PCR validation in response to (NaCl, drought, and ABA), which showed their critical role in grapevine. CONCLUSIONS: In conclusion, we predict that these results will lead to novel insights regarding genetic improvement of grapevine.

Anthocyanin Biosynthesis and Methylation of the MdMYB10 Promoter Are Associated with the Red Blushed-Skin Mutant in the Red Striped-Skin "Changfu 2" Apple.

The color of apple skin, particularly anthocyanin-based coloration, is a key factor determining market acceptance. The mechanisms of anthocyanin accumulation in apples with different skin color patterns (i.e., striped and blushed) were analyzed. In total, 14 anthocyanins and 5 procyanidins were simultaneously assayed in red blushed-skin mutants (CF-B1 and CF-B2) and red striped-skin parents (CF-S1 and CF-S2), and 13 significant differences were revealed. Anthocyanin accumulation was significantly higher in the red blushed-skin apples than it was in the parents. The transcript levels of anthocyanin biosynthesis genes and regulatory factors (MdMYB10, MdbHLH3, and MdWD40) were associated with different skin color patterns during the coloring period at 4, 6, and 8 days after the fruits were debagged. The methylation levels of the MdMYB10 promoter regions -1203 to -779 bp, -1667 to -1180 bp, and -2295 to -1929 bp were associated with different skin color patterns, and there was more methylation in red striped-skin apples. These results improve our understanding of anthocyanin accumulation and its underlying molecular mechanism in apples with different skin color patterns, thereby providing valuable information for apple breeding.

Genome-wide identification and analysis of B-BOX gene family in grapevine reveal its potential functions in berry development.

BACKGROUND: The B-BOX (BBX) proteins are the class of zinc-finger transcription factors and can regulate plant growth, development, and endure stress response. In plants, the BBX gene family has been identified in Arabidopsis, rice, and tomato. However, no systematic analysis of BBX genes has been undertaken in grapevine. RESULTS: In this study, 24 grapevine BBX (VvBBX) genes were identified by comprehensive bioinformatics analysis. Subsequently, the chromosomal localizations, gene structure, conserved domains, phylogenetic relationship, gene duplication, and cis-acting elements were analyzed. Phylogenetic analysis divided VvBBX genes into five subgroups. Numerous cis-acting elements related to plant development, hormone and/or stress responses were identified in the promoter of the VvBBX genes. The tissue-specific expressional dynamics of VvBBX genes demonstrated that VvBBXs might play important role in plant growth and development. The transcript analysis from transcriptome data and qRT-PCR inferred that 11 VvBBX genes were down-regulated in different fruit developmental stages, while three VvBBX genes were up-regulated. It is also speculated that VvBBX genes might be involved in multiple hormone signaling (ABA, ethylene, GA3, and CPPU) as transcriptional regulators to modulate berry development and ripening. VvBBX22 seems to be responsive to multiple hormone signaling, including ABA, ethylene GA3, and CPPU. Some VvBBX genes were strongly induced by Cu, salt, waterlogging, and drought stress treatment. Furthermore, the expression of VvBBX22 proposed its involvement in multiple functions, including leaf senescence, abiotic stress responses, fruit development, and hormone response. CONCLUSIONS: Our results will provide the reference for functional studies of BBX gene family, and highlight its functions in grapevine berry development and ripening. The results will help us to better understand the complexity of the BBX gene family in abiotic stress tolerance and provide valuable information for future functional characterization of specific genes in grapevine.

Molecular Evaluation of Vitality and Survival Rate of Dormant Kyoho Grape Seedlings: A Step toward Molecular Farming.

Vitality and survival rate of grape seedlings are crucial factors affecting quality of vineyards. There is no comprehensive study describing accurate evaluation of dormant grapevine seedlings' vitality and survival rate. The purpose of this study was to explore the possibility of using molecular information to evaluate viability and survival rate of dormant seedlings before transplanting. After bare roots treatment, 1-5 day expression levels of six HKGs in four buds of tetraploid Kyoho grape (Vitis labruscana: V. labrusca × V. vinifera) seedlings were detected by (Sq.) RT-PCR and qRT-PCR for calibration of the molecular method. The results revealed that HKGs expression indicates vitality and survival of plant, higher expression was strongly linked to higher vitality and survival rate, lower expression was associated with lower vitality, and lowest expression was significantly associated with lowest vitality and survival rate. Moreover, DNA and RNA quality can superficially determine seedling qualities. Finally, the survival rate of the seedlings produced in Juxian-Shandong, Laixi-Shandong, Huailai-Hebei, Suizhong-Liaoning, Changli-Hebei, Guanxian-Shandong, and Zhangjiagang-Jiangsu was 100.00%, 100.00%, 100.00%, 100.00%, 100.00%, 87.77%, and 93.33%, respectively. In conclusion, molecular technique is potential approach for promoting gene information to estimate vitality and survival rate of dormant grape seedlings and might contribute to viticulturists' efforts.

Genome-wide identification and transcript analysis of TCP transcription factors in grapevine.

BACKGROUND: The plant-specific TCP transcription factors play different functions in multiple processes of plant growth and development. TCP family genes have been identified in several plant species, but no comprehensive analysis of the TCP family in grapevine has been undertaken to date, especially their roles in fruit development. RESULTS: A total of 18 non-redundant grapevine TCP (VvTCP) genes distributing on 11 chromosomes were identified. Phylogenetic and structural analysis showed that VvTCP genes were divided into two main classes - class I and class II. The Class II genes were further classified into two subclasses, the CIN subclass and the CYC/TB1 subclass. Segmental duplication was a predominant duplication event which caused the expansion of VvTCP genes. The cis-acting elements analysis and tissue-specific expression patterns of VvTCP genes demonstrated that these VvTCP genes might play important roles in plant growth and development. Expression patterns of VvTCP genes during fruit development and ripening were analyzed by RNA-Seq and qRT-PCR. Among them, 11 VvTCP genes were down-regulated during different fruit developmental stages, while only one VvTCP genes were up-regulated, suggesting that most VvTCP genes were probably related to early development in grapevine fruit. Futhermore, the expression of most VvTCP genes can be inhibited by drought and waterlogging stresses. CONCLUSIONS: Our study establishes the first genome-wide analysis of the grapevine TCP gene family and provides valuable information for understanding the classification and functions of the TCP genes in grapevine.

Characterization on the conservation and diversification of miRNA156 gene family from lower to higher plant species based on phylogenetic analysis at the whole genomic level.

miRNA156 family members (miR156s) participate in regulating the transition of plant vegetative and reproductive growth, flower development, and formation of berry skin color by negatively modulating their target gene SPLs. However, the evolution and functional diversification of miR156s in plants remain elusive. Phylogenetic analysis on 310 miR156s from 51 plant species on miRBase 21.0 showed that only miR156a could be conserved in the 51 plant species, but their sequences exhibited variation; another set of miR156s, such as miR156m/n/o/p/q/r/s/t/u/v/w/x/y/z, was identified only in certain special plant species (Glycine max and Malus); also, all base variations in the sequences of 310 miR156s occurred within one miR156 seed sequence, "TGACAGAAGAGAGTGAGCAC," and the changed base sites were mainly located at the 11th and 14th bases from the 5' end of the miR156 seed sequence, in which some base variations of miR156s resulted in a difference in miR156 targeting modes; by contrast, miR156 precursor sequences are highly divergent across diverse species. Similarly, cis-regulatory motifs on the promoter sequence of MIR156s in various plants also exhibited significant discrepancy. The intragenic MIR156 genes overlapped their target SBP genes, thereby suggesting that some microRNAs (miRNAs) originate from duplication of target genes. These traits might be the reasons of the conservation and diversification of miR156 gene family. This study identified the conserved seed sequence "TGACAGAAGAGAGTGAGCAC," and the sequence variation characterization, of miR156 family evolution, also investigated the varied traits of their promoters, precursors, and mature sequences in sequence evolutions and found some miRNAs might originate from duplication of target genes. Our findings will contribute to our understanding of the functional diversification of miRNAs and the interactions of miRNA/target pairs based on the evolutionary history of miRNA genes.

Identification of copper (Cu) stress-responsive grapevine microRNAs and their target genes by high-throughput sequencing.

MicroRNAs (miRNAs) are a class of single-stranded non-coding small RNAs (sRNAs) that are 20-24 nucleotides (nt) in length. Extensive studies have indicated that miRNAs play important roles in plant growth, development and stress responses. With more copper (Cu) and copper containing compounds used as bactericides and fungicides in plants, Cu stress has become one of the serious environmental problems that affect plant growth and development. In order to uncover the hidden response mechanisms of Cu stress, two small RNA libraries were constructed from Cu-treated and water-treated (Control) leaves of 'Summer Black' grapevine. Following high-throughput sequencing and filtering, a total of 158 known and 98 putative novel miRNAs were identified in the two libraries. Among these, 100 known and 47 novel miRNAs were identified as differentially expressed under Cu stress. Subsequently, the expression patterns of nine Cu-responsive miRNAs were validated by quantitative real-time PCR (qRT-PCR). There existed some consistency in expression levels of Cu-responsive miRNAs between high throughput sequencing and qRT-PCR assays. The targets prediction of miRNAs indicates that miRNA may regulate some transcription factors, including AP2, SBP, NAC, MYB and ARF during Cu stress. The target genes for two known and two novel miRNAs showed specific cleavage sites at the 10th and/or 11th nucleotide from the 5'-end of the miRNA corresponding to their miRNA complementary sequences. The findings will lay the foundation for exploring the role of the regulation of miRNAs in response to Cu stress and provide valuable gene information for breeding some Cu-tolerant grapevine cultivars.

Ectopic expression of CSD1 and CSD2 targeting genes of miR398 in grapevine is associated with oxidative stress tolerance.

MicroRNAs (miRNAs) are endogenous small RNAs of -21 nucleotides that play an important role in diverse plant physiological processes at the post-transcriptional level by directing mRNA cleavage or translational inhibition. Previous studies have indicated that down-regulation of miR398 in response to oxidative stress allows up-regulation of the two target genes, cytosolic CSD1 and chloroplastic CSD2 (copper/zinc superoxide dismutase), resulting in protecting the plants to tolerate oxidative stress. In this study, we provide evidence that grapevine miR398 (Vv-miR398), by regulating the expression of its target genes, VvCSD1 and VvCSD2, mediates responses of grapevine to copper (Cu) stress which have been magnified due to increase in Cu-containing pesticide application. The expression of Vv-miR398 was inhibited by different concentrations of Cu stress; on the other hand, there was a steady increase in the activity of VvCSD1 and VvCSD2 genes. The function of VvCSD1 and VvCSD2 under Cu stress was thoroughly examined by overexpressing the use of the VvCSD1 and VvCSD2 in transgenic tobacco (Nicotiana tabacum). We found that both the overexpressed transgenic lines had lower Cu sensitivity and higher Cu tolerance compared with the wild type. In addition, lower levels of ROS and higher levels of SOD activities were accumulated in the transgenic lines in comparison with the wild type under the higher Cu conditions. Furthermore, these transgenic tobacco lines also recorded a higher UV and salt tolerance than the WT plants. These results suggested that overexpressing the VvCSDs will enhance the ROS-scavenging systems and protect the plant against more oxidative damage. Also, more investigations in this line are needed that would provide significant improvements in our understanding the resistance of fruit crops to environmental stress.

Genome-wide identification and characterization of genes involved in carotenoid metabolic in three stages of grapevine fruit development.

Carotenoids not only play indispensable roles in plant growth and development but also enhance nutritional value and health benefits for humans. In this study, total carotenoids progressively decreased during fruit ripening. Fifty-four genes involving in mevalonate (MVA), 2-C-methyl-D-erythritol 4-phosphate (MEP), carotenoid biosynthesis and catabolism pathway were identified. The expression levels of most of the carotenoid metabolism related genes kept changing during fruit ripening generating a metabolic flux toward carotenoid synthesis. Down regulation of VvDXS, VvDXR, VvGGPPS and VvPSY and a dramatic increase in the transcription levels of VvCCD might be responsible for the reduction of carotenoids content. The visible correlation between carotenoid content and gene expression profiles suggested that transcriptional regulation of carotenoid biosynthesis pathway genes is a key mechanism of carotenoid accumulation. In addition, the decline of carotenoids was also accompanied with the reduction of chlorophyll content. The reduction of chlorophyll content might be due to the obstruction in chlorophyll synthesis and acceleration of chlorophyll degradation. These results will be helpful for better understanding of carotenoid biosynthesis in grapevine fruit and contribute to the development of conventional and transgenic grapevine cultivars for further enrichment of carotenoid content.