Wildfire-related PM2.5 and cause-specific cancer mortality.

Wildfires have devastating effects on society and public health. However, little evidence from population-based cohort has been performed to analyze the relationship of wildfire-related PM2.5, an important component of wildfire smoke, with cancer-specific mortality. We aimed to explore this relationship and identify vulnerable populations in UK with lower levels of wildfire-related PM2.5 exposure. The study consisted of 492394 participants (age: 38-73 years) recruited by UK Biobank during 2004-2010. The cumulative wildfire-related PM2.5 within 10 kilometers of residence over three years was used as exposure, which was assessed by chemical transport and machine learning models. A time-varying Cox regression was utilized to explore the relationship of exposure with diverse cancer-specific mortality outcomes. Subgroup analyses of a range of potential modifiers were performed. Each 10 µg/m3 increment of 3-year cumulative exposure was related to a 0.4 % greater risk of total cancer (95 %CI: 1.001-1.007), a 1.1 % greater risk of lung cancer (95 %CI: 1.004-1.018), and a 2.7 % greater risk of lip, oral cavity and pharynx (LOP) cancer (95 %CI: 1.005-1.049). Higher vulnerability in the wildfire-related PM2.5-lung cancer relationship was found among participants being retired than those with other employment status. Even lower levels of exposure to PM2.5 from wildfires were related to elevated mortality risks for cancer from total, lung, LOP, highlighting the importance of wildfire prevention and control. Further investigations are warranted to enrich and extend existing knowledge in this field.

Research on information extension of mountainous rack railway engineering based on IFC standard.

In response to the practical demands for data sharing and exchange in the field of rack railway systems engineering, as well as to address the gaps in the rack railway domain within the framework of the IFC4 standard, we extend and define the rack railway domain through entity extension and custom attribute sets. By utilizing the ongoing construction of the Dujiangyan to Mount Siguniang Railway as a case study, we validate the utility of this IFC extension and modeling approach. Leveraging IfcOpenShell, we incorporate the extended data content into the generated IFC file. We present a process for extension tailored to the characteristics of rack railway engineering. This study aims to provide broader information support for the digital construction of track structures in the design phase of rack railway engineering and to facilitate more efficient data exchange and sharing.

Risk factors for postoperative recovery in oral cancer surgery: A retrospective cohort study.

BACKGROUND: Effective management of oral cancer necessitates a multidisciplinary approach, with surgery playing a pivotal role in treatment. However, there are many risk factors during the perioperative period that affect postoperative recovery. PURPOSE: This study aims to identify the risk factors influencing postoperative recovery in patients undergoing oral cancer surgery, thereby optimizing perioperative management. STUDY DESIGN, SETTING, SAMPLE: A retrospective cohort study was carried out in patients who underwent surgery for oral cancer at The Second Affiliated Hospital Of Zhejiang University School Of Medicine from Jan. to Dec. in 2023. Based on the median length of stay (LOS) of 20.42 days, we divided the study population into DL3W and DM3W groups (DL3W/DM3W: Discharged less/>3 weeks). PREDICTOR VARIABLE: The Predictor variables included sex, age, BMI, smoke, drink, education, settlement, surgery history, tumor history, intra-operative situation, flap details, pathologic stage, treatment and laboratory examination. MAIN OUTCOME VARIABLE: The primary outcome was length of stay (LOS) defined as the days from the start of preoperative preparation to discharge from the hospital. ANALYSES: Descriptive and inferential analyses were performed using the χ2 test, Fisher's exact test and t-test. A P value of 0.05 was deemed as an acceptable statistical significance level. RESULTS: The sample was composed of 103 subjects with a mean age of 59.45 (14.20) and 71 (68.9 %) were male. The median LOS was 20.42 ((range, 10-69) days. The baseline characteristics between the DL3W and DM3W groups were generally balanced. Factors associated with LOS were BMI (95 %CI 1.01-1.15, P = 0.046), intraoperative blood loss (95 %CI 0.;99-1.00, P = 0.002), flap source (P < 0.001), and postoperative fasting time (95 %CI 0.88-0.95, P < 0.001). In the regression model, more intraoperative blood loss and longer postoperative fasting time were associated with increased. LOS and factors BMI and the use of forearm flap were associated with decreased LOS after adjusting the confounding factors. CONCLUSIONS AND RELEVANCE: In the perioperative period for oral cancer patients, optimizing postoperative recovery may be achieved by carefully managing BMI, intraoperative blood loss, flap source, and postoperative fasting time.

Promoting Electrocatalytic Reduction of CO2 and Nitrate to Urea on N-Doped Porous Hollow Carbon Spheres.

The electrocatalytic coreduction of CO2 and nitrate is a green method for urea synthesis, mitigating CO2 emission and nitrate contamination. However, its slow kinetics and high energy barrier result in a poor urea production performance. Herein, we reported N-doped porous hollow carbon spheres (N-PHCS) for promoting CO2 and nitrate conversion to urea via nanoconfinement and N-doping from both reaction kinetics and thermodynamics. A high urea yield of 12.0 mmol h-1 gcat-1 with Faradaic efficiency of 19.1% was achieved on N-PHCS at -1.0 V (vs Ag/AgCl), which was comparable to or even higher than those of metal-based electrocatalysts reported. The experimental and theoretical calculation results revealed that carbon spheres with an appropriate interior void and pore size were favorable for confining reactants and intermediates to accelerate urea production, while N-doping can reduce the energy barrier for urea synthesis. By regulating the microstructure and N doping of N-PHCS, it showed a superior performance for urea electrosynthesis. The energy favorable pathway for urea synthesis was through the C-N coupling reaction of *NO and *CO, and pyridinic N can reduce the reaction energy barrier.

Risks of infectious disease hospitalisations in the aftermath of tropical cyclones: a multi-country time-series study.

BACKGROUND: The proportion of intense tropical cyclones is expected to increase in a changing climate. However, there is currently no consistent and comprehensive assessment of infectious disease risk following tropical cyclone exposure across countries and over decades. We aimed to explore the tropical cyclone-associated hospitalisation risks and burden for cause-specific infectious diseases on a multi-country scale. METHODS: Hospitalisation records for infectious diseases were collected from six countries and territories (Canada, South Korea, New Zealand, Taiwan, Thailand, and Viet Nam) during various periods between 2000 and 2019. The days with tropical cyclone-associated maximum sustained windspeeds of 34 knots or higher derived from a parametric wind field model were considered as tropical cyclone exposure days. The association of monthly infectious diseases hospitalisations and tropical cyclone exposure days was first examined at location level using a distributed lag non-linear quasi-Poisson regression model, and then pooled using a random-effects meta-analysis. The tropical cyclone-attributable number and fraction of infectious disease hospitalisations were also calculated. FINDINGS: Overall, 2·2 million people who were hospitalised for infectious diseases in 179 locations that had at least one tropical cyclone exposure day in the six countries and territories were included in the analysis. The elevated hospitalisation risks for infectious diseases associated with tropical cyclones tended to dissipate 2 months after the tropical cyclone exposure. Overall, each additional tropical cyclone day was associated with a 9% (cumulative relative risk 1·09 [95% CI 1·05-1·14]) increase in hospitalisations for all-cause infectious diseases, 13% (1·13 [1·05-1·21]) for intestinal infectious diseases, 14% (1·14 [1·05-1·23]) for sepsis, and 22% (1·22 [1·03-1·46]) for dengue during the 2 months after a tropical cyclone. Associations of tropical cyclones with hospitalisations for tuberculosis and malaria were not significant. In total, 0·72% (95% CI 0·40-1·01) of the hospitalisations for all-cause infectious diseases, 0·33% (0·15-0·49) for intestinal infectious diseases, 1·31% (0·57-1·95) for sepsis, and 0·63% (0·10-1·04) for dengue were attributable to tropical cyclone exposures. The attributable burdens were higher among young populations (aged ≤19 years) and male individuals compared with their counterparts, especially for intestinal infectious diseases. The heterogeneous spatiotemporal pattern was further revealed at the country and territory level-tropical cyclone-attributable fractions showed a decreasing trend in South Korea during the study period but an increasing trend in Viet Nam, Taiwan, and New Zealand. INTERPRETATION: Tropical cyclones were associated with persistent elevated hospitalisation risks of infectious diseases (particularly sepsis and intestinal infectious diseases). Targeted interventions should be formulated for different populations, regions, and causes of infectious diseases based on evidence on tropical cyclone epidemiology to respond to the increasing risk and burden. FUNDING: Australian Research Council, Australian National Health, and Medical Research Council.

SAPHO syndrome in the mandible: A 17-patient-based experience.

SAPHO (Synovitis, Acne, Pustulosis, Hyperostosis and Osteitis) syndrome is a rare inflammatory bone disorder with a remarkably low incidence. The condition's impact on the mandible is exceptionally uncommon, often resulting in a high rate of misdiagnosis and an extended duration of illness. The objective of this study was to assess patients with SAPHO syndrome in the mandible in across various stages and to dissect their distinctive features, aiming to provide future clinical experience for the disease. METHODS: A retrospective analysis was performed on a cohort of 17 patients diagnosed with SAPHO syndrome affecting the mandible at the Second Affiliated Hospital of Zhejiang University from January 2020 to March 2023. Data including clinical presentations, imaging characteristics, and laboratory results were collected. RESULTS: The median age at disease onset was 25, with a diagnostic interval of 26 months. Notably, seven individuals were prepubescent (under the age of 14). Seven patients (41.18 %) exhibited polyostotic involvement, while eight patients (47.06 %) presented with dermatological manifestations either concurrently with or subsequent to the osseous lesions. Condyle involvement was identified in six patients (35.29 %), and bilateral mandibular affection was noted in an equivalent number. The majority of patients (sixteen patients, 94.12 %) reported symptomatic relief following treatment with nonsteroidal anti-inflammatory drugs (NSAIDs). Glucocorticoids were instrumental in managing severe pain and extreme limitations in mouth opening. For patients with refractory disease, tumor necrosis factor-alpha (TNF-α) inhibitors, Janus kinase (JAK) inhibitors and bisphosphonates were employed. Ultimately, effective pain management was achieved in the entire cohort. CONCLUSION: The diagnosis of SAPHO syndrome involving the mandible is exclusionary. It is important to improve diagnostic accuracy among oral and maxillofacial surgeons (OMFS), dentists, and rheumatologists to avoid unnecessary surgery and tooth extraction. TNF-α inhibitors, JAK inhibitors and bisphosphonates are recommended as third-line drugs.

Ionic liquid-functionalized covalent organic frameworks on the surface of silica for online solid-phase extraction.

A covalent organic framework (COF) was gown on porous silica with 1,3,5-tri(4-aminophenyl)benzene and 2,5-divinyl-1,4-phenyldiformaldehyde as monomers, and two ionic liquids were grafted to COF by a click reaction. The materials before and after the modification of ionic liquids were separately packed into solid-phase extraction columns (10 × 4.6 mm, i.d.), which were coupled with liquid chromatography to construct online analysis systems. The extraction mechanisms of polycyclic aromatic hydrocarbons, bisphenols, diphenylalkanes and benzoic acids were investigated on these materials. There were π-π, hydrogen-bond and electrostatic interactions on ionic liquid-functionalized sorbents. After the comparison among these materials, the best sorbent was used, and the analytical method was established and successfully applied to the detection of some estrogens from actual samples. For the analytical method, the detection limit was as low as 0.005 µg L-1, linear range was as wide as 0.017-10.0 µg L-1, and enrichment ratio was as high as 3635. The recoveries in actual samples were 70 %-129 %.

Short-term Exposure to Wildfire-Specific PM2.5 and Diabetes Hospitalization: A Study in Multiple Countries and Territories.

OBJECTIVE: To evaluate associations of wildfire fine particulate matter ≤2.5 mm in diameter (PM2.5) with diabetes across multiple countries and territories. RESEARCH DESIGN AND METHODS: We collected data on 3,612,135 diabetes hospitalizations from 1,008 locations in Australia, Brazil, Canada, Chile, New Zealand, Thailand, and Taiwan during 2000-2019. Daily wildfire-specific PM2.5 levels were estimated through chemical transport models and machine-learning calibration. Quasi-Poisson regression with distributed lag nonlinear models and random-effects meta-analysis were applied to estimate associations between wildfire-specific PM2.5 and diabetes hospitalization. Subgroup analyses were by age, sex, location income level, and country or territory. Diabetes hospitalizations attributable to wildfire-specific PM2.5 and nonwildfire PM2.5 were compared. RESULTS: Each 10 µg/m3 increase in wildfire-specific PM2.5 levels over the current day and previous 3 days was associated with relative risks (95% CI) of 1.017 (1.011-1.022), 1.023 (1.011-1.035), 1.023 (1.015-1.032), 0.962 (0.823-1.032), 1.033 (1.001-1.066), and 1.013 (1.004-1.022) for all-cause, type 1, type 2, malnutrition-related, other specified, and unspecified diabetes hospitalization, respectively. Stronger associations were observed for all-cause, type 1, and type 2 diabetes in Thailand, Australia, and Brazil; unspecified diabetes in New Zealand; and type 2 diabetes in high-income locations. An estimate of 0.67% (0.16-1.18%) and 1.02% (0.20-1.81%) for all-cause and type 2 diabetes hospitalizations were attributable to wildfire-specific PM2.5. Compared with nonwildfire PM2.5, wildfire-specific PM2.5 posed greater risks of all-cause, type 1, and type 2 diabetes and were responsible for 38.7% of PM2.5-related diabetes hospitalizations. CONCLUSIONS: We show the relatively underappreciated links between diabetes and wildfire air pollution, which can lead to a nonnegligible proportion of PM2.5-related diabetes hospitalizations. Precision prevention and mitigation should be developed for those in advantaged communities and in Thailand, Australia, and Brazil.

A 2.5-Dimensional biomimetic dual-functional bifacial-evaporator for high efficient evaporation and water purification.

Nowadays, solar-driven interfacial steam generation (SISG) is a sustainable and green technology for mitigating the water shortage crisis. Nevertheless, SISG is suffering from the enrichment of volatile organic compounds in condensate water and non-volatile organic compounds in feed water in practical applications. Herein, taking inspiration from nature, a dual-functional bifacial-CuCoNi (Bi-CuCoNi) evaporator with a special biomimetic urchin-like microstructure was successfully prepared. The unique design with 2.5-Dimensional bifacial working sides and urchin-like light absorption microstructure provided the Bi-CuCoNi evaporator with remarkable evaporation performance (1.91 kg m-2 h-1 under 1 kW m-2). Significantly, due to the urchin-like microstructure, the adequately exposed catalytic active sites enabled the Bi-CuCoNi/peroxydisulfate (PDS) system to degrade non-volatile organic pollutants (removal rate of 99.3 % in feed water, close to 100 % in condensate water) and the volatile organic pollutants (removal rate of 99.1 % in feed water, 98.2 % in condensate water) simultaneously. Moreover, the Bi-CuCoNi evaporator achieved non-radical pathway degradation at whole-stages. The dual-functional evaporator successfully integrated advanced oxidation processes (AOPs) into SISG, providing a new idea for high-quality freshwater production from polluted wastewater. ENVIRONMENTAL IMPLICATION: Inspired by nature, a dual-functional bifacial CuCoNi evaporator with a special biomimetic urchin-like microstructure formed by CuCoNi oxide nanowires grown on nickel foam by the hydrothermal synthesis method was successfully prepared. The prepared Bi-CuCoNi evaporator can effectively degrade organic pollutants in feed water and condensate water simultaneously during SISG, thus generating high-quality fresh water. Meanwhile, the health risks associated with the accumulation of organic pollutants in water during traditional SISG were reduced via green and sustainable way. The spatial 2.5-Dimensional structural design of Bi-CuCoNi provided new insights for achieving efficient water evaporation and fresh water generation from various polluted wastewater.

The N6-methyladenosine Epitranscriptomic Landscape of Lung Adenocarcinoma.

Comprehensive m6A epitranscriptome profiling of primary tumors remains largely uncharted. Here, we profiled the m6A epitranscriptome of 10 non-neoplastic lung (NL) tissues and 51 lung adenocarcinoma (LUAD) tumors, integrating the corresponding transcriptome, proteome and extensive clinical annotations. We identified distinct clusters and genes that were exclusively linked to disease progression through m6A modifications. In comparison with NL tissues, we identified 430 transcripts to be hypo-methylated and 222 to be hyper-methylated in tumors. Among these genes, EML4 emerged as a novel metastatic driver, displaying significant hyper-methylation in tumors. m6A modification promoted the translation of EML4, leading to its widespread overexpression in primary tumors. Functionally, EML4 modulated cytoskeleton dynamics through interacting with ARPC1A, enhancing lamellipodia formation, cellular motility, local invasion, and metastasis. Clinically, high EML4 protein abundance correlated with features of metastasis. METTL3 small molecule inhibitor markedly diminished both EML4 m6A and protein abundance, and efficiently suppressed lung metastases in vivo.

Integration of a Cas12a-mediated DNAzyme actuator with efficient RNA extraction for ultrasensitive colorimetric detection of viral RNA.

Developing highly sensitive and specific on-site tests is imperative to strengthen preparedness against future emerging infectious diseases. Here, we describe the construction of a Cas12a-mediated DNAzyme actuator capable of converting the recognition of a specific DNA sequence into an amplified colorimetric signal. To address viral RNA extraction challenges for on-site applications, we developed a rapid and efficient method capable of lysing the viral particles, preserving the released viral RNA, and concentrating the viral RNA. Integration of the DNAzyme actuator with the viral RNA extraction method and loop-mediated isothermal amplification enables a streamlined colorimetric assay for highly sensitive colorimetric detection of respiratory RNA viruses in gargle and saliva. This assay can detect as few as 83 viral particles/100 µL in gargle and 166 viral particles/100 µL in saliva. The entire assay, from sample processing to visual detection, was completed within 1 h at a single controlled temperature. We validated the assay by detecting SARS-CoV-2 in 207 gargle and saliva samples, achieving a clinical sensitivity of 96.3 % and specificity of 100%. The assay is adaptable for detecting specific nucleic acid sequences in other pathogens and is suitable for resource-limited settings.

Cancer mortality risk from short-term PM2.5 exposure and temporal variations in Brazil.

Although some studies have found that short-term PM2.5 exposure is associated with lung cancer deaths, its impact on other cancer sites is unclear. To answer this research question, this time-stratified case-crossover study used individual cancer death data between January 1, 2000, and December 31, 2019, extracted from the Brazilian mortality information system to quantify the associations between short-term PM2.5 exposure and cancer mortality from 25 common cancer sites. Daily PM2.5 concentration was aggregated at the municipality level as the key exposure. The study included a total of 34,516,120 individual death records, with the national daily mean PM2.5 exposure 15.3 (SD 4.3) µg/m3. For every 10-µg/m3 increase in three-day average PM2.5 exposure, the odds ratio (OR) for all-cancer mortality was 1.04 (95% CI 1.03-1.04). Apart from all-cancer deaths, PM2.5 exposure may impact cancers of oesophagus (1.04, 1.00-1.08), stomach (1.05, 1.02-1.08), colon-rectum (1.04, 1.01-1.06), lung (1.04, 1.02-1.06), breast (1.03, 1.00-1.06), prostate (1.07, 1.04-1.10), and leukaemia (1.05, 1.01-1.09). During the study period, acute PM2.5 exposure contributed to an estimated 1,917,994 cancer deaths, ranging from 0 to 6,054 cases in each municipality. Though there has been a consistent downward trend in PM2.5-related all-cancer mortality risks from 2000 to 2019, the impact remains significant, indicating the continued importance of cancer patients avoiding PM2.5 exposure. This nationwide study revealed a notable association between acute PM2.5 exposure and heightened overall and site-specific cancer mortality for the first time to our best knowledge. The findings suggest the importance of considering strategies to minimize such exposure in cancer care guidelines. ENVIRONMENTAL IMPLICATION: The 20-year analysis of nationwide death records in Brazil revealed that heightened short-term exposure to PM2.5 is associated with increased cancer mortality at various sites, although this association has gradually decreased over time. Despite the declining impact, the research highlights the persistent adverse effects of PM2.5 on cancer mortality, emphasizing the importance of continued research and preventive measures to address the ongoing public health challenges posed by air pollution.

Highly Efficient Acidic Electrosynthesis of Hydrogen Peroxide at Industrial-Level Current Densities Promoted by Alkali Metal Cations.

Acidic H2O2 synthesis through electrocatalytic 2e- oxygen reduction presents a sustainable alternative to the energy-intensive anthraquinone oxidation technology. Nevertheless, acidic H2O2 electrosynthesis suffers from low H2O2 Faradaic efficiencies primarily due to the competing reactions of 4e- oxygen reduction to H2O and hydrogen evolution in environments with high H+ concentrations. Here, we demonstrate the significant effect of alkali metal cations, acting as competing ions with H+, in promoting acidic H2O2 electrosynthesis at industrial-level currents, resulting in an effective current densities of 50-421 mA cm-2 with 84-100 % Faradaic efficiency and a production rate of 856-7842 µmol cm-2 h-1 that far exceeds the performance observed in pure acidic electrolytes or low-current electrolysis. Finite-element simulations indicate that high interfacial pH near the electrode surface formed at high currents is crucial for activating the promotional effect of K+. In situ attenuated total reflection Fourier transform infrared spectroscopy and ab initio molecular dynamics simulations reveal the central role of alkali metal cations in stabilizing the key *OOH intermediate to suppress 4e- oxygen reduction through interacting with coordinated H2O.

The association between humidex and tuberculosis: a two-stage modelling nationwide study in China.

BACKGROUND: Under a changing climate, the joint effects of temperature and relative humidity on tuberculosis (TB) are poorly understood. To address this research gap, we conducted a time-series study to explore the joint effects of temperature and relative humidity on TB incidence in China, considering potential modifiers. METHODS: Weekly data on TB cases and meteorological factors in 22 cities across mainland China between 2011 and 2020 were collected. The proxy indicator for the combined exposure levels of temperature and relative humidity, Humidex, was calculated. First, a quasi-Poisson regression with the distributed lag non-linear model (DLNM) was constructed to examine the city-specific associations between humidex and TB incidence. Second, a multivariate meta-regression model was used to pool the city-specific effect estimates, and to explore the potential effect modifiers. RESULTS: A total of 849,676 TB cases occurred in the 22 cities between 2011 and 2020. Overall, a conspicuous J-shaped relationship between humidex and TB incidence was discerned. Specifically, a decrease in humidex was positively correlated with an increased risk of TB incidence, with a maximum relative risk (RR) of 1.40 (95% CI: 1.11-1.76). The elevated RR of TB incidence associated with low humidex (5th humidex) appeared on week 3 and could persist until week 13, with a peak at approximately week 5 (RR: 1.03, 95% CI: 1.01-1.05). The effects of low humidex on TB incidence vary by Natural Growth Rate (NGR) levels. CONCLUSION: A J-shaped exposure-response association existed between humidex and TB incidence in China. Humidex may act as a better predictor to forecast TB incidence compared to temperature and relative humidity alone, especially in regions with higher NGRs.

Efficient electro-Fenton degradation of organic pollutants via the synergistic effect of 1O2 and •OH generated on single FeN4 sites.

The electro-Fenton with in situ generated 1O2 and •OH is a promising method for the degradation of micropollutants. However, its application is hindered by the lack of catalysts that can efficiently generate 1O2 and •OH from electrochemical oxygen reduction. Herein, N-doped stacked carbon nanosheets supported Fe single atoms (Fe-NSC) with FeN4 sites were designed for simultaneous generation of 1O2 and •OH to enhance electro-Fenton degradation. Due to the synergistic effect of 1O2 and •OH, a variety of contaminants (phenol, 2,4-dichlorophenol, sulfamethoxazole, atrazine and bisphenol A) were efficiently degraded with high kinetic constants of 0.037-0.071 min-1 by the electro-Fenton with Fe-NSC as cathode (-0.6 V vs Ag/AgCl, pH 6). Moreover, the superior performance for electro-Fenton degradation was well maintained in a wide pH range from 3 to 10 even with interference of various inorganic salt ions. It was found that FeN4 sites with pyridinic N coordination were responsible for its good performance for electro-Fenton degradation. Its 1O2 yield was higher than •OH yield, and the contribution of 1O2 was more significant than •OH for pollutant degradation.

SARS-CoV-2 Omicron Variants Show Attenuated Neurovirulence Compared with the Wild-Type Strain in Elderly Human Brain Spheroids.

Infection with severe acute respiratory syndrome coronavirus 2 Omicron variants still causes neurological complications in elderly individuals. However, whether and how aging brains are affected by Omicron variants in terms of neuroinvasiveness and neurovirulence are unknown. Here, we utilize resected paracarcinoma brain tissue from elderly individuals to generate primary brain spheroids (BSs) for investigating the replication capability of live wild-type (WT) strain and Omicron (BA.1/BA.2), as well as the mechanisms underlying their neurobiological effects. We find that both WT and Omicron BA.1/BA.2 are able to enter BSs but weakly replicate. There is no difference between Omicron BA.1/BA.2 and WT strains in neurotropism in aging BSs. However, Omicron BA.1/BA.2 exhibits ameliorating neurological damage. Transcriptional profiling indicates that Omicron BA.1/BA.2 induces a lower neuroinflammatory response than WT strain in elderly BSs, suggesting a mechanistic explanation for their attenuated neuropathogenicity. Moreover, we find that both Omicron BA.1/BA.2 and WT strain infections disrupt neural network activity associated with neurodegenerative disorders by causing neuron degeneration and amyloid-ß deposition in elderly BSs. These results uncover Omicron-specific mechanisms and cellular immune responses associated with severe acute respiratory syndrome coronavirus 2-induced neurological complications.

Identification of novel variations in three cases with rare inherited neuromuscular disorder.

Inherited neuromuscular disorder (IND) is a broad-spectrum, clinically diverse group of diseases that are caused due to defects in the neurosystem, muscles and related tissue. Since IND may originate from mutations in hundreds of different genes, the resulting heterogeneity of IND is a great challenge for accurate diagnosis and subsequent management. Three pediatric cases with IND were enrolled in the present study and subjected to a thorough clinical examination. Next, a genetic investigation was conducted using whole-exome sequencing (WES). The suspected variants were validated through Sanger sequencing or quantitative fluorescence PCR assay. A new missense variant of the Spastin (SPAST) gene was found and analyzed at the structural level using molecular dynamics (MD) simulations. All three cases presented with respective specific clinical manifestations, which reflected the diversity of IND. WES detected the diagnostic variants in all 3 cases: A compound variation comprising collagen type VI α3 chain (COL6A3) (NM_004369; exon19):c.6322G>T(p.E1208*) and a one-copy loss of COL6A3:exon19 in Case 1, which are being reported for the first time; a de novo SPAST (NM_014946; exon8):c.1166C>A(p.T389K) variant in Case 2; and a de novo Duchenne muscular dystrophy (NM_004006; exon11):c.1150-17_1160delACTTCCTTCTTTGTCAGGGGTACATGATinsC variant in Case 3. The structural and MD analyses revealed that the detected novel SPAST: c.1166C>A(p.T389K) variant mainly altered the intramolecular hydrogen bonding status and the protein segment's secondary structure. In conclusion, the present study expanded the IND mutation spectrum. The study not only detailed the precise diagnoses of these cases but also furnished substantial grounds for informed consultations. The approach involving the genetic evaluation strategy using WES for variation screening followed by validation using appropriate methods is beneficial due to the considerable heterogeneity of IND.

Etching of Ag nanoparticles triggered bidirectional regulation for electrochemiluminescence ratiometric immunoassay.

A highly efficient ratiometric electrochemiluminescence (ECL) immunoassay was explored by bidirectionally regulating the ECL intensity of two luminophors. The immunoassay was conducted in a split-type mode consisting of an ECL detection procedure and a sandwich immunoreaction. The ECL detection was executed using a dual-disk glassy carbon electrode modified with two potential-resolved luminophors (g-C3N4-Ag and Ru-MOF-Ag nanocomposites), and the sandwich immunoreaction using glucose oxidase (GOx)-modified SiO2 nanospheres as labels was carried out in a 96-well plate. The Ag nanoparticles (NPs) acted as bifunctional units both for triggering the resonance energy transfer (RET) with g-C3N4 and for accelerating the electron transfer rate of the Ru-MOF-Ag ECL reaction. When the H2O2 catalyzed by GOx in the 96-well plate was transferred to the dual-disk glass carbon electrode, the doped Ag NPs in the two luminophors could be etched, thus destroying the RET between C3N4 and the accelerated reaction to Ru-MOF, resulting in an opposite trend in the ECL signal outputted from the dual disks. Using the ratio of the two signals for quantification, the constructed immunosensor for a model target, i.e. myoglobin, exhibited a low detection limit of 4.7 × 10-14 g/mL. The ingenious combination of ECL ratiometry, bifunctional Ag NPs, and a split-type strategy effectively reduces environmental and human errors, offering a more precise and sensitive analysis for complex samples.

Promoting CO2 Electroreduction to Ethane by Iodide-Derived Copper with the Hydrophobic Surface.

Electrochemical reduction of CO2 to value-added products provides a feasible pathway for mitigating net carbon emissions and storing renewable energy. However, the low dimerization efficiency of the absorbed CO intermediate (*CO) and the competitive hydrogen evolution reaction hinder the selective electroreduction of CO2 to ethane (C2H6) with a high energy density. Here, we designed hydrophobic iodide-derived copper electrodes (I-Cu/Nafion) for reducing CO2 to C2H6. The Faradaic efficiency of C2H6 reached 23.37% at -0.7 V vs RHE over the I-Cu/Nafion electrode in an H-type cell, which was about 1.7 times higher than that of the I-Cu electrode. The hydrophobic properties of the I-Cu/Nafion electrodes led to an increase in the local CO2 concentration and stabilized the Cu+ species. In situ Raman characterizations and density functional theory calculations indicate that the enhanced performances could be ascribed to the strong *CO adsorption and decreased the formation energy of *COOH and *COCOH intermediates. This study highlights the effect of the hydrophobic surface on Cu-based catalysts in the electroreduction of CO2 and provides a promising way to adjust the selectivity of C2 products.

The impact of salinity on the cohesion process of quartz substracts: A molecular dynamics study.

The moisture with salt ions adsorbed on the mineral soil surface is crucial to the cohesion process when the media is exposed to marine or coastal environments. However, the impact of salinity on the cohesion of soils is not well studied at the nanoscale. In this study, the salinity effect was investigated by studying the wettability and capillary force of NaCl solutions on quartz substrates via a molecular dynamics-based approach. Besides, a new visualization method was proposed to measure the contact angle of liquid droplets from the aspect of nanoscale. The results indicated that salt ions can weaken the wettability of the liquid on the quartz surface and inhibit the capillary force. Compared with water, the liquid with a 10% NaCl solution can achieve a capillary force reduction of around 70%, resulting in a detrimental effect on the cohesion of soils. Overall, this study enhanced the understanding of the nanoscale salinity effect on the cohesion process and provided insights into the modification of the mechanical properties of soils from the aspect of nanoscale.