Early Detection of Pipeline Natural Gas Leakage from Hyperspectral Imaging by Vegetation Indicators and Deep Neural Networks.

The timely detection of underground natural gas (NG) leaks in pipeline transmission systems presents a promising opportunity for reducing the potential greenhouse gas (GHG) emission. However, existing techniques face notable limitations for prompt detection. This study explores the utility of Vegetation Indicators (VIs) to reflect vegetation health deterioration, thereby representing leak-induced stress. Despite the acknowledged potential of VIs, their sensitivity and separability remain understudied. In this study, we employed ground vegetation as biosensors for detecting methane emissions from underground pipelines. Hyperspectral imaging from vegetation was collected weekly at both plant and leaf scales over two months to facilitate stress detection using VIs and Deep Neural Networks (DNNs). Our findings revealed that plant pigment-related VIs, modified chlorophyll absorption reflectance index (MCARI), exhibit commendable sensitivity but limited separability in discerning stressed grasses. A NG-specialized VI, the optimized soil-adjusted vegetation index (OSAVI), demonstrates higher sensitivity and separability in early detection of methane leaks. Notably, the OSAVI proved capable of discriminating vegetation stress 21 days after methane exposure initiation. DNNs identified the methane leaks following a 3-week methane treatment with an accuracy of 98.2%. DNN results indicated an increase in visible (VIS) and a decrease in near-infrared (NIR) in spectra due to methane exposure.

An Ochratoxin a DNA Aptamer-Mediated Transcriptional Regulatory Riboswitch Biosensor.

This study developed a transcriptional regulation riboswitch biosensing analytical method based on the Ochratoxin A (OTA) DNA aptamer programming design. OTA DNA aptamer was used to develop artificial riboswitch, a strategy that relies on a simple combination of single-stranded DNA (ssDNA) template with oligonucleotides that base pair only in the -17 to +1 region to define promoter elements. The OTA DNA aptamer sequence GATCGGGTTGGGTGGCGTAAAGGGAGCATCGG (1.12.8) has a typical antiparallel G-quadruplex structure, and the presence of OTA will further stabilize this structure. Based on this property, OTA DNA aptamer can be used to construct riboswitch and potentially transcriptionally regulate gene expression. To further increase the impact of OTA-binding aptamer on the structure, an ssDNA template was prepared based on the rolling circle replication mechanism of the helper phage M13K07. This ssDNA was used in the cell-free expression system to inhibit the expression of the downstream reporter gene colorimetric enzyme catechol (2,3)-dioxygenase (C23DO) in the presence of OTA. C23DO was used to catalyze the substrate catechol to produce a colorimetric output. This study broadens the potential of artificial riboswitch as practical biosensing module tools and contributes to the development of simple, rapid, field-deployable analytical methods with broad application prospects for field placement testing.

5†kW power-level 1050†nm narrow-linewidth fiber amplifier enabled by biconical-tapered active fiber.

Effective wavelength extension is vital in the applications of high-power narrow-linewidth fiber lasers. In this work, we demonstrate a 5-kW power-level narrow-linewidth fiber amplifier at 1050 nm utilizing a homemade biconical-tapered Yb-doped fiber (BT-YDF). Up to ∼4.96 kW fiber laser is achieved with a 3 dB linewidth of ∼0.54 nm and a beam quality factor of Mx 2 = 1.46, My 2 = 1.6. The experimental comparisons reveal that BT-YDF has the advantages of improving a stimulated Raman scattering threshold and balancing transverse mode instability suppression in the fiber amplifier. This work could provide a good reference for extending the operating wavelength of high-power fiber amplifiers.

General error analysis of matrix-operation-mode decomposition technique in few-mode fiber laser.

The mode decomposition based on matrix operation (MDMO) is one of the fastest mode decomposition (MD) techniques, which is important to the few-mode fiber laser characterization and its applications. In this paper, the general error of the MDMO technique was analyzed, where different influencing factors, such as position deviation of the optical imaging system, coordinate deviation of the image acquisition system, aberrations, and mode distortion were considered. It is found that the MDMO technique based on far-field intensity distribution is less affected by optical imaging system position deviation, coordinate deviation of the image acquisition system, and mode distortion than those based on direct near-field decomposition. But far-field decomposition is more affected by aberration than those based on near-field decomposition. In particular, the numerical results show that the deviation of the coordinate axis direction is an important factor limiting the accuracy of MD. In addition, replacing the ideal eigenmode basis with a distorted eigenmode basis can effectively suppress the decrease in mode decomposition accuracy caused by fiber bending. Moreover, based on detailed numerical analysis results, fitting formulas for estimating the accuracy of the MDMO technique with imperfections are also provided, which provides a comprehensive method for evaluating the accuracy of the MDMO technique in practical engineering operations.

Evaluation of the impact of weak end feedback on the SBS threshold in high-power narrow-linewidth fiber amplifiers.

In this work, we quantitatively investigate the SBS threshold in high-power narrow-linewidth fiber amplifiers seeded with phase-modulated single-frequency lasers in presence of weak end feedback. The impacts of the end feedback and spectral linewidths on the SBS threshold are demonstrated in detail through comparative experiments and numerical simulations, respectively. In the experiment, we have pointed out a practical method to estimate the end reflectivity in high-power fiber amplifiers. Based on this estimation, the SBS threshold characters of the high-power narrow-linewidth fiber amplifiers with different end reflectivity and seed linewidths are investigated. By reducing the end reflectivity, a 2.85 times SBS threshold enhancement has been achieved at the most susceptible linewidth (16.8 GHz). Furthermore, we propose a spectral evolution model to investigate the SBS threshold in high-power narrow-linewidth fiber amplifiers, which is even capable for calculating SBS thresholds of the systems with tens of GHz linewidth while weak end reflection is considered. The simulation results demonstrate that end reflection will obviously affect the SBS threshold when the linewidth of the seed laser is broadened beyond 5 GHz, especially for the spectral linewidth of seed lasers nearing the Brillouin frequency shift. Besides, when the end reflectivity is set to be stronger than -65 dB, the SBS threshold performs a tendency to decline and then rise with the growth of seed linewidth. The experiment and simulation results provide a new optimization sight for the SBS effect suppression in high-power narrow-linewidth fiber amplifiers.

A fused multi-subfrequency bands and CBAM SSVEP-BCI classification method based on convolutional neural network.

For the brain-computer interface (BCI) system based on steady-state visual evoked potential (SSVEP), it is difficult to obtain satisfactory classification performance for short-time window SSVEP signals by traditional methods. In this paper, a fused multi-subfrequency bands and convolutional block attention module (CBAM) classification method based on convolutional neural network (CBAM-CNN) is proposed for discerning SSVEP-BCI tasks. This method extracts multi-subfrequency bands SSVEP signals as the initial input of the network model, and then carries out feature fusion on all feature inputs. In addition, CBAM is embedded in both parts of the initial input and feature fusion for adaptive feature refinement. To verify the effectiveness of the proposed method, this study uses the datasets of Inner Mongolia University of Technology (IMUT) and Tsinghua University (THU) to evaluate the performance of the proposed method. The experimental results show that the highest accuracy of CBAM-CNN reaches 0.9813 percentage point (pp). Within 0.1-2 s time window, the accuracy of CBAM-CNN is 0.0201-0.5388 (pp) higher than that of CNN, CCA-CWT-SVM, CCA-SVM, CCA-GNB, FBCCA, and CCA. Especially in the short-time window range of 0.1-1 s, the performance advantage of CBAM-CNN is more significant. The maximum information transmission rate (ITR) of CBAM-CNN is 503.87 bit/min, which is 227.53 bit/min-503.41 bit/min higher than the above six EEG decoding methods. The study further results show that CBAM-CNN has potential application value in SSVEP decoding.

Comprehensive multi-omics analysis of resectable locally advanced gastric cancer: Assessing response to neoadjuvant camrelizumab and chemotherapy in a single-center, open-label, single-arm phase II trial.

BACKGROUND: The current standard of care for locally advanced gastric cancer (GC) involves neoadjuvant chemotherapy followed by radical surgery. Recently, neoadjuvant treatment for this condition has involved the exploration of immunotherapy plus chemotherapy as a potential approach. However, the efficacy remains uncertain. METHODS: A single-arm, phase 2 study was conducted to evaluate the efficacy and tolerability of neoadjuvant camrelizumab combined with mFOLFOX6 and identify potential biomarkers of response through multi-omics analysis in patients with resectable locally advanced GC. The primary endpoint was the pathological complete response (pCR) rate. Secondary endpoints included the R0 rate, near pCR rate, progression-free survival (PFS), disease-free survival (DFS), and overall survival (OS). Multi-omics analysis was assessed by whole-exome sequencing, transcriptome sequencing, and multiplex immunofluorescence (mIF) using biopsies pre- and post-neoadjuvant therapy. RESULTS: This study involved 60 patients, of which 55 underwent gastrectomy. Among these, five (9.1%) attained a pathological complete response (pCR), and 11 (20.0%) reached near pCR. No unexpected treatment-emergent adverse events or perioperative mortality were observed, and the regimen presented a manageable safety profile. Molecular changes identified through multi-omics analysis correlated with treatment response, highlighting associations between HER2-positive and CTNNB1 mutations with treatment sensitivity and a favourable prognosis. This finding was further supported by immune cell infiltration analysis and mIF. Expression data uncovered a risk model with four genes (RALYL, SCGN, CCKBR, NTS) linked to poor response. Additionally, post-treatment infiltration of CD8+ T lymphocytes positively correlates with pathological response. CONCLUSION: The findings suggest the combination of PD-1-inhibitor and mFOLFOX6 showed efficacy and acceptable toxicity for locally advanced GC. Extended follow-up is required to determine the duration of the response. This study lays essential groundwork for developing precise neoadjuvant regimens.

Unprecedented variation pattern of plastid genomes and the potential role in adaptive evolution in Poales.

BACKGROUND: The plastid is the photosynthetic organelle in plant cell, and the plastid genomes (plastomes) are generally conserved in evolution. As one of the most economically and ecologically important order of angiosperms, Poales was previously documented to exhibit great plastomic variation as an order of photoautotrophic plants. RESULTS: We acquired 93 plastomes, representing all the 16 families and 5 major clades of Poales to reveal the extent of their variation and evolutionary pattern. Extensive variation including the largest one in monocots with 225,293 bp in size, heterogeneous GC content, and a wide variety of gene duplication and loss were revealed. Moreover, rare occurrences of three inverted repeat (IR) copies in angiosperms and one IR loss were observed, accompanied by short IR (sIR) and small direct repeat (DR). Widespread structural heteroplasmy, diversified inversions, and unusual genomic rearrangements all appeared in Poales, occasionally within a single species. Extensive repeats in the plastomes were found to be positively correlated with the observed inversions and rearrangements. The variation all showed a "small-large-moderate" trend along the evolution of Poales, as well as for the sequence substitution rate. Finally, we found some positively selected genes, mainly in C4 lineages, while the closely related lineages of those experiencing gene loss tended to have undergone more relaxed purifying selection. CONCLUSIONS: The variation of plastomes in Poales may be related to its successful diversification into diverse habitats and multiple photosynthetic pathway transitions. Our order-scale analyses revealed unusual evolutionary scenarios for plastomes in the photoautotrophic order of Poales and provided new insights into the plastome evolution in angiosperms as a whole.

A brain functional network feature extraction method based on directed transfer function and graph theory for MI-BCI decoding tasks.

Background: The development of Brain-Computer Interface (BCI) technology has brought tremendous potential to various fields. In recent years, prominent research has focused on enhancing the accuracy of BCI decoding algorithms by effectively utilizing meaningful features extracted from electroencephalographic (EEG) signals. Objective: This paper proposes a method for extracting brain functional network features based on directed transfer function (DTF) and graph theory. The method incorporates the extracted brain network features with common spatial pattern (CSP) to enhance the performance of motor imagery (MI) classification task. Methods: The signals from each electrode of the EEG, utilizing a total of 32 channels, are used as input signals for the network nodes. In this study, 26 healthy participants were recruited to provide EEG data. The brain functional network is constructed in Alpha and Beta bands using the DTF method. The node degree (ND), clustering coefficient (CC), and global efficiency (GE) of the brain functional network are obtained using graph theory. The DTF network features and graph theory are combined with the traditional signal processing method, the CSP algorithm. The redundant network features are filtered out using the Lasso method, and finally, the fused features are classified using a support vector machine (SVM), culminating in a novel approach we have termed CDGL. Results: For Beta frequency band, with 8 electrodes, the proposed CDGL method achieved an accuracy of 89.13%, a sensitivity of 90.15%, and a specificity of 88.10%, which are 14.10, 16.69, and 11.50% percentage higher than the traditional CSP method (75.03, 73.46, and 76.60%), respectively. Furthermore, the results obtained with 8 channels were superior to those with 4 channels (82.31, 83.35, and 81.74%), and the result for the Beta frequency band were better than those for the Alpha frequency band (87.42, 87.48, and 87.36%). Similar results were also obtained on two public datasets, where the CDGL algorithm's performance was found to be optimal. Conclusion: The feature fusion of DTF network and graph theory features enhanced CSP algorithm's performance in MI task classification. Increasing the number of channels allows for more EEG signal feature information, enhancing the model's sensitivity and discriminative ability toward specific activities in brain regions. It should be noted that the functional brain network features in the Beta band exhibit superior performance improvement for the algorithm compared to those in the Alpha band.

Genome assemblies of 11 bamboo species highlight diversification induced by dynamic subgenome dominance.

Polyploidy (genome duplication) is a pivotal force in evolution. However, the interactions between parental genomes in a polyploid nucleus, frequently involving subgenome dominance, are poorly understood. Here we showcase analyses of a bamboo system (Poaceae: Bambusoideae) comprising a series of lineages from diploid (herbaceous) to tetraploid and hexaploid (woody), with 11 chromosome-level de novo genome assemblies and 476 transcriptome samples. We find that woody bamboo subgenomes exhibit stunning karyotype stability, with parallel subgenome dominance in the two tetraploid clades and a gradual shift of dominance in the hexaploid clade. Allopolyploidization and subgenome dominance have shaped the evolution of tree-like lignified culms, rapid growth and synchronous flowering characteristic of woody bamboos as large grasses. Our work provides insights into genome dominance in a remarkable polyploid system, including its dependence on genomic context and its ability to switch which subgenomes are dominant over evolutionary time.

The "quadrant-sandwich" method in clockwise modular D2 lymph node dissection in laparoscopic total gastrectomy: a retrospective cohort study.

Background: For patients who need laparoscopic radical gastrectomy, lymph node dissection (LND) and optimization of surgical procedures are particularly important. This study introduces the "quadrant-sandwich" method in clockwise modular D2 LND and evaluates the advantages and safety of this method. Methods: The clinical data of 108 laparoscopic total gastrectomy patients admitted to the Affiliated Cancer Hospital of Zhengzhou University from January 2019 to January 2022 were retrospectively analyzed. Based on the different LND processes, 55 patients were allocated to the observation group, which underwent clockwise modular LND using the "quadrant-sandwich method", and 53 patients were allocated to the control group, which underwent traditional LND. The effectiveness and safety of the approach in terms of operation time, blood loss, lymph node yield, postoperative recovery and postoperative complications were observed in the two groups. Results: There was no statistical difference between the baseline data of the two groups. In relation to the surgery, the observation group had an operation time of 227.0±48.5 minutes, and intraoperative bleeding of 100.0 mL [inter-quartile range (IQR), 30.0-200.0 mL], while the control group had an operation time of 247±41.5 minutes, and intraoperative bleeding of 180.0 mL (IQR, 130.0-245.0 mL). There were statistically significant differences between the two groups in terms of the operation time and intraoperative bleeding (P=0.001, P=0.020). In relation to the LND, there were no statistically significant differences between the two groups in terms of the total number of lymph nodes in each division, and the number of positive lymph nodes. In relation to the post-operative results, there were no statistically significant differences between the two groups in terms of the post-operative pathological stage, first postoperative oral feeding, post-operative hospitalization time, and post-operative complications. Conclusions: Clockwise modular D2 LND using the "quadrant-sandwich method" is potentially safe and feasible in laparoscopic total gastrectomy. It not only ensures the thoroughness of the LND, but also ensures and efficient and fast surgical process, shortens the operation time, and reduces the amount of intraoperative bleeding.

Postoperative superior anastomotic leakage classification and treatment strategy for postoperative esophagogastric junction cancer.

Background: At present, anastomotic fistula cannot be avoided after adenocarcinoma of the esophagogastric junction (AEG). Once the anastomotic leakage occurs, the posterior mediastinum and the left thoracic cavity are often seriously infected, which further impairs respiratory and circulatory function, heightening the danger of the disease course. The aim of this study was to identify the characteristics of superior anastomotic leakage after surgery for AEG and recommend corresponding treatment strategies to improve the diagnosis and treatment of superior anastomotic leakage after surgery for AEG. Methods: The clinical data of 57 patients with superior anastomotic leakage after surgery for AEG in the Affiliated Cancer Hospital of Zhengzhou University from January 2017 to March 2019 were retrospectively analyzed, including 27 cases referred from external hospitals and 30 cases at the Affiliated Cancer Hospital of Zhengzhou University. According to the diameter and risk level of anastomotic leakage, the high anastomotic leakage is divided into types I, II, III, and IV. Results: Patients with preoperative comorbidities or those treated with the transabdominal approach or laparoscopic surgery often had type I and type II anastomotic leakage; meanwhile, patients with preoperative comorbidities and sacral perforation or those treated with a thoracic and abdominal approach or open surgery often had type III and IV fistula. The difference between types I-II and types III-IV was statistically significant (P<0.05). The mortality rate of patients with type III and type IV leakage was 14.8% within 90 days after operation, while no deaths occurred among patients with type I and type II leakage, and the difference in mortality between the two groups was statistically significant (P<0.05). Conclusions: After surgery for AEG, suitable treatment measures should be adopted according to the type of superior anastomotic leakage that occurs. Types III and IV superior anastomotic leakages are associated with higher mortality and require greater attention from surgeons.

Retrospective study of combined pelvic exenteration in the treatment of primary and recurrent pelvic malignant tumors.

Background: Pelvic malignant tumors often originate in the rectum, bladder, uterus, and other organs. In patients with locally advanced tumours in the presence of direct invasion of one or more organs, negative tumor resection margin (R0) resection can be very beneficial to patient survival if it can be performed. As a multidisciplinary and high-risk surgical method, the pelvic exenteration (PE) procedure has only been reported in a few medical centres internationally. We retrospectively analyzed the clinical data of patients who had undergone PE surgery in our hospital, in order to provide ideas for the best treatment of patients with pelvic malignant tumors. Methods: A retrospective analysis was conducted of 59 patients with pelvic malignant tumors admitted to the Affiliated Cancer Hospital of Zhengzhou University from January 2015 to July 2021, all of whom received PE surgery. They were divided into two groups according to the location of the disease: the rectal cancer group (n=40) and the cervical cancer group (n=19). Statistical analysis was performed on the baseline and follow-up data of the two groups of patients. Results: (I) Patient baseline data. Compared to the rectal cancer group, more patients in the cervical cancer group received preoperative radiotherapy and chemotherapy (P=0.013), and had a lower R0 resection rate (P=0.037). Postoperative complications in patients with rectal cancer and cervical cancer were 27.5% and 47.3%, respectively. (II) Patient survival analysis after PE surgery. The 5-year survival rate was 36.6% in the rectal cancer group and 25.3% in the cervical cancer group. In the rectal cancer group, for the primary tumor, if there was no lymph node metastasis or no postoperative complications in the postoperative pathology, the patient had a good survival prognosis. Univariate analysis showed that recurrent rectal cancer, postoperative lymph node metastasis, postoperative complications, and microsatellite stability (MSS) were significant predictors of poor survival outcomes. Multivariate analysis showed that lymph node metastasis and postoperative complications were independent prognostic factors for patient survival. Conclusions: PE is a viable option for pelvic malignancies; aggressive radical resection of lesions and reduced postoperative complications can effectively improve patient outcomes.

Clinicopathological features and prognoses in younger and older patients with mismatch repair defects colorectal cancer: a retrospective comparative cohort study.

Background: Microsatellite instability-high (MSI-H) is an important biomarker for predicting the effects of immune checkpoint inhibitors (ICIs) in colorectal cancer (CRC) patients. However, due to the low mutation rate of MSI-H/deficient mismatch repair (dMMR) in the overall population, some doctors are of the view that testing this indicator increases the burden on patients, and consequently some patients fail to receive the most beneficial treatment methods. In order to provide testing criteria for younger patients with a higher proportion of MSI-H, we designed this retrospective controlled study. Methods: A retrospective analysis was conducted of 1,901 patients who were admitted to the Affiliated Cancer Hospital of Zhengzhou University from January 2017 to December 2019 and underwent CRC-related gene testing. For this analysis, 100 patients aged 40 or younger are defined as the young group, and 305 patients aged 71 and older but younger than 80 are defined as the elderly group. We included patients who met the following criteria: (I) underwent preoperative colonoscopy or gastroscopy and were diagnosed with CRC; (II) received perioperative adjuvant therapy; (III) underwent curative surgery for CRC. Each patient was followed up from the time of surgery until April 30, 2023, or death, with follow-up visits scheduled every 3 months for the first 2 years after surgery, and every 6 months thereafter. Clinical characteristics such as age, gender, body mass index (BMI), tumor depth (T), number of metastatic lymph nodes (N), distant metastasis (M), tumor, node, metastasis (TNM) stage, extent of surgical resection, tumor size, tumor location, differentiation grade, and carcinoembryonic antigen (CEA) levels were collected. The microsatellite instability (MSI) status was analyzed using fluorescence in situ hybridization (FISH). Results: In young CRC patients, the proportion of MSI-H is higher than in elderly CRC patients (33% vs. 10.16%, P<0.001). The proportion of poorly differentiated tumors is also higher in young CRC patients compared to elderly CRC patients (53% vs. 31.15%, P<0.001). However, there were no significant differences in clinical characteristics between young and elderly CRC patients. In terms of prognosis, survival analysis of the young group showed that MSI status [hazard ratio (HR) =0.26, 95% confidence interval (CI): 0.08-0.88, P=0.03], TNM staging (HR =3.84, 95% CI: 1.38-10.71, P=0.010) were associated with the prognosis of CRC patients. Conclusions: The mutation rate of MSI-H is higher in young CRC patients compared to older. Our study further confirms that MSI-H can serve as a favorable prognostic marker for CRC patients. This finding may provide valuable guidance for clinicians in terms of prognosis assessment and treatment selection. If feasible, we hope that MSI testing can be performed for all CRC patients to enable targeted testing, with particular attention to monitoring the MSI status in young patients. This will aid clinicians in selecting appropriate treatment strategies for these patients.

The long-term outcomes and prognostic factors about locally advanced right colon cancer: a retrospective cohort study.

Background: The first case of treatment with en bloc right hemicolectomy with pancreatoduodenectomy (RHCPD) for locally advanced right-sided colon cancer (LARCC) invading the pancreas, duodenum, or other organs, was reported in 1953 by Van Prohaska. Right-sided colon cancers invading the pancreas and duodenum are rare. Surgery can be technically challenging, with unclear oncologic consequences, hence there are few reports on the clinical outcomes and factors associated with survival in this patient cohort. The need for neoadjuvant chemotherapy in patients with LARCC is controversial, and the long-term survival of these patients as well as the preferred treatment regimen needs to be explored. This paper reports our experience in right hemicolectomy with en bloc resection for LARCC. We conducted this study to analyze the clinical features and surgical outcomes of LARCC. Methods: A retrospective study was performed using a database of all patients who underwent RHCPD due to the tumour directly invading the duodenum and/or pancreas in a 19-year period [2003-2022]. We included patients whose primary tumor site was the right hemicolon and who had undergone a negative tumor resection margin (R0) resection. In addition, the adhesions between the colon and other organs in these patients were malignant adhesions. The primary outcome was the overall survival after surgery. The secondary endpoints of the study included 30-day postoperative mortality, postoperative complications, prognostic factors, and tumour genetics. All patients were followed up with postoperative imaging at an interval of 3 months for the first 3 years and at an interval of 6 months for the next 2 years, and annual follow-up thereafter. Survival was estimated using Kaplan-Meier analysis. Variables with P values <0.05 in univariate analysis were entered into multivariate Cox proportional risk regression to identify independent predictors of survival. Results: There were 47 patients (23 males and 24 females) who underwent en bloc resection for LARCC. The median age of the patients was 61 years (range, 38-80 years). R0 resection was achieved in all cases. The overall complication rate was 27.7% (n=13). Two patients died within 30 days of surgery. The overall survival was 80.9%, 63.5%, and 51.7% at 1, 3, and 5 years, respectively. Univariate survival analysis identified pancreatic invasion, regional lymph node positivity, more than two organs invaded, and no neoadjuvant treatment as predictors of poor survival (log-rank P<0.05). Multivariate analysis showed that regional lymph node positivity [95% confidence interval (CI): 1.145-7.736; P=0.025] and more than two organs invaded (95% CI: 1.321-26.981; P=0.020) were predictors of poor survival. Conclusions: Relatively optimistic clinical outcomes from en bloc resection were demonstrated for patients with LARCC. For LARCC patients, en bloc resection can be carefully considered.

Recent Advances in Vitamin D3 Intervention to Eradicate Helicobacter pylori Infection.

Helicobacter pylori (HP) infections affect approximately one-third of children worldwide. In China, the incidence of HP infection in children ranges from approximately 30% to 60%. In addition to damaging the gastrointestinal tract mucosa, HP infection in children can negatively affect their growth and development, hematology, respiratory and hepatobiliary system, skin, nutritional metabolism, and autoimmune system. However, the rate of HP eradication also fell considerably from the previous rate due to the presence of drug-resistant HP strains and the limited types of antibiotics that can be used in young patients. Vitamin D3 (VitD3) is a steroid hormone that can reduce inflammation in the stomach mucosa induced by HP and can alleviate and eradicate HP through a variety of pathways and mechanisms, including immune regulation and the stimulation of antimicrobial peptide (AMP) secretion and Ca2+ influx, to reestablish lysosomal acidification; thus, these results provide new strategies and ideas for the eradication of drug-resistant HP strains.

High-affinity truncated aptamers for detection of Cronobacter spp with magnetic separation-assisted DNAzyme-driven 3D DNA walker.

After optimizing the original aptamer sequence by truncation strategy, a magnetic separation-assisted DNAzyme-driven 3D DNA walker fluorescent aptasensor was developed for detecting the food-borne pathogen Cronobacter species. Iron oxide magnetic nanoparticles (MNPs) modified with a hybrid of truncated aptamer probe and DNAzyme strand (AP-E1) denoted as MNPs@AP-E1, were employed as capture probes. Simultaneously, a DNAzyme-driven 3D-DNA walker was utilized as the signal amplification element. The substrate strand (Sub) was conjugated with the gold nanoparticles (AuNPs), resulting in the formation of AuNPs@Sub, which served as a 3D walking track. In the presence of the target bacteria and Mg2+, E1-DNAzyme was activated and moved along AuNPs@Sub, continuously releasing the signal probe. Under optimized conditions, a strong linear correlation was observed for Cronobacter sakazakii (C. sakazakii) in the concentration range 101 to 106 CFU mL-1, with a low detection limit of 2 CFU mL-1. The fluorescence signal responses for different Cronobacter species exhibited insignificant differences, with a relative standard deviation of 3.6%. Moreover, the aptasensor was successfully applied to determine  C. sakazakii in real samples with recoveries of 92.86%-108.33%. Therefore, the novel method could be a good candidate for ultra-sensitive and selective detection of Cronobacter species without complex manipulation.

Interfacial electric field construction of hollow PdS QDs/Zn1-xCdxS solid solution with enhanced photocatalytic hydrogen evolution.

The regulation of hollow morphology, band structure modulation of solid solution, and introduction of cocatalysts greatly promote the separation of electron-hole pairs in photocatalytic processes, which is of great significance for the process of photocatalytic hydrogen evolution (PHE). In this study, we constructed Zn1-xCdxS hollow solid solution photocatalysts using template and ion exchange methods, and successfully loaded PdS quantum dots (PdS QDs) onto the solid solution through in situ sulfidation. Significantly, the 0.5 wt% PdS QDs/Zn0.6Cd0.4S composite material achieved a H2 production rate of 27.63 mmol g-1 h-1 in the PHE process. The hollow structure of the composite material enhances processes such as light reflection and scattering, the band structure modulation of the solid solution enables the electron-hole pairs to reach an optimal exciton recombination balance, and the modification of PdS QDs provides abundant sites for oxidation, thereby promoting the proton reduction and hydrogen evolution rate. This work provides valuable guidance for the rational design of efficient composite PHE catalysts with strong internal electric field.

Anthropogenic disturbance driving population decline of a dominant tree in East Asia evergreen broadleaved forests over the last 11,000 years.

Current biodiversity loss is generally considered to have been caused by anthropogenic disturbance, but it is unclear when anthropogenic activities began to affect biodiversity loss. One hypothesis suggests it began with the Industrial Revolution, whereas others propose that anthropogenic disturbance has been associated with biodiversity decline since the early Holocene. To test these hypotheses, we examined the unique vegetation of evergreen broadleaved forests (EBLFs) in East Asia, where humans have affected landscapes since the early Holocene. We adopted a genomic approach to infer the demographic history of a dominant tree (Litsea elongata) of EBLFs. We used Holocene temperature and anthropogenic disturbance factors to calculate the correlation between these variables and the historical effective population size of L. elongata with Spearman statistics and integrated the maximum-entropy niche model to determine the impact of climate change and anthropogenic disturbance on fluctuation in its effective population size. We identified 9 well-defined geographic clades for the populations of L. elongata. Based on the estimated historical population sizes of these clades, all the populations contracted, indicating persistent population decline over the last 11,000 years. Demographic history of L. elongata and human population change, change in cropland use, and change in irrigated rice area were significantly negatively correlated, whereas climate change in the Holocene was not correlated with demographic history. Our results support the early human impact hypothesis and provide comprehensive evidence that early anthropogenic disturbance may contribute to the current biodiversity crisis in East Asia.