ABSTRACT
PURPOSE: The long noncoding RNA LINC00261 was reported to be involved in carcinogenesis and has been validated as a tumor suppressor in pancreatic cancer (PC); however, how LINC00261 is regulated has not been fully examined. Here, we attempted to investigate the upstream and downstream targets of LINC00261 in PC. METHODS: LINC00261 expression in PC tissues was examined by the Gene Expression Omnibus (GEO) datasets and the Gene Expression Profiling Interactive Analysis (GEPIA) database. The quantitative reverse transcription polymerase chain reaction (qRT-PCR) assays were performed to detect the expression level of LINC00261 in PC cells. The location of LINC00261 in PC cells was identified by RNA fluorescence in situ hybridization (RNA-FISH). Cell Counting Kit-8 (CCK-8), cell apoptosis assay, transwell invasion and migration assays testified the critical role of LINC00261 in PC. The luciferase reporter assay was applied to confirm the binding of LINC00261 to its upstream transcription factor KLF13. The changes in LINC00261 related target protein levels were analyzed by Western blotting assay. RESULTS: LINC00261 was significantly lower in PC tissues and was mainly concentrated in the nucleus. Overexpression of LINC00261 inhibited the invasion and migration of PC cells. Mechanistically, transcription factor KLF13 was confirmed to inhibit the epithelial-mesenchymal transition (EMT) process of PC cells by promoting the transcription of LINC00261 and suppressing the expression of metastasis-associated proteins, such as matrix metalloproteinase MMP2 and vimentin, thus inhibiting the metastasis of PC. CONCLUSION: LINC00261 regulates PC cell metastasis through the "KLF13-LINC00261-mTOR-P70S6K1-S6" signaling pathway, which provides a significant set of potential PC therapeutic targets.
Subject(s)
Kruppel-Like Transcription Factors , MicroRNAs , Pancreatic Neoplasms , RNA, Long Noncoding , Cell Cycle Proteins , Cell Line, Tumor , Cell Movement/genetics , Cell Proliferation/genetics , Epithelial-Mesenchymal Transition , Humans , In Situ Hybridization, Fluorescence , Kruppel-Like Transcription Factors/genetics , MicroRNAs/genetics , MicroRNAs/metabolism , Pancreatic Neoplasms/genetics , Pancreatic Neoplasms/pathology , RNA, Long Noncoding/genetics , RNA, Long Noncoding/metabolism , Repressor Proteins , Signal Transduction , TOR Serine-Threonine Kinases/genetics , TOR Serine-Threonine Kinases/metabolism , Transcription Factors/genetics , Transcription Factors/metabolism , Up-Regulation , Pancreatic NeoplasmsABSTRACT
The prevalence rates of anti-citrullinated protein/peptide antibodies (ACPAs) were investigated in a cohort of juvenile idiopathic arthritis (JIA) patients, and their diagnostic performances were compared. ACPAs, including anti-cyclic citrullinated peptide IgG (anti-CCP), anti-CCP IgG/IgA (anti-CCP3.1), citrullinated recombinant rat filaggrin antibodies (CPA), anti-mutated citrullinated vimentin (anti-MCV), and antibodies to citrullinated human IgG-derived peptides (RA/CP), were measured in the sera from 81 JIA patients. Serum samples from 55 children with other joint diseases or viral infections and 49 healthy donors were tested as controls. Of the 81 JIA patients, 7 (8.6%), 8 (9.9%), 17 (21.0%), 23 (28.4%), and 18 (22.2%) were found to be positive for anti-CCP, anti-CCP3.1, CPA, anti-MCV, and RA/CP, respectively, with specificities of 98.1, 95.1, 93.3, 84.6, and 86.5%. Analysis by subtype revealed that 7/7 (100%) of RF-positive polyarticular JIA patients tested positive at high serum levels for anti-MCV or RA/CP, and 5/7 (71.4%) were positive for anti-CCP, anti- CCP3.1, or CPA (P < 0.001, compared with controls). Eighteen of 81 JIA patients demonstrated joint erosions on radiographs and erosive arthritis occurred more often in ACPAs positive patients (P < 0.01). Our findings indicate that although ACPAs are not satisfactory screening biomarkers for JIA due to low sensitivity, ACPA measurement can aid in diagnosing RF-positive polyarticular JIA and identifying JIA patients with severe bone involvement. The diagnostic performance of each ACPA in JIA is different, and the careful selection of assays is necessary.
Subject(s)
Arthritis, Juvenile/diagnosis , Peptides, Cyclic/immunology , Adolescent , Arthritis, Juvenile/blood , Arthritis, Juvenile/genetics , Arthritis, Juvenile/immunology , Autoantibodies/blood , Biomarkers/blood , Child , Child, Preschool , Female , Filaggrin Proteins , Humans , Immunoglobulin G/blood , Infant , Male , Peptides/immunology , Rheumatoid Factor/bloodABSTRACT
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
ABSTRACT
The objective of this study was to investigate whether a single defect in skin barrier function simulated by filaggrin silencing could induce Th2-predominant inflammation. Filaggrin gene expression was silenced in cultured normal human epidermal keratinocytes (NHEKs) using small hairpin RNA (shRNA, GTTGGCTCAAGCATATTATTT). The efficacy of silencing was confirmed by polymerase chain reaction (PCR) and Western blotting. Filaggrin-silenced cells (LV group), shRNA control cells (NC group), and noninfected cells (Blank group) were evaluated. The expression of cornified cell envelope-related proteins, including cytokeratin (CK)-5, -10, -14, loricrin, involucrin, and transglutaminase (TGM)-1, was detected by Western blotting. Interleukins (IL)-2, IL-4, IL-5, IL-12p70, IL-13, and interferon-gamma (IFN-γ) were detected by enzyme-linked immunosorbent assay (ELISA). After filaggrin was successfully silenced by shRNA, the expressions of CK-5, -10, -14, involucrin, and TGM-1 in NHEKs were significantly downregulated compared to the Blank and NC groups (P<0.05 or P<0.01); only loricrin expression was markedly upregulated (P<0.01). Filaggrin silencing also resulted in significant increases of IL-2, IL-4, IL-5, and IL-13 (P<0.05 or P<0.01), and significant decreases of IL-12p70 and IFN-γ (P<0.01) compared with cells in the Blank and NC groups. Filaggrin silencing impaired normal skin barrier function mainly by targeting the cornified cell envelope. The immune response after filaggrin silencing was characterized by Th2 cells, mainly because of the inhibition of IFN-γ expression. Lack of filaggrin may directly impair skin barrier function and then further induce the immune response.
ABSTRACT
In this study, we aimed to explore the curative effect and safety of neural stem cell intrathecal transplantation for the treatment of cerebral hemorrhage. We transplanted 4.0 x 10(8) neural stem cells per procedure into the subarachnoid space by lumbar puncture 7 days after cerebral hemorrhage, twice a week, a total of 4 times. NIHSS scores and brain CT scans were conducted to assess neural functions and the volume of perihematoma lesions in patients on days 1, 7, 14, 21, and 28. We found that the NIHSS scores and the volume of the perihematoma lesions were significantly reduced after day 14. The differences before and after treatment were highly significant in intra- and between-group comparisons (P < 0.05). There were no adverse reactions, except for transient fever and shivering in a few patients. Our data suggest that the use of neural stem cells in intrathecal transplantation for the treatment of cerebral hemorrhage is safe and effective.
Subject(s)
Cerebral Hemorrhage/therapy , Neural Stem Cells/cytology , Stem Cell Transplantation , Adult , Aged , Cell- and Tissue-Based Therapy , Cerebral Hemorrhage/etiology , Cerebral Hemorrhage/pathology , Cerebral Hemorrhage/physiopathology , Female , Humans , Injections, Spinal , Male , Middle Aged , Stem Cell Transplantation/adverse effects , Time Factors , Treatment OutcomeABSTRACT
This study was directed at the understanding of the function of CCoAOMT isolated from Acacia auriculiformis x Acacia mangium. Full length cDNA of the Acacia hybrid CCoAOMT (AhCCoAOMT) was 1024-bp long, containing 750-bp coding regions, with one major open reading frame of 249 amino acids. On the other hand, full length genomic sequence of the CCoAOMT (AhgflCCoAOMT) was 2548 bp long, containing three introns and four exons with a 5' untranslated region (5'UTR) of 391 bp in length. The 5'UTR of the characterized CCoAOMT gene contains various regulatory elements. Southern analysis revealed that the Acacia hybrid has more than three copies of the CCoAOMT gene. Real-time PCR showed that this gene was expressed in root, inner bark, leaf, flower and seed pod of the Acacia hybrid. Downregulation of the homologous CCoAOMT gene in tobacco by antisense (AS) and intron-containing hairpin (IHP) constructs containing partial AhCCoAOMT led to reduction in lignin content. Expression of the CCoAOMT in AS line (pART-HAS78-03) and IHP line (pART-HIHP78-06) was reduced respectively by 37 and 75% compared to the control, resulting in a decrease in the estimated lignin content by 24 and 56%, respectively. AhCCoAOMT was found to have altered not only S and G units but also total lignin content, which is of economic value to the pulp industry. Subsequent polymorphism analysis of this gene across eight different genetic backgrounds each of A. mangium and A. auriculiformis revealed 47 single nucleotide polymorphisms (SNPs) in A. auriculiformis CCoAOMT and 30 SNPs in A. mangium CCoAOMT.
Subject(s)
Acacia/genetics , Acacia/metabolism , Hybridization, Genetic , Lignin/biosynthesis , Methyltransferases/genetics , Amino Acid Sequence , Base Sequence , Cloning, Molecular , DNA, Complementary/chemistry , DNA, Complementary/genetics , Gene Expression , Gene Expression Regulation, Plant , Gene Order , Genetic Vectors/genetics , Methyltransferases/chemistry , Molecular Sequence Data , Organ Specificity/genetics , Plant Stems/cytology , Plant Stems/genetics , Polymorphism, Single Nucleotide , Promoter Regions, Genetic , Regulatory Elements, Transcriptional , Sequence Alignment , Nicotiana/genetics , Nicotiana/metabolismSubject(s)
Blood Glucose/analysis , Fasting , Glucagon/blood , Insulin/blood , Obesity/blood , Adolescent , Child , Food, Formulated , Humans , Male , Obesity/diet therapyABSTRACT
Se estudiaron seis pacientes adolescentes con obesidad grave. Su estancia en el hospital se dividio en cuatro periodos dieteticos de una semana cada uno: dieta normal, ayuno total, realimentacion con 200 calorias y realimentacion con 400 calorias. Se realizo una prueba de tolerancia a la glucosa al principio y otra al final del periodo de hospitalizacion.Al final de cada periodo de variacion dietetica se les practico una prueba de arginina e insulina. Las concentraciones de la glucosa se conservaron sin diferencia en todas las condiciones experimentales cuando se les estimulo con glucosa o con arginina e insulina.Las concentraciones de la insulina plasmatica fueron mayores durante la dieta normal y disminuyeron significativamente durante el periodo de ayuno. La reaccion del glucagon fue mas baja durante la dieta normal que durante el periodo de ayuno. Estas interacciones entre insulina y glucagon permiten conservar la homeostasia de la glucosa. Los cambios observados en estas dos hormonas parecen ser secundarios a las variaciones del estado nutricional
Subject(s)
Child , Adolescent , Humans , Diet , Obesity , Glucagon , Glucose , InsulinABSTRACT
The cortisol response to insulin hypoglycemia was determined in ten hypopituitary children treated for four months with both growth hormone and cyproheptadine, and in six other children with hypopituitarism treated for four months with hGH alone. All patients had previously normal responses to orally administered metyrapone. There was no demonstrable difference in the F responses to insulin hypoglycemia before and four months following its discontinuation in the patients receiving hGH alone. In the ten patients on combined therapy the F response to insulin hypoglycemia was normal in five and subnormal in five patients. These ten patients were retested at least two months after cessation of CPH therapy. The F response reverted to normal in four of the five patients in whom it had been subnormal. There was no significant change in the five patients with initial normal response. No patients had signs or symptoms of glucocorticoid insufficiency. In some cases, long-term administration of CPH to children with hypopituitarism is associated with decreased F response to insulin hypoglycemia; this may represent decreased adrenocortical reserve in these patients. The previously reported enhancement of growth of hypopituitary children treated with hGH and CPH may in part be a result of decreased F production.