Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 46
Filter
1.
Phys Rev Lett ; 132(16): 160801, 2024 Apr 19.
Article in English | MEDLINE | ID: mdl-38701444

ABSTRACT

A solid-state approach for quantum networks is advantageous, as it allows the integration of nanophotonics to enhance the photon emission and the utilization of weakly coupled nuclear spins for long-lived storage. Silicon carbide, specifically point defects within it, shows great promise in this regard due to the easy of availability and well-established nanofabrication techniques. Despite of remarkable progresses made, achieving spin-photon entanglement remains a crucial aspect to be realized. In this Letter, we experimentally generate entanglement between a silicon vacancy defect in silicon carbide and a scattered single photon in the zero-phonon line. The spin state is measured by detecting photons scattered in the phonon sideband. The photonic qubit is encoded in the time-bin degree of freedom and measured using an unbalanced Mach-Zehnder interferometer. Photonic correlations not only reveal the quality of the entanglement but also verify the deterministic nature of the entanglement creation process. By harnessing two pairs of such spin-photon entanglement, it becomes straightforward to entangle remote quantum nodes at long distance.

2.
Phys Rev Lett ; 132(18): 180803, 2024 May 03.
Article in English | MEDLINE | ID: mdl-38759186

ABSTRACT

Solid-state qubits with a photonic interface is very promising for quantum networks. Color centers in silicon carbide have shown excellent optical and spin coherence, even when integrated with membranes and nanostructures. Additionally, nuclear spins coupled with electron spins can serve as long-lived quantum memories. Pioneering work previously has realized the initialization of a single nuclear spin and demonstrated its entanglement with an electron spin. In this Letter, we report the first realization of single-shot readout for a nuclear spin in SiC. We obtain a deterministic nuclear spin initialization and readout fidelity of 94.95% with a measurement duration of 1 ms. With a dual-step readout scheme, we obtain a readout fidelity as high as 99.03% within 0.28 ms by sacrificing the success efficiency. Our Letter complements the experimental toolbox of harnessing both electron and nuclear spins in SiC for future quantum networks.

3.
Plant Dis ; 2023 Mar 01.
Article in English | MEDLINE | ID: mdl-36856647

ABSTRACT

Maize (Zea mays L.) as the most important crops is globally cultivated for food, feedstuff and industrial raw materials. During August to September 2021, we carried out a survey on the soil-borne diseases of tobacco in Guizhou Province. Poorly developed maize plants were observed in the same field of root-knot nematode (RKN) infected tobacco (Nicotiana tabacum L.) in Dafang County, Bijie City (106º00'08"E, 22º24'81"N) (Figure 1A). Roots of maize plant were taken back to laboratory for nematode identification and infecting confirmation in greenhouse. Females, males, second-stage juveniles (J2s) and eggs were collected from the sampling roots and nematodes were identified based on morphological and molecular characteristics. The identification of the nematode was performed by observations of morphological characters of adults (n= 30) and molecular analysis. Perineal pattern of female showed distinct characteristics of a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. 1B). J2s hatched from eggs demonstrated the morphometric characters of body length = 433.25 µm, body width = 16.31 µm, stylet length = 10.43 µm. DGO = 3.62 µm, tail length = 52.78 µm, and hyaline tail terminus = 11.14 µm (Fig. 1C). For molecular analysis, females from infected roots of maize in fields and in Koch's postulate experiment were definitively identified via PCR using the M. arenaria species-specific markers (Far/Rar:TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT). PCR products of females amplification were run in the agar gel, and a PCR product of 420 bp band was identified for M. arenaria for all tested female samples (Fig. 1E). The obtained specific fragment was sequenced and submitted to GenBank with accession number of OP503512. A 100% identity of the Fare/Rare sequence with M. arenaria (Accession: GQ395518.1, J. Phytopathol. 160(2): 59-66, 2012, MZ555757.1,MZ555753.1, U42342.1)were found through NCBI blast. Therefore, based on morphological and molecular analysis, the nematodes from maize were determined to be M. arenaria according to the related description of (Perry et al., 2009). Koch's postulate was conducted in greenhouse by inoculation of J2 from the original population to pots containing two-week old maize seedlings (n= 15, 1000 J2/seedling) and 5 seedlings were nonincubated as controls. Plants were maintained in greenhouse at 26 to 28°C. On day 50 after inoculation, all the inoculated plants showed typical RKN symptoms such as stunting and galled roots which were similar to those observed in the field (Fig. 2A). Females, J2 and eggs were found in the roots after staining(Fig. 2B, C, D) by the method of Bybd et al. (1983), while uninoculated control plants presented normal development, confirming that Maize was a host of M. arenaria. M. arenaria is one of the most damaging plant-parasitic nematodes, which can infect many crops worldwide, resulting in great losses on the crop quality and yield. The Southern Root-Knot Nematode (M. incognita) had been known to cause root-knot nematode disease on maize in Shandong Province of China(Shi et al.,2020). As a major rotation crop, maize was recommended for the management of RKNs and most soil-born pathogens in tobacco planting systems in China. However, the findings of M. arenaria on maize demonstrates that further investigation and management strategies should be conduct. To our knowledge, this is the first report of M. arenaria parasitizing maize in Guizhou province of China.

4.
Mitochondrial DNA B Resour ; 6(1): 40-42, 2021 Jan 06.
Article in English | MEDLINE | ID: mdl-33521261

ABSTRACT

The grain Chenopodium quinoa Willd. is the main traditional food of Inca aboriginal, which was a native grain in South American Andes Mountains, the edible and cultivation history of which has been more than five thousand years. In this study, we sequenced the complete chloroplast genome of C. quinoa on the Illumina platform by shotgun genome skimming method. The complete chloroplast genome of C. quinoa was 152,087 bp in length with the GC content 37.2%, which was comprised of a large single copy (LSC) region of 83,570 bp, a small single copy (SSC) region of 18,107 bp, and a pair of inverted repeats (IRA/IRB) of 25,205 bp. The chloroplast genome encoded 133 genes including 88 protein-coding genes, 37 tRNA genes and eight rRNA genes. Phylogenetic analysis constructed using the maximum likelihood (ML) method strongly supported the monophyly of each genus in the family Chenopodiaceae, and the genus Chenopodium is sister to Spinacia as a cluster, which closely grouped to Dysphania.

5.
Mitochondrial DNA B Resour ; 5(1): 1031-1033, 2020 Feb 03.
Article in English | MEDLINE | ID: mdl-33366861

ABSTRACT

The complete mitochondrial genome (mitogenome) of golden pheasant Chrysolophus pictus from North China was sequenced by the shotgun genome skimming methods. The mitogenome of C. pictus was 16,678 bp in length, consisting of 13 protein-coding genes, 22 tRNA genes, two rRNA genes and one non-coding control region (D-loop). Its overall base composition was 30.4% A, 24.8% T, 31.2% C and 13.6% G. All protein-coding genes had a typical ATG initiation codon except COX1 with GTG and terminated with a TAN codon, whereas COX1 terminated with a codon of AGG, COX3, ND2 and ND4 terminated with a single T. The ML phylogenetic tree constructed using 13 protein-coding genes showed that Chrysolophus species formed a monophyletic group, which was sister to the clade clustered by the two genera Crossoptilon and Lophura.

6.
Mitochondrial DNA B Resour ; 5(1): 1081-1083, 2020 Feb 07.
Article in English | MEDLINE | ID: mdl-33366884

ABSTRACT

We sequenced the complete mitochondrial genome (mitogenome) of Mustela sibirica in China by the shotgun genome skimming methods. The mitogenome of M. sibirica is 16,558bp in length with the base composition of 32.9% A, 27.3% T, 26.0% C, and 13.9% G, and consists of 13 protein-coding genes (PCGs), 22 tRNAs, two rRNAs, and one non-coding control region. The 13 PCGs use ATG as initiation codons except ND3, ND5 and ND2 which initiate with codons ATA and ATT, respectively. Four (COX3, ND1, ND2 and ND4) of the 13 PCGs terminate with a single T- -, and the remainder with a TAA termination codon except ND3 and CYT B using TA- and AGA as termination codon. The phylogenetic tree based on 13 protein-coding genes indicated that M. sibirica is sister to the clade grouped with three species M. nigripes, M. eversmannii, and M. putorius, and Mustelinae species formed a monophyletic group, which is close to the Lutrinae clade within Mustelidae.

7.
Article in English | WPRIM (Western Pacific) | ID: wpr-829019

ABSTRACT

Objective@#Our objective was to investigate the occurrence of opportunistic pathogens and characterize the bacterial community structures in the water system of a pulmonary hospital.@*Methods@#The water samples were collected from automatic and manual faucets in the consulting room, treatment room, dressing room, respiratory ward, and other non-medical rooms in three buildings of the hospital. Quantitative polymerase chain reaction was used to quantify the load of several waterborne opportunistic pathogens and related microorganisms, including spp., spp., and . Illumina sequencing targeting 16S rRNA genes was performed to profile bacterial communities.@*Results@#The occurrence rates of spp., spp., and were 100%, 100%, and 76%, respectively in all samples. Higher occurrence rates of were observed in the outpatient service building (building 1, 91.7%) and respiration department and wards (building 2, 80%) than in the office building (building 3), where no was found. were more abundant in automatic faucets (average 2.21 × 10 gene copies/L) than in manual faucets (average 1.03 × 10 gene copies/mL) ( < 0.01). , , , , , and were the dominant bacterial phyla. Disinfectant residuals, nitrate, and temperature were found to be the key environmental factors driving microbial community structure shifts in water systems.@*Conclusion@#This study revealed a high level of colonization of water faucets by opportunistic pathogens and provided insight into the characteristics of microbial communities in a hospital water system and approaches to reduce risks of microbial contamination.


Subject(s)
China , Drinking Water , Microbiology , Genes, Bacterial , Hospitals , Legionella , Microbiota , Mycobacterium , Mycobacterium avium , RNA, Bacterial , RNA, Ribosomal, 16S , Water Quality , Water Supply
8.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-871675

ABSTRACT

Objective:To summarize the early results and follow-up of mitral valve repair for rheumatic heart disease(RHD).Methods:From January 2018 to November 2019, 48 patients with rheumatic heart disease undergoing mitral valve repair in Cardiovascular Surgery Department of GaoZhou People' s Hospital were analyzed retrospectively. Surgical methods: according to the condition of mitral valve disease, the prosthetic mitral annulus was used in rheumatic mitral valve repair by the methods of joint incision, valve thinning, calcification stripping, Chordae tendineae release and papillary muscle splitting. All patients with tricuspid regurgitation were fixed with artificial valve ring(type C ring), and with atrial fibrillation were treated with Maze-IV radiofrequency ablation. Data on extracorporeal circulation time, aortic occlusion time, mechanical ventilation time, ICU stay time, and major postoperative complications were collected. Patients were followed up to assess mitral valve, cardiac function, and cardiac rhythm.Results:According to pathological classification, type Ⅰ were 9 cases, 31 cases as type Ⅱ and 8 cases as type Ⅲ. All patients in type I and type II were repaired successfully, and type III has 1 case who was repaired failed and underwent mitral valve replacement due to moderate regurgitation. Cardiopulmonary bypass(CPB) time was(110.62±27.68) min, Cross-clamp time was(76.63±17.63) min, ICU stay was(46.16±11.37) h, mechanical ventilation was(21.60±10.89) h. All survived at 30 days, 1 case of acute renal failure, 1 case of low cardiac output syndrome, 3 cases of pulmonary infection, no complications such as stroke and malignant Arrhythmia. 47 patients were followed up for(9.86±6.78) months. There were no death, malignant Arrhythmia and reoperation during the follow-up, and the cardiac function was improved significantly( P<0.001). Conclusion:The mitral valve repair of RHD can preserve the intact mitral valve structure, maintain the heart function, and have a good survival and quality of life. On the basis of mastering the repair of heart valve, being familiar with the anatomic features of rheumatic mitral valve disease, strictly grasping the indications, fully evaluating before operation, it is feasible to carry out the repair of rheumatic mitral valve, and the early clinical effect is satisfactory, long-term results recommend long-term follow-up.

9.
Zhongguo Zhong Yao Za Zhi ; 44(15): 3253-3260, 2019 Aug.
Article in Chinese | MEDLINE | ID: mdl-31602880

ABSTRACT

Flavonoids are a group of secondary metabolites found in plants. They have many pharmacological functions and play an important role in Chinese sumac( Rhus chinensis),which is a well-known traditional Chinese medicinal plant. Chalcone isomerase( CHI,EC 5. 5. 1. 6) is one of the key enzymes in the flavonoids biosynthesis pathway. In this paper,the full-length c DNA sequence encoding the chalcone isomerase from R. chinensis( designated as Rc CHI) was cloned by RT-PCR and rapid-amplification of c DNA Ends( RACE). The Rc CHI c DNA sequence was 1 058 bp and the open reading frame( ORF) was 738 bp. The ORF predicted to encode a 245-amino acid polypeptide. Rc CHI gene contained an intron and two exons. The sequence alignments revealed Rc CHI shared47. 1%-71. 6% identity with the homologues in other plants. Real-time PCR analysis showed that the total flavonoid levels were positively correlated with tissue-specific expressions of Rc CHI mRNA in different tissues. The recombinant protein was successfully expressed in an Escherichia coli strain with the p GEX-6 P-1 vector. In this paper,the CHI gene was cloned and characterized in the family of Anacardiaceae and will help us to obtain better knowledge of the flavonoids biosynthesis of the flavonoid compounds in R. chinensis.


Subject(s)
Flavonoids/biosynthesis , Intramolecular Lyases/genetics , Rhus/enzymology , Cloning, Molecular , DNA, Complementary , Plants, Medicinal/enzymology , Plants, Medicinal/genetics , Rhus/genetics
10.
Acta Pharmacol Sin ; 40(12): 1532-1543, 2019 Dec.
Article in English | MEDLINE | ID: mdl-31165783

ABSTRACT

Obesity induces accumulation of adipose tissue macrophages (ATMs) and ATM-driven inflammatory responses that promote the development of glucose and lipid metabolism disorders. ClC-3 chloride channel/antiporter, encoded by the Clcn3, is critical for some basic cellular functions. Our previous work has shown significant alleviation of type 2 diabetes in Clcn3 knockout (Clcn3-/-) mice. In the present study we investigated the role of Clcn3 in high-fat diet (HFD)-induced obesity and ATM inflammation. To establish the mouse obesity model, both Clcn3-/- mice and wild-type mice were fed a HFD for 4 or 16 weeks. The metabolic parameters were assessed and the abdominal total adipose tissue was scanned using computed tomography. Their epididymal fat pad tissue and adipose tissue stromal vascular fraction (SVF) cells were isolated for analyses. We found that the HFD-fed Clcn3-/- mice displayed a significant decrease in obesity-induced body weight gain and abdominal visceral fat accumulation as well as an improvement of glucose and lipid metabolism as compared with HFD-fed wild-type mice. Furthermore, the Clcn3 deficiency significantly attenuated HFD-induced ATM accumulation, HFD-increased F4/80+ CD11c+ CD206- SVF cells as well as HFD-activated TLR-4/NF-κB signaling in epididymal fat tissue. In cultured human THP-1 macrophages, adenovirus-mediated transfer of Clcn3 specific shRNA inhibited, whereas adenovirus-mediated cDNA overexpression of Clcn3 enhanced lipopolysaccharide-induced activation of NF-κB and TLR-4. These results demonstrate a novel role for Clcn3 in HFD-induced obesity and ATM inflammation.


Subject(s)
Adipose Tissue, White/metabolism , Chloride Channels/genetics , Inflammation/metabolism , Macrophages/metabolism , Obesity/metabolism , Adipose Tissue, White/pathology , Animals , Cell Line , Diet, High-Fat , Humans , Mice, Knockout , NF-kappa B/metabolism , Obesity/genetics , Toll-Like Receptor 4/metabolism
11.
Mitochondrial DNA B Resour ; 4(2): 2363-2364, 2019 Jul 12.
Article in English | MEDLINE | ID: mdl-33365545

ABSTRACT

We sequenced the complete mitochondrial genome of the Chinese Rhus gall aphid Meitanaphis microgallis (Hemiptera: Aphididae: Eriosomatinae: Fordini) by the genome skimming method on an Illunima platform. The assembled mitogenome is 16,191 bp in length with a very high A + T content of 84.3%. This genome consists of 13 protein-coding genes, 22 tRNAs, 2 rRNAs, and a control region. All the protein-coding genes have a typical ATN initiation codon and TAA termination codon except COX1 and ND4 with a single T as stop codon. The tRNAs ranged in size from 59 to 77 bp and formed a clover-leaf secondary structure except tRNA-Ser (AGN). We constructed the phylogenetic relationship of Fordini aphids including all the Rhus gall aphids, and the ML tree showed that M. microgallis grouped with M. elongallis as its sister group.

12.
Mitochondrial DNA B Resour ; 4(2): 2469-2470, 2019 Jul 13.
Article in English | MEDLINE | ID: mdl-33365586

ABSTRACT

We sequenced the complete mitochondrial genome (mitogenome) of Siberian Roe Deer, Capreolus pygargus, in China by the shotgun genome-skimming methods. The mitogenome of C. pygargus is totally 16,353 bp in length and contains 13 protein-coding genes (PCGs), 22 tRNA genes, two rRNA genes, and a control region. The sequence has a higher A + T content of 63.4% than G + C 36.6% and with a base composition of 33.4% A, 23.2% C, 13.4% G, and 30.0% T. All of the 13 PCGs initiate a typical ATN codon except Nd4L with GTG. Six PCGs terminate with a TAA codon, while Cyt b, Atp8, and Nd1 terminate with AGA, TAG, and TA-, respectively. Whereas, Cox3, Nd2, Nd3, and Nd4 terminate with a single T-. The phylogenetic trees of the subfamily Capreolinae with 13 PCGs indicated that Capreolus species were well-supported as a monophyletic group, which is sister to the clade of Hydropotes with well-support.

13.
Mitochondrial DNA B Resour ; 4(2): 2509-2510, 2019 Jul 13.
Article in English | MEDLINE | ID: mdl-33365603

ABSTRACT

The complete mitochondrial genome (mitogenome) of black stork Ciconia nigra from North China was sequenced by shotgun genome-skimming method. The mitogenome of C. nigra was 17,787 bp in length and consists of 13 protein-coding genes, 22 tRNAs, two rRNAs, and one non-coding control region (D-loop). All protein-coding genes initiate with ATG codon except for ND2, ND3, and COX1, which uses ATA, ATC, and GTG as their initiation codons, respectively. The termination codon of protein-coding genes shows rich diversity with six termination codons (TAA, AGG, AGA, TAG, T, and A). The phylogenetic trees based on 13 protein-coding genes showed that Ciconia formed a monophyletic group, which was sister to the clade clustered by Threskiorothidae species.

14.
Mitochondrial DNA B Resour ; 4(2): 3072-3074, 2019 Sep 19.
Article in English | MEDLINE | ID: mdl-33365861

ABSTRACT

The complete mitochondrial genome (mitogenome) of the leopard cat Prionailurus bengalensis in China was sequenced using the shotgun genome-skimming method. The mitogenome of P. bengalensis is totally 17,006 bp in length with a higher A + T content of 60.4% than that of G + C and consists of 13 protein-coding genes (PCGs), two rRNAs, 22 tRNAs, and one non-coding control region. All the PCGs initiate with a typical ATN codon and terminate with a TAA codon except for the four PCGs (COX1, ND2, ND3, and ND4) terminating with a single T-and one gene CYT B with AGA as stop codon. Most of the tRNA genes have a clover-leaf secondary structure except for tRNAS (AGN), which loses a dihydrouridine (DHU) arm. The ML phylogenetic tree showed that P. viverrinus nested in the group of P. bengalensis individuals, which is close to the clade clustered by the two genera Otocolobus and Felis.

15.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-691104

ABSTRACT

<p><b>OBJECTIVE</b>To explore therapeutic effect of absorbable net-sliding intertexture with tension band wiring in treating comminuted fracture of distal patella pole.</p><p><b>METHODS</b>From January 2012 to December 2016, 80 patients with comminuted fracture of distal patella pole were treated with absorbable net-sliding intertexture with tension band wiring, including 45 males and 35 females aged from 25 to 60 years old with an average of(45.0±2.0) years old. All fractures were freshly closed. VAS scores and motion of knee joint were evaluated at 6 weeks after operation, HSS scores were used to assess clinical effects at 12 months after operation.</p><p><b>RESULTS</b>Operative time was (50.2±10.1) min, blood loss was (20.3±5.2 ) ml. All patients were followed up from 12 to 24 months with an average of (16.0±0.5) months. VAS score was 1.8±0.4, range motion of knee joint was (120.6±1.5)° at 6 weeks after operation. The fracture healing time was (3.0±0.8) months. Postoperative HSS score at 12 months was 95.6±0.6.</p><p><b>CONCLUSIONS</b>Absorbable net-sliding intertexture with tension band wiring in treating comminuted fracture of distal patella pole has advantages of simple operation, stable fixation, which could recover anatomical formation of patella, obtain rapid rehabilitation and favorable prognosis with early exercise. It is an ideal method for treating comminuted fracture of distal patella pole.</p>

16.
Basic & Clinical Medicine ; (12): 480-484, 2018.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-693926

ABSTRACT

Objective To observe the protective effect of hydroxysafflor yellow A(HSYA) on anoxia/reoxygenation (A/R) injury of neonatal primary cardiomyocytes, and its relationship with phosphoinositide 3-kinase/protein ki-nase B/glycogen synthase kinase 3β(PI3K/Akt/GSK3β) signaling pathway. Methods Primary cardiomyocytes of neonatal rats were isolated from the rats and incubated for 48 hours. The cells were adhered to each other and then divided into five groups:control group (Con group), anoxia/reoxygenation group (A/R group),HSYA treatment group(A/R+H group),PI3K inhibitor (LY294002)treatment group(A/R+L group)and HSYA+LY294002 treat-ment group (A/R+H+L group),then to collect the supernatant fluid of each group to measure LDH.The flow cy-tometry was used to measure the apoptotic cells. The protein levels of Bcl-2,Bax,Akt,p-Akt (Ser473),GSK3β, p-GSK3β (Ser9) were evalated by Western blot. Results A/R increased LDH release,the apoptosis rate (P<0.001),and the expression of pro-apoptotic protein Bax (P <0.001) with the decrease of anti-apoptotic protein Bcl-2,p-Akt(Ser473), p-GSK3β(Ser9)(P<0.001) as compared with the control group. HSYA treatment de-creased LDH release,the apoptosis rate (P<0.001),and the expression of Bax (P<0.001) and increase the ex-pression of Bcl-2,p-Akt(Ser473),p-GSK3β(Ser9)(P<0.001). Compared with the A/R+H group,the expres-sion of Bax was increased (P<0.001),while the expression of Bcl-2, p-Akt(Ser473), p-GSK3β(Ser9)was de-creased (P<0.001) in the A/R+H+L group. Conclusions HSYA protects rats'cardiomyocytes from anoxia/reoxy-genation injury by regulating PI3K/Akt/GSK3β signaling pathway.

17.
Basic & Clinical Medicine ; (12): 47-50, 2018.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-664890

ABSTRACT

Objective To study the role of surfactant protein C ( SP-C) in rat lung of chronic obstructive pulmonary disease (COPD).Methods Forty healthy conventional Sprague-Dawley (SD) rats were randomly divided into four groups , normal control group ( control group ) , smoke exposure group ( smoking group ) , lipopolysaccharide group (LPS group), smoke exposure +Lipopolysaccharide group (COPD group).The arterial partial pressure oxygen (PaO2) and arterial partial pressure of carbon dioxide pathological (PaCO2) were detected.The ultrastructure of lung tissue was observed by transmission electron microscope .Enzyme-linked immuno sorbent assay (ELISA) were performed to determine protein expression of SP-C in lung and bronchoalveolar lavage fluid ( BALF).RT-qPCR were performed to determine mRNA expression of SP-C in lung.Results Compared with control group , smoking group and LPS group, the PaO2 of COPD group was obviously lower , the PaCO2 of COPD group was obviously higher;the ultrastructure and histological analysis of lung tissues showed chronic inflammatory injury ; Compared with control group , the expression of SP-C protein in was reduced , as well as SP-C mRNA expression .Conclusions The expression of SP-C in lung of rats COPD model is down-regulated.SP-C may be involved in COPD .

18.
Mitochondrial DNA B Resour ; 2(1): 169-170, 2017 Mar 23.
Article in English | MEDLINE | ID: mdl-33473755

ABSTRACT

We sequenced the complete mitochondrial genome (mitogenome) for the North American Rhus gall aphid species Melaphis rhois. The mitogenome is 15,436 bp in length with a high A + T content of 82.7%, consisting of 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and a control region. Its gene order is identical to that of the eastern Asian species Schlechtendalia chinensis. All protein-coding genes start with a typical ATN codon and terminate with a TAA codon except COI and ND4 by a single T residue. All the tRNAs except tRNACys formed a clover-leaf secondary structure. The mitogenome phylogeny of Aphididae suggests that M. rhois is most closely related to the eastern Asian Rhus gall aphid S. chinensis with the present sampling scheme.

19.
Chinese Journal of Trauma ; (12): 208-212, 2017.
Article in Chinese | WPRIM (Western Pacific) | ID: wpr-510061

ABSTRACT

Objective To observe the outcomes of one-stage posterior short-level pedicle screw fixation combined with anterior fixation of severe thoracolumbar fractures.Methods A retrospective case series study was performed on 21 patients with severe thoracolumbar fractures stabilized by posterior short-level pedicle fixation combined with anterior internal fixation at one stage from January 2012 to December 2014.There were 16 males and 5 females,at age of 17 and 64 years [(38.7 ± 11.4) years].The involved segments included T11 in 2 patients,T12 in 5,Lt in 6 and L2 in 8.For AO fracture classification,type A fractures were seen in 4 patients,type B in 7 and type C in 10.Thoracolumbar injury classification and severity score (TLICS) was (8.12 ± 0.87) points (range,7-10 points).Frankel neurological performance scale was Grade B in 8 patients,Grade C in 11 and Grade D in 2.Operation time,blood loss,nerve function,kyphosis correction and complications were reported.Results Operation time was (234.5 ±57.3)min (range,180-360 min),and blood loss was (387.4 ± 124.4) ml (range,260-950 ml).Time of follow-up was (19.8 ± 3.5)months (range,14-25 months).Nerve function of 18 patients was improved by at least one Frankel scale.Cobb angle was (4.1 ±5.3)° at postoperative 3 days and (4.0 ± 4.9)°at the final follow-up,showing significant differences from that before operation [(-9.3 ± 4.2) °] (P < 0.05).While the difference of Cobb angle did not differ significantly at postoperative 3 days and at final follow-up.No cerebrospinal fluid leakage,vascular injury,incision infection or nerve function deterioration occurred.Conclusion One-stage posterior short-level pediele screw fixation combined with anterior decompression and bone graft fixation is characterized by short operation time,few blood loss,good correction of traumatic kyphosis and good neurological recovery,indicating a good surgical choice for severe thoracolumbar fractures.

20.
World J Surg ; 40(3): 570-3, 2016 Mar.
Article in English | MEDLINE | ID: mdl-26711636

ABSTRACT

OBJECTIVE: To analyze the clinical characteristics of familial nonmedullary thyroid carcinoma (FNMTC), in order to provide evidence for early diagnosis and treatment. METHODS: We retrospectively investigated the inpatients between September 2006 and September 2013 in the First Bethune Hospital of Jilin University, in which 78 patients with FNMTC from 31 families were analyzed by a comparison with 3445 control cases from the patients with sporadic nonmedullary thyroid carcinoma (SNMTC). RESULTS: There was no significant difference in gender, age, and tumor size between FNMTC and SNMTC patients. However, the characteristics of disease in multifoci, neck lymph node metastasis, invasion to the surrounding tissues, and coexistence with Hashimoto disease in two types of cancer patients show significant difference. They are: multifoci: 71.8% (56/78) in FNMTC versus 46.3% (1595/3445) in SNMTC; neck lymph node metastasis: 52.6% (41/78) in FNMTC versus 33.3% (1148/3445) in SNMTC; surrounding tissue invasion: 64.1% (50/78) in FNMTC versus 48.5% (1670/3445) in SNMTC; coexistence with Hashimoto disease: 30.8% (24/78) in FNMTC versus 20.0% (689/3445) in SNMTC. CONCLUSION: Lymph node metastasis, multifoci, invasion to the surrounding tissues, and combination with chronic lymphocytic thyroiditis are the main features of FNMTC, which suggests the extent of the operation for FNMTC patients should be amplified properly.


Subject(s)
Carcinoma/diagnosis , Early Diagnosis , Thyroid Neoplasms/diagnosis , Adolescent , Adult , Aged , Aged, 80 and over , Carcinoma/therapy , Carcinoma, Papillary , Child , Combined Modality Therapy , Diagnosis, Differential , Female , Humans , Male , Middle Aged , Retrospective Studies , Thyroid Cancer, Papillary , Thyroid Neoplasms/therapy , Young Adult
SELECTION OF CITATIONS
SEARCH DETAIL