First report of nectarine virus M in grapefruit (Citrus × paradisi Macfad.) in association with citrus chlorotic blotch disease in Texas, USA.

During November 2019, four leaf samples (TX1-TX4) with citrus leprosis-like symptoms in 'Rio Red' grapefruit trees were collected from La Feria, Cameron County, Texas, USA and sent to USDA-Animal and Plant Health Inspection Service - Plant Protection Quarantine, Plant Pathogen Confirmatory Laboratory at Laurel, Maryland for pathogen identification and confirmatory testing. Ribo-depleted libraries for all four samples were prepared for high-throughput sequencing (HTS) analysis, using the RNA extracts of individual grapefruit samples. HTS yielded 13.6 to 22.8 million 75 bp paired-end raw reads per sample library but failed to identify any potential virus-like agent at the time. Recent advances in bioinformatic tools (Roy et al., 2024) prompted a revisit of the archived HTS data and several virus contigs were identified. The assembled contigs covered approximately 82% of the nectarine marafivirus M (NeVM) genome (GenBank accession KT273413) with read depths of 4.72 to 9.96 per-nt. In addition, a few Caulimoviridae and Retroviridae contigs were also identified in the libraries. NeVM was previously discovered from budwoods of nectarine trees from California using HTS and shown to infect peach (Villamor et al., 2016), but no other biological or serological data were reported. Foliar chlorotic blotch symptoms, reminiscent of the 2019 findings, were observed in adjacent Rio Red grapefruit blocks during September 2023. To know the association of chlorotic blotch symptoms with NeVM, 12 symptomatic and 4 non-symptomatic grapefruit samples were collected for testing (Supplementary Figure 1). A conventional RT-PCR primer pair, Marafi Gen-1F (5´AACATGAAGAACGGSTTCGACG 3´)/NeVM-1R (5´TTCATGGTGTGCATGGCRTTYTG 3´), was designed using HTS-derived NeVM contigs and utilized for the development of a detection assay. The results of the 671 bp amplicon sequencing showed that 13 (12+1) of the 16 grapefruit plants (81.25%) were positive for NeVM and shared 87.63-92.25% nt identities with the nectarine isolates of NeVM (KT273411-13) and 78% with the Canadian prunus isolate 13TF170 (MZ291915). To confirm the first report of NeVM in grapefruit trees, the archived 2019 (TX4) and 2023 leaf tissue samples (LF1 and LF2) from La Feria, TX were selected for genetic analysis. The primer pair Marafi Gen-1F/NeVM-1R targeting the helicase domain of NeVM, successfully amplified the expected 671 bp product. The amplicon sequence of isolate TX4 shared 97.76% and 89.87% nt identities with isolates LF1 and LF2, respectively, while LF1 shared 90.76% nt identity with LF2. Sequence variation was observed for a 1906 bp overlapping amplicon obtained with the primer pairs NeVM-2F (5´CTGTTCGCCGAATGCATCAAYCT 3´)/Marafi Gen-1R (5´AGTAGTACCCGCAGAAGGTGG3´) and Marafi Gen-2F (5´CCACCTTCTGCGGGTACTACT3´)/Marafi Gen-2R (5´CTGGAGGTGTTTTCCTTCACCTG3´), spanning the catalytic domain and tymovirus coat protein region of NeVM. The analysis showed that the 1906 bp amplicon sequence of TX4 shared 94 and 95% nt identities with LF2 and LF1, respectively, but only 91% nt identity between them. Overall, the 1906 bp amplicon of all 3 Texas grapefruit isolates shared 91.08 to 92.29% nt identity with American prunus isolates (KT273411-13) and 75% nt identity with Canadian isolate (MZ291915). Three sequences of 671 bp and 1906 bp amplicons were deposited in GenBank under accession numbers PP767656-61. From the regulatory point of view, NeVM fails to satisfy the criteria to be considered as potential quarantine pests for the European Union because of the absence of information on its biology, distribution, and economic impact (Bragard et al., 2019). However, this report expands the natural host range of NeVM to include grapefruit. From an epidemiological standpoint, more data on host range, varietal susceptibility, and genetic variability among citrus and prunus isolates are needed to conclude the association of NeVM infection with symptoms development.

Exploring drivers of unsafe disposal of child stool in India using hierarchical regression model.

BACKGROUND: Disposal of children's stools is often neglected in Indian sanitation programs, putting them at higher risk of diseases transmitted through the fecal-oral route. Therefore, the current study aims to identify the socioeconomic and demographic factors associated with the unsafe disposal of child stool in India and to estimate the geographical variation in unsafe disposal. METHODS: The study used 78,074 births under two years from the fifth round of the National Family Health Survey (2019-21). Descriptive statistics, bivariate analysis with the chi-square test, and a four-level hierarchical logistic regression model were applied to accomplish the study objectives. RESULTS: Findings revealed a 61.3% prevalence of unsafe stool disposal nationwide, significantly varying between rural (45%) and urban (67%) areas. Multilevel logistic regression highlighted that mother's education, wealth quintile, and sanitation facility were significant predictors of unsafe disposal of child stools. Random intercept statistics revealed a substantial geographical unit-level variance in unsafe stool practice in India. CONCLUSION: The study emphasizes the widespread unsafe disposal of child stool among Indian mothers with young children below two years, and the study underscores a range of contributing factors, including education, media exposure, prosperity, water availability, and sanitation. It also accentuates the significance of the geographical variance in the unsafe disposal of child stool in India, particularly at the household level, followed by the community level. Hence, the findings underscore the importance of focused interventions, including targeted household-level poverty alleviation programs, initiatives to enhance sanitation and water facilities, and community-level public health awareness programs.

Decomposing rural-urban gap in unsafe disposal practice of child stool in India using nationwide sample survey data.

A significant rural-urban disparity in unsafe child stool disposal practices exists in India, yet existing research falls short in identifying the contributing factors to this gap. This study addresses the research gap by contextualizing the rural-urban divide in unsafe child stool disposal using data from the fifth round of the National Family Health Survey (NFHS-5, 2019-21). In particular, the study examines the prevalence and predictors of unsafe disposal practices, exploring associated contributing factors to this gap. The study involves a sample of 78,074 women aged 15-49 with a living child under 2 years, without any missing data related to the study interest. Employing descriptive statistics, the Pearson chi-square test, multilevel logistic regression, and the Fairlie decomposition model, the research aims to fulfill its objectives. The rural-urban gap in unsafe child stool disposal practices among the study participants was 22.3 percentage points (pp), with a more pronounced gap among the Scheduled Tribes (ST). Notably, the gap was particularly wide in Madhya Pradesh (33.9 pp), Telangana (27.5 pp), Gujarat (26.1 pp), and Rajasthan (25.8 pp). Predictors such as mother's education, mass media exposure, household wealth quintile, and sanitation facilities proved significant irrespective of residence. However, religion, social group, and water facility on household premises emerged as significant factors in rural areas only. The study identified that 67% of the explained gap in unsafe child stool disposal practices was attributed to the rural-urban difference in household wealth. Other noteworthy contributors were 'household sanitation facility' (21.3%), 'mother's education level' (3.9%), and 'water facility on household premises' (3.9%). These findings underscore the need for population and area-specific policy interventions, especially for individuals from socio-economically disadvantaged backgrounds, those with lower education levels, and limited exposure to mass media, particularly in states with a high prevalence of unsafe disposal practices. Such interventions are crucial to mitigating the existing rural-urban gap in unsafe child stool disposal practices.

A population based study on human papillomavirus infection and associated risk factors among women of the remote South Andaman Island, India.

BACKGROUND: Human papillomavirus (HPV) is associated with cervical cancer and cervical dysplasia worldwide. Data on HPV prevalence in a region is important because it serves as a predictor of the likelihood of the population in that particular region acquiring cervical cancer. Moreover, with the availability of effective vaccines, the public health system must be aware of the preponderance of HPV to implement the vaccine. The present study was designed to understand the prevalence of HPV and associated factors among the women of South Andaman Island. METHODS: A cross-sectional study was conducted among married women of reproductive age (18-59 years) from South Andaman District from 2018 to 2022. Cervical scrapes were collected from participants after obtaining informed written consent for HPV molecular testing (HPV DNA) such as PCR assay. Demographic data was collected using a standard questionnaire and statistical analyses were performed to determine the associated factors. RESULTS: The study showed prevalence of HPV as 5.9%(95% CI: 3.9-7.9) and prevalence of HR-HPV16 was 4.1% (95% CI 2.6 - 5.5) and HR-HPV18 prevalence was 1.8(95% CI: 0.6-3). The independent factors associated the HPV positivity were age above 55 years, menopause, post-menopausal bleeding, blood-stained vaginal discharge and loss of weight. Age was associated with all HPV infections among the South Andaman women. CONCLUSIONS: HPV 16 was reported as the predominant high risk HPV type circulating among women of South Andaman. Cervical cancer and precancerous lesions were significantly associated with HPV positivity and High risk HPV 16. Based on the knowledge of the risk factors associated with HPV, implementation of stronger public health awareness and prophylactic HPV vaccination is crucial among the women of this remote island.

Meta-Transcriptomic Analysis Uncovers the Presence of Four Novel Viruses and Multiple Known Virus Genera in a Single Hibiscus rosa-sinensis Plant in Colombia.

Hibiscus is not native to Colombia but well suited to its arid soil and dry climates. A single hibiscus plant from Risaralda, showing black spots on upper and lower sides of its leaves, was collected for virome analysis using meta-transcriptomic high-throughput sequencing technology. Bioinformatic analysis identified 12.5% of the total reads in the Ribo-Zero cDNA library which mapped to viral genomes. BLAST searches revealed the presence of carlavirus, potexvirus, and of known members of the genera Betacarmovirus, Cilevirus, Nepovirus, and Tobamovirus in the sample; confirmed by RT-PCR with virus-specific primers followed by amplicon sequencing. Furthermore, in silico analysis suggested the possibility of a novel soymovirus, and a new hibiscus strain of citrus leprosis virus C2 in the mixed infection. Both RNA dependent RNA polymerase and coat protein gene sequences of the potex and carla viruses shared less than 72% nucleotide and 80% amino acid identities with any alphaflexi- and betaflexi-virus sequences available in GenBank, identifying three novel carlavirus and one potexvirus species in the Hibiscus rosa-sinensis plant. The detection of physalis vein necrosis nepovirus and passion fruit green spot cilevirus in hibiscus are also new reports from Colombia. Overall, the meta-transcriptome analysis identified the complex virome associated with the black spot symptoms on hibiscus leaves and demonstrated the diversity of virus genera tolerated in the mixed infection of a single H. rosa-sinensis plant.

Factors associated with public and private healthcare utilization for outpatient care among older adults in India: A Wagstaff's decomposition of Anderson's behavioural model.

In India, an expanding ageing population will become a public health alarm, putting additional pressure on the healthcare system. Therefore, the current study aimed to examine the factors associated with outpatient healthcare choices among older Indian adults. We used data from the first wave of the Longitudinal Ageing Study in India (LASI, 2017-2018). A total of 34,588 individuals (age 45 years and over) who accessed outpatient healthcare services in the last 12 months during the survey were included in this research. A bivariate chi-square test was used to present the percentage distribution of types of outpatient healthcare utilisation by background characteristics. Multinomial logistic regression and Wagstaff's decomposition analyses were employed to explore the interplay of outpatient healthcare utilisation and allied predisposing, enabling, and need factors and examine these factors' contributions to the wealth-based inequalities in public, private, and other healthcare utilisation. Outpatient healthcare utilisation varied significantly according to socioeconomic and demographic factors. The findings suggest that consumption quintiles, place of residence, education, and health insurance were significant determinants of private and public healthcare utilisation and contributed to wealth-based inequalities in healthcare choices. The current study emphasises the need to strengthen and promote public healthcare services.

Revisiting the predisposing, enabling, and need factors of unsafe abortion in India using the Heckman Probit model.

Unsafe abortion refers to induced abortions performed without trained medical assistance. While previous studies have investigated predictors of unsafe abortion in India, none have addressed these factors with accounting sample selection bias. This study aims to evaluate the contributors to unsafe abortion in India by using the latest National Family Health Survey data conducted during 2019-2021, incorporating the adjustment of sample selection bias. The study included women aged 15 to 49 who had terminated their most recent pregnancy within five years prior to the survey (total weighted sample (N) = 4,810). Descriptive and bivariate statistics and the Heckman Probit model were employed. The prevalence of unsafe abortion in India was 31%. Key predictors of unsafe abortion included women's age, the gender composition of their living children, gestation stage, family planning status, and geographical region. Unsafe abortions were typically performed in the early stages of gestation, often involving self-administered medication. The primary reasons cited were unintended pregnancies and health complications. This study underscores the urgent need for targeted interventions that take into account regional, demographic, and social dynamics influencing abortion practices in India.

Genetic Analysis of the Emerging Citrus Yellow Vein Clearing Virus Reveals a Divergent Virus Population in American Isolates.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

First report of Hibiscus soymovirus in Hibiscus rosa-sinensis in Colombia in mixed infection.

Hibiscus is native to southeast Asia but well suited to Colombia's arid soil and dry climates from the coast to the mountains of Bogotá. Viruses infecting hibiscus in Colombia are largely unexplored, with four viruses previously known: hibiscus chlorotic ringspot virus (HCRSV), hibiscus latent Fort Pierce virus (HLFPV), hibiscus latent Singapore virus (HLSV), and citrus leprosis virus C2 (CiLV-C2) (Padmanabhan et al., 2023). Mixed infections between these viruses were frequently detected. A recent virome analysis of a single hibiscus plant from Colombia revealed multiple viruses in mixed infection; : HCRSV, HLFPV, passion fruit green spot virus (PFGSV), a strain of physalis vein necrosis nepovirus, four novel carlavirus, one new potexvirus and a mitovirus. In addition, few smaller contigs of blunervirus and soymovirus were also identified in the high throughput sequencing (HTS) data, but their presence in the mixed infection could not be validated (A. Roy et al. 2023unpublish data). During Brevipalpus-transmitted virus (BTV) surveys, two asymptomatic and 15 hibiscus foliar samples showing green ringspots with central chlorotic spots in senescing areas, mosaic, and black or chlorotic spots were collected from six departments (states) in three geographical regions of Colombia: Tolima (n=4) and Cauca Valley (n=2) (Andean region), Meta (n=6) and Casanare (n=1) (Orinoquia region), and Quindío (n=1) and Risaralda (n=1) (coffee growing region). About 100 mg of 17 hibiscus leaf samples were separately processed for RNA isolation without DNase I treatment and tested for known BTVs, and for newly discovered hibiscus soymovirus (HSV; genus Soymovirus family Caulimoviridae) using PCR assays (Padmanabhan et al. 2023, Wang et al. 2023). To identify potential HSV infection in the samples, published SVF1/SVR1 and newly designed primer pairs (HSV-REP-F/-R and HSV-CPG-F/-R) were used to amplify the 430 nt transactivation (ORF-VI), 631 nt replicase (REP) and 401 nt coat protein gene (CPG), respectively (Supplementary 1). Of 17 samples tested, three from Tolima and one each from Meta and Quindío yielded all three expected size amplicons. Bi-directional sequencing followed by BLASTn analysis revealed 95-98% nt identity with the CPG, REP, and ORF-VI genes of HSV (OP757659). Ribo-depleted libraries were prepared using the RNA extracts of five HSV PCR positive samples. HTS yielded 11.6 to 50.3 million raw reads per sample library. Adapters were trimmed and filtered from the raw reads with Trimmomatic v0.39 and then assembled using SPAdes v3.15.5 (Padmanabhan et al., 2023). Contigs were blasted against the Arabidopsis proteome and a RefSeq-based viral protein database. Potential viral sequences were then blasted against the complete NCBI nr database. Assembled soymo contigs covered 99-100% of the HSV genome, with per-nucleotide read depths of 23.8 to 393. Contigs from the Tolima (Accessions; OR621030- OR621032 and Quindío samples (OR621033) covered 99-100% of the HSV genome and had >96-98% nt identity to Hawaiian isolate (OP757659) whereas the Meta sample contigs covered 78% of the genome with 9495% nt identity. HTS contigs shared >98-99% nt identities with their PCR amplicons. Along with HSV, other virus sequences (HCRSV, HLFPV, PFGSV, CiLV-C2, and mycoviruses) were variously detected from all five libraries. Due to mixed infection no symptom similarity was noticed among these 5 samples. The findings in hibiscus in Tolima, Meta and Quindío represent the first confirmed report of HSV infection in hibiscus in Colombia. The widespread distribution suggests the possibility of HSV dispersion via movement of planting material, and potential further spread to another hibiscus growing region.

Re-examining the Nexus Between Maternal Smoking Behavior and Under-Five Children's ARI in India: A Comprehensive Study.

Background: The burden of acute respiratory infections (ARIs) among children under-five is a serious concern in lower and middle-income countries (LMICs), including India, where it is positively associated with indoor smoking exposures. This study re-examines the impact of maternal smoking on ARIs among children under 5 in India, considering other indoor air pollutant factors and covariates. The aim is to establish existing findings and capture any differentials in results using comprehensive analytical approaches. Methods: Data from the National Family Health Survey (NFHS-5), 2019 - 21, was used. Descriptive statistics, bivariate analysis, multivariable logistic regression models, and interaction analysis were applied to accomplish the study objective. Results: The adjusted likelihood of ARI was 1.24 (95% CI: 1.04-1.48) times higher in under-five children with smoking mothers than those with non-smoking mothers. The result was also observed to be almost similar across all seasons. Moreover, the combined effect of maternal smoking with other household members smoking and using unclean cooking fuel without a separate ventilated kitchen escalated the risk (AOR: 2.01; 95% CI: 1.98-2.67). Breastfeeding was found to be a preventive measure for reducing the risk of indoor smoking exposure. The children who were never breastfed and were born large or small were more susceptible to maternal smoking. Conclusion: The study highlights the association between maternal smoking and ARIs in Indian under-five children. Interventions include reducing maternal smoking, promoting breastfeeding, and improving respiratory health in fuel-exposed households.

Iterative Synthesis of Oligosilanes Using Methoxyphenyl- or Hydrogen-Substituted Silylboronates as Building Blocks: A General Synthetic Method for Complex Oligosilanes.

Organosilanes have attracted the attention of researchers for more than 150 years due to their unique properties, and they have become indispensable industrial assets. However, many synthesized oligosilanes with multiple Si-Si bonds are relatively simple, i.e., they often only contain a single repeating unit. More laborious customized synthetic routes can lead to more complex oligosilanes, but compared to carbon-based molecules, their structural diversity remains limited. The development of effective and practical synthetic routes to complex oligosilanes that contain mixed substituents constitutes a long-standing challenge. Here, we describe an iterative synthesis of oligosilanes using methoxyphenyl- or hydrogen-substituted silylboronates, which were obtained via transition-metal-catalyzed Si-H borylation reactions. The first key reaction is a cross-Si-Si bond-forming reaction between chloro(oligo)silanes and silylboronates activated by MeLi. The second key reaction is the selective chlorination of the methoxyphenyl group or the hydrogen atom at the terminal of the oligosilanes. Iteration of these two key reactions enables the synthesis of various oligosilanes that are otherwise difficult to access. As a demonstration of the synthetic utility of this iterative synthetic approach, oligosilanes with different sequences were prepared by simply changing the order of the reaction of four different silicon units. Furthermore, a bespoke tree-shaped oligosilane is easily obtained via the present iterative synthesis. The solid-state structures of several of these oligosilanes were unequivocally determined using single-crystal X-ray diffraction analysis.

Unveiling the spatial divide in open defecation practices across India: an application of spatial regression and Fairlie decomposition model.

OBJECTIVE: The study contextualises the spatial heterogeneity and associated drivers of open defecation (OD) in India. DESIGN: The present study involved a secondary cross-sectional survey data from the fifth round of the National Family Health Survey conducted during 2019-2021 in India. We mapped the spatial heterogeneity of OD practices using LISA clustering techniques and assessed the critical drivers of OD using multivariate regression models. Fairlie decomposition model was used to identify the factors responsible for developing OD hot spots and cold spots. SETTING AND PARTICIPANTS: The study was conducted in India and included 636 699 sampled households within 36 states and union territories covering 707 districts of India. PRIMARY AND SECONDARY OUTCOME MEASURES: The outcome measure was the prevalence of OD. RESULTS: The prevalence of OD was almost 20%, with hot spots primarily located in the north-central belts of the country. The rural-urban (26% vs 6%), illiterate-higher educated (32% vs 4%) and poor-rich (52% vs 2%) gaps in OD were very high. The odds of OD were 2.7 and 1.9 times higher in rural areas and households without water supply service on premises compared with their counterparts. The spatial error model identified households with an illiterate head (coefficient=0.50, p=0.001) as the leading spatially linked predictor of OD, followed by the poorest (coefficient=0.31, p=0.001) and the Hindu (coefficient=0.10, p=0.001). The high-high and low-low cluster inequality in OD was 38%, with household wealth quintile (67%) found to be the most significant contributing factor, followed by religion (22.8%) and level of education (6%). CONCLUSION: The practice of OD is concentrated in the north-central belt of India and is particularly among the poor, illiterate and socially backward groups. Policy measures should be taken to improve sanitation practices, particularly in high-focus districts and among vulnerable groups, by adopting multispectral and multisectoral approaches.

Contextualizing the standard maternal continuum of care in Pakistan: an application of revised recommendation of the World Health Organization.

Objective: This study utilizes recent nationally representative data to contextualize the standard maternal continuum of care (SMCoC) in Pakistan. The revised SMCoC framework encompasses at least eight antenatal care visits, skilled birth attendants during delivery, and postnatal care within 48 h of childbirth. Methods: The study used a sample of 3,887 ever-married women aged 15-49 from the latest Pakistan Demographic and Health Survey (PDHS) conducted in 2017-18. Several statistical methods were employed: descriptive statistics, bivariate, multilevel logistic regression models, and Fairlie decomposition analysis. Results: Only 12% of women had accessed full SMCoC services in Pakistan. Education and the wealth quintile emerged as pivotal factors influencing the utilization of SMCoC. The likelihood of full SMCC utilization was more likely among higher educated women (OR: 3.37; 95% CI: 2.16-5.25) and those belonging to the wealthiest household wealth quintile (OR: 4.95; 95% CI: 2.33-5.51). Media exposure, autonomy, healthcare accessibility, residence, and region were also identified as significant predictors of SMCoC utilization among women. Conclusion: In conclusion, while most women did not utilize full SMCoC services in Pakistan, the pattern is substantially varied by background characteristics. Education, wealth quintile, mass media exposure, and autonomy were significant factors, along with geographical aspects such as healthcare accessibility and region. The study underscores the need for a multifaceted approach to ensure equitable access to full SMCoC services for women in Pakistan, addressing individual, socioeconomic, and geographical factors.

Examining the predictors of healthcare facility choice for outpatient care among older adults in India using Andersen's revised healthcare utilization framework model.

BACKGROUND: In India, the demand for outpatient care is substantially higher than inpatient care among older adults. Therefore, the current study examines the level, patterns, and factors associated with outpatient care use. METHODS: The present research used data from the first wave of the Longitudinal Ageing Study in India (LASI, 2017-18). A total of 34,588 older adults (45 years and above) who accessed outpatient healthcare services in one year prior to the survey were included in this study. A bivariate chi-square test was applied to present the percentage distribution of types of outpatient healthcare utilization by background characteristics and healthcare responsiveness. Multinomial logistic regression analyses were employed to explore the interplay of outpatient healthcare utilization and allied predisposing, enabling, and need factors. RESULTS: About 63.7% of total older adults used a private facility, followed by 22.8% used a public facility, and 13.5% used other facilities. Years of schooling, household wealth status, place of residence, self-rated health, and health insurance were all found to be significant determinants of public or private facility use. In contrast, respondents' sex was found to be a significant determinant of private healthcare use only. The study finds that there was inadequate healthcare reaction to public health facilities. CONCLUSION: The current study revealed that the use of private facility for outpatient care is noticeably high in India. Older adults' educational attainments, health insurance coverage, and household level economic background were found to be significant factors in healthcare choice. The current study emphasizes the need to strengthen public healthcare services for outpatient care.

First report of Passion fruit green spot virus in yellow Passion fruit (Passiflora edulis f. flavicarpa) in Casanare, Colombia.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important species in terms of net production and local consumption. Recently two brevipalpus transmitted cileviruses, (i) passion fruit green spot virus (PfGSV) and (ii) hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) were detected in passion fruit in Brazil and Hawaii, respectively (Ramos-González et al., 2020, Olmedo-Velarde et al., 2022). CiLV-C2H infects both citrus and hibiscus in Colombia (Roy et al., 2015, 2018) but there was no report of PfGSV elsewhere apart from Brazil and Paraguay (Costa-Rodrigues et al., 2022). Apart from emerging begomovirus diseases, five major viruses are known to infect passion fruit in Colombia: soybean mosaic virus (SMV), cowpea aphid-borne mosaic virus, passion fruit yellow mosaic virus, cucumber mosaic virus, and a tentative Gulupa bacilliform badnavirus A (Cardona et al., 2022). Current findings of CiLV-C2H in passion fruit and PfGSV in hibiscus motivated us to investigate the possibilities of cilevirus infection in passion fruit in Colombia. During surveys, along with healthy yellow passion fruit leaves, five symptomatic plant samples from Meta and three from Casanare were collected before sent to the Molecular Plant Pathology Laboratory at Beltsville, MD under APHIS permit. Passion fruit samples from Meta showed leaf mottling, rugose mosaic, and leaf distortion, whereas leaf variegation, chlorotic spots, yellowing, green spots in senescent leaves and green vein banding were observed in the Casanare samples (Supp. Fig. 1). Total RNA was extracted using RNeasy Plant Mini Kit (Qiagen, USA). To know the potential cilevirus infection in these samples, three PfGSV specific (Ramos-González et al. 2020) and a CiLV-C2 generic primer pairs (Olmedo-Velarde et al. 2021) were used in the RT-PCR assays. All five passion fruit samples from Meta failed to produce either CiLV-C2 or CiLV-C2H or PfGSV amplicon whereas all three Casanare samples successfully amplified 321, 244 and 299 nts of PfGSV-RNA1 and -RNA2 amplicons using C13F/C13R, C6F/C6R and C8F/C8R primers, respectively. Bi-directional amplicon sequencing followed by BlastN analysis revealed ≥99% nt identity with the PfGSV-RNA1 (MK804173) and -RNA2 (MK804174) genome sequences. An optimized ribo-depleted library preparation protocol was utilized to prepare two cDNA libraries using the RNA extracts of a PfGSV suspected positive (Casanare) and a negative (Meta) samples (Chellappan et al., 2022). HTS libraries of Casanare and Meta samples resulted in 22.7 to 29.5 million raw reads, respectively. After adapter trimming and filtering, clean reads were mapped to the Arabidopsis thaliana reference genome and unmapped reads were de novo assembled (Chellappan et al., 2022). BlastN analysis from the assembled contigs identified 1-3 contigs corresponding to PfGSV-RNA1 and -RNA2, respectively, from Casanare sample whereas 3 contigs of SMV were identified in Meta passion fruit sample. No other virus sequence was obtained from either of the libraries. Assembled contigs covered 99.33% of the RNA1 and 94.42% of the RNA2 genome, with read depths of 64,474 and 119,549, respectively. Meta sample contigs (OP564897) covered >99% of the SMV genome, which shared >99% nt identity with the Colombian SMV isolates (KY249378, MW655827). Both RNA-1 (OP564895) and -2 (OP564896) segments of the Casanare isolate shared 99% nt identity with PfGSV isolate (MK804173-74). Our discovery identified PfGSV in Colombia, for the first-time outside Brazil and Paraguay. The findings of PfGSV in yellow passion fruit increases the potential threat and possibility of PfGSV movement via Brevipalpus sp. from passion fruit to other hosts.

Examining the rural-urban divide in predisposing, enabling, and need factors of unsafe abortion in India using Andersen's behavioral model.

BACKGROUND: The prevalence of unsafe abortions significantly varies with geography; therefore, more research is needed to understand the rural-urban differences in unsafe abortion practices in India. The present study aims to explore the rural-urban differences in predisposing, enabling, and need factors of unsafe abortion in India. METHODS: The present study used the fourth round of the National Family Health Survey (2015-16) and included the women aged 15-49 who terminated pregnancies by induced abortion during the 5 years prior to the survey (N = 9113) as the study sample. Descriptive statistics, bivariate chi-square significance test and multivariate logistic regression model were used to accomplish the study objectives. RESULTS: The findings revealed that almost one-third of pregnancies were terminated through unsafe measures with sharp rural-urban contrast. The likelihood of unsafe abortions increases with decreasing women's age and spousal level of education. Younger women in urban settings were more vulnerable to unsafe abortion practices. In rural settings, women with an uneducated spouse are more likely to have unsafe abortions (OR: 1.92). Poor households were more likely to undergo unsafe abortions, which were more common in rural settings (OR: 1.26). The unmet need for family planning was revealed to be a significant need factor for unsafe abortion, particularly in rural settings. CONCLUSION: Although abortion is legal, India's high estimated frequency of unsafe abortions reveals a serious public health issue. Due to socio-economic vulnerability, unmet family planning needs, and a lack of awareness, significant numbers of women still practice unsafe abortions in India.

Respiratory viruses among ethnic Nicobarese during COVID-19 pandemic.

BACKGROUND: Acute respiratory infections (ARIs) and severe acute respiratory illness (SARI) are public health burdens globally. The percentage of non-SARS CoV-2 respiratory viruses among patients having ARI and SARI who visit Car Nicobar's hospital settings is undocumented. Changes in the epidemiology of other respiratory viruses during COVID19 pandemic is being reported worldwide. METHODS: Inpatient and outpatient settings at BJR hospital, Car Nicobar Island, India, were used to conduct prospective monitoring for ARI and SARI among Nicobarese tribal members. The patients with ARI and SARI were enlisted in BJR hospital from June 2019 to May 2021. At the ICMR-NIV in Pune, duplex RT-PCR assays were used to test the presence of respiratory viruses. The prevalence of non- SARS CoV-2 respiratory viruses was measured by comparing here between pandemic and pre-pandemic periods. RESULTS: During the COVID19 pandemic, Influenza A (H3N2) and rhinovirus were predominantly reported non-SARS CoV-2 respiratory viruses while Human metapneumovirusand influenza A (H1N1)pdm09were most commonly reported in the prepandemic period. This result indicates the altered circulation of non-SARS CoV-2 during pandemic. CONCLUSIONS: A considerable proportion of respiratory infection was correlated with respiratory viruses. Prevalence of non-SARS CoV-2 respiratory viruses was high at the time of infection when compared with pre-pandemic period, at Car Nicobar Island. This study enlightened the change in circulation of other respiratory viruses among the indigenous Nicobarese tribes. Clinicians and allied medical staff should be more prudent of these respiratory infections.

Perceived academic satisfaction level, psychological stress and academic risk among Indian students amidst COVID-19 pandemic.

Background: The Covid-19 pandemic has a significant impact on education and mental health outcomes. This study attempts to analyze the factors associated with academic satisfaction level, psychological stress/anxiety, and future academic risk among Indian students of higher education in the wake of the Covid-19 pandemic. Methods: An online survey was conducted through a structured questionnaire among students of higher education. Multivariate ordered logistic regression models were performed to find out the predictors of perceived academic satisfaction level, psychological stress, and academic risk among the participants. Results: Among the 630 participants, the majority of the students (73%) had low to moderate levels of academic satisfaction. Over two-thirds of participants (68%) had a high level of stress and nearly two-fifths (38%) of the participants felt very high risk in their academic career. The multivariate logistic regression models show that the likelihood of psychological stress and academic risk was significantly higher among students aged above 25 years, researchers, and those who belong to broken families. Besides, the higher probability of satisfaction level is associated with female students, undergraduates, belonging to economically well-off families, and rural residents. Conclusion: Our study suggests that the Covid-19 pandemic leads to a range of psychological health problems. Therefore, increase students' satisfaction with online classes and it is essential to preserve the mental health of individuals and to develop psychological interventions that can improve the mental health of students during the Covid-19 pandemic.

Levels, patterns and determinants of using reversible contraceptives for limiting family planning in India: evidence from National Family Health Survey, 2015-16.

BACKGROUND: Demand for family planning is predominantly for birth limiting rather than birth spacing in India. Despite several family planning programmes in India, the use of reversible contraception for limiting family planning has been stagnant and largely depends on female sterilization. Though many researchers have examined patterns and determinants of using modern contraception for total family planning, studies on patterns and determinants of contraceptive use for birth limiting are limited in India. This paper examines the patterns of contraceptive use for liming demand and its determinants in India. METHODS: The National Family Health Survey-4, 2015-16 data was used. Bivariate chi-square significant test and multivariate binary logistic regression model used to accomplish the study objectives. RESULTS: Majority of women (86.5%) satisfied limiting demand (SLD) in India; the SLD was found significantly low among the women's age 15-19 years (53.1%) and parity 0 (42%). The satisfied limiting demand by modern reversible contraception (mrSLD) was found significantly high in age group 15-19 years (49.1%), Muslims (30.6%) and North-east region (45.4%). The satisfied limiting demand by traditional contraception (tSLD) was almost three times higher in North-east region (26.1%) than national average of India (8.7%). The women's years of schooling, wealth status, religion and presence of son child found to be significant determinants of mrSLD. The likelihood of tSLD was found significantly high among the women who had no son child (AOR = 1.41; 95% CI:1.34, 1.48), Muslim (AOR = 1.78; 95% CI:1.70, 1.87). A considerable regional variability in levels of SLD, mrSLD and tSLD was found in India. CONCLUSION: Public investment in family planning is required to promote and provide subsidized modern reversible contraception (MRC) services, especially to women from North-east region, Muslim, Scheduled tribe, poor household and who had no son child. Improving the quality and availability of MRC services in public health centre will be helpful to increase SLD among the above mentioned women. Besides, the promotion of MRC will be supportive to overcome the issues of sterilization regrets in India.

Exploring the Socioeconomic Factors Associated with Girl Child Marriage and its Impact on Pregnancy Outcomes: A Study from Malda District of West Bengal.

Background: Child marriage is not a new phenomenon in India. The prevalence of child marriage remains high in many districts of West Bengal. Objectives: The present study aims to address socioeconomic factors associated with girl child marriage and its effect on selected pregnancy outcomes among women in the Malda district of West Bengal. Methods: The study is based on primary data, collected from the Manikchak CD block by adopting a random sample survey technique. The participants in the study consisted of 357 ever married women aged 15-49 years. Results: Multivariate analysis revealed that the prevalence of child marriage was substantially higher among women who had no formal education resided in the marginalized family. Similarly, educated parents were less likely to marry their daughter at an early age. Besides, the likelihood of miscarried or stillbirth, complications during pregnancy and delivery were significantly higher among those married <18 years than those married at 18 years or later. Conclusions: The findings of this study suggest preventing child marriage by increasing opportunities for girls' education and employment. The targeted approach should be made among rural and poor girls to reduce the vulnerability of child marriage.