Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 35
Filter
Add more filters











Publication year range
1.
Nat Plants ; 10(6): 1039-1051, 2024 06.
Article in English | MEDLINE | ID: mdl-38816498

ABSTRACT

Cotton (Gossypium hirsutum L.) is the key renewable fibre crop worldwide, yet its yield and fibre quality show high variability due to genotype-specific traits and complex interactions among cultivars, management practices and environmental factors. Modern breeding practices may limit future yield gains due to a narrow founding gene pool. Precision breeding and biotechnological approaches offer potential solutions, contingent on accurate cultivar-specific data. Here we address this need by generating high-quality reference genomes for three modern cotton cultivars ('UGA230', 'UA48' and 'CSX8308') and updating the 'TM-1' cotton genetic standard reference. Despite hypothesized genetic uniformity, considerable sequence and structural variation was observed among the four genomes, which overlap with ancient and ongoing genomic introgressions from 'Pima' cotton, gene regulatory mechanisms and phenotypic trait divergence. Differentially expressed genes across fibre development correlate with fibre production, potentially contributing to the distinctive fibre quality traits observed in modern cotton cultivars. These genomes and comparative analyses provide a valuable foundation for future genetic endeavours to enhance global cotton yield and sustainability.


Subject(s)
Genome, Plant , Gossypium , Plant Breeding , Gossypium/genetics , Gossypium/growth & development , Plant Breeding/methods , Cotton Fiber , Genetic Variation , Phenotype
2.
Viruses ; 15(8)2023 07 28.
Article in English | MEDLINE | ID: mdl-37631986

ABSTRACT

Analyses of Illumina-based high-throughput sequencing data generated during characterization of the cotton leafroll dwarf virus population in Mississippi (2020-2022) consistently yielded contigs varying in size (most frequently from 4 to 7 kb) with identical nucleotide content and sharing similarities with reverse transcriptases (RTases) encoded by extant plant pararetroviruses (family Caulimoviridiae). Initial data prompted an in-depth study involving molecular and bioinformatic approaches to characterize the nature and origins of these caulimovirid-like sequences. As a result, here, we report on endogenous viral elements (EVEs) related to extant members of the family Caulimoviridae, integrated into a genome of upland cotton (Gossypium hirsutum), for which we propose the provisional name "endogenous cotton pararetroviral elements" (eCPRVE). Our investigations pinpointed a ~15 kbp-long locus on the A04 chromosome consisting of head-to-head orientated tandem copies located on positive- and negative-sense DNA strands (eCPRVE+ and eCPRVE-). Sequences of the eCPRVE+ comprised nearly complete and slightly decayed genome information, including ORFs coding for the viral movement protein (MP), coat protein (CP), RTase, and transactivator/viroplasm protein (TA). Phylogenetic analyses of major viral proteins suggest that the eCPRVE+ may have been initially derived from a genome of a cognate virus belonging to a putative new genus within the family. Unexpectedly, an identical 15 kb-long locus composed of two eCPRVE copies was also detected in a newly recognized species G. ekmanianum, shedding some light on the relatively recent evolution within the cotton family.


Subject(s)
Computational Biology , Gossypium , Phylogeny , High-Throughput Nucleotide Sequencing , Movement
3.
Plants (Basel) ; 12(5)2023 Mar 03.
Article in English | MEDLINE | ID: mdl-36904013

ABSTRACT

Cotton leaf curl virus (CLCuV) causes devastating losses to fiber production in Central Asia. Viral spread across Asia in the last decade is causing concern that the virus will spread further before resistant varieties can be bred. Current development depends on screening each generation under disease pressure in a country where the disease is endemic. We utilized quantitative trait loci (QTL) mapping in four crosses with different sources of resistance to identify single nucleotide polymorphism (SNP) markers associated with the resistance trait to allow development of varieties without the need for field screening every generation. To assist in the analysis of multiple populations, a new publicly available R/Shiny App was developed to streamline genetic mapping using SNP arrays and to also provide an easy method to convert and deposit genetic data into the CottonGen database. Results identified several QTL from each cross, indicating possible multiple modes of resistance. Multiple sources of resistance would provide several genetic routes to combat the virus as it evolves over time. Kompetitive allele specific PCR (KASP) markers were developed and validated for a subset of QTL, which can be used in further development of CLCuV-resistant cotton lines.

4.
Mol Biotechnol ; 65(1): 34-51, 2023 Jan.
Article in English | MEDLINE | ID: mdl-35778659

ABSTRACT

Cotton is an important crop that produces fiber and cottonseed oil for the textile and oil industry. However, cotton leaf curl virus disease (CLCuD) stress is limiting its yield in several Asian countries. In this study, we have sequenced Mac7 accession, a Gossypium hirsutum resistance source against several biotic stresses. By aligning with the Gossypium hirsutum (AD1) 'TM-1' genome, a total of 4.7 and 1.2 million SNPs and InDels were identified in the Mac7 genome. The gene ontology and metabolic pathway enrichment indicated SNPs and InDels role in nucleotide bindings, secondary metabolite synthesis, and plant-pathogen interaction pathways. Furthermore, the RNA-seq data in different tissues and qPCR expression profiling under CLCuD provided individual gene roles in resistant and susceptible accessions. Interestingly, the differential NLR genes demonstrated higher expression in resistant plants rather than in susceptible plants expression. The current resequencing results may provide primary data to identify DNA resistance markers which will be helpful in marker-assisted breeding for development of Mac7-derived resistance lines.


Subject(s)
Gossypium , Plant Breeding , Gossypium/genetics , Genes, Plant , Sequence Analysis, DNA , Genetic Markers , Genetic Variation
5.
Plant Dis ; 2022 Dec 22.
Article in English | MEDLINE | ID: mdl-36548916

ABSTRACT

Pothos latent virus (PoLV) is a virus with isometric virions and a positive-sense RNA genome, approximately 4.4 kb in size, currently classified in the genus Aureusvirus, family Tombusviridae (Martelli et al. 1998; Rubino et al. 1995). After its original discovery from hydroponic-grown pothos plants (Scindapsus aureus) in Italy (Sabanadzovic et al. 1995), additional PoLV isolates were reported from pigeonpea (Cajanus cajan) and lisianthus (Eustoma grandiflorum) in India and Taiwan, respectively (Chen et al. 2016; Kumar et al. 2001). PoLV has not been previously reported on the American continent. During 2019, we carried out a state-wide, RT-PCR-based survey for cotton leafroll dwarf virus (CLRDV), as previously described (Aboughanem-Sabanadzovic et al. 2019). Plants exhibiting symptoms reported associated with CLRDV (Avelar et al. 2019) were collected from cotton fields throughout Mississippi. Samples consisted of individually bagged, six inch-long, apical portions collected from five to twelve cotton plants per field. At the end of the season, the total RNAs extracted from a subset of CLRDV-infected samples using a Spectrum RNA extraction kit (Sigma, St Louis, MO), were randomly selected for additional characterization by Illumina 150 nt paired-end high-throughput sequencing at the UIUC Core Sequencing Facility (University of Illinois, Urbana, IL). De novo assembly of 46 to 60 million raw reads/sample was performed by metaSPAdes (Nurk et al. 2017). In addition to several CLRDV-specific contigs, analyses of 184,173 contigs assembled from a sample collected in Clay County (lab code CL-112) revealed a large contig # 63556 of 4298 nt in size with identities ranging from 90.5% to 94.3% with three PoLV genome sequences available in GenBank, suggesting that an isolate of this virus (PoLV-cot; GenBank OP584699) was coinfecting the sample along with CLRDV. Sequence analyses showed that contig #63556 represents approx. 97-98% of the entire PoLV-cot genome. To verify HTS data, specific primers (PoLV-F 5'ACATATATCAGAGAGAGCTCAGGTC3' and PoLV-R 5'GCTCCCATGACAGACCTCACT3') were designed on conserved sequences of all four PoLV genomes and used in a single-tube RT-PCR. The initial tests on RNAs from CL-112 and six other samples from the same field confirmed PoLV-cot infections in the original and an additional cotton plant. Sanger sequencing of the two 294 bp-long RT-PCR products revealed >99% nt mutual identity and 97.5-99% with PoLV isolates. However, none of the additional 226 cotton samples collected in 2019 across the state of Mississippi and 12 samples collected in the same field in 2020 tested positive for PoLV-cot. At this moment, it is not clear whether the PoLV infections originated from infected seeds or, more likely, from soil-borne inoculum. Indeed, several aureusviruses are known to be transmitted by soil either involving vectors belonging to the fungal genera Olpidium and/or Polymyxa (i.e., cucumber leaf spot virus, maize white line mosaic virus), or in a vectorless manner (Rochon et al. 2012). Previous studies on this virus demonstrated low-rate experimental transmission through the soil with no apparent involvement of specific vectors (Chen et al. 2016; Kumar et al. 2001; Sabanadzovic et al. 1995). In summary, results of our study indicate an original report of PoLV on the North American continent, along with description of a new host. Possible impact of PoLV-cot on the cotton industry, or any other susceptible crop in the US, is yet to be understood. Funding: This work has been partially supported by financial support from Cotton Inc, Cotton Foundation, USDA-ARS 58-6066-9-033 and 2020 MAFES-SRI grants. NAS and SS acknowledge partial support from the National Institute of Food and Agriculture, US Department of Agriculture, Hatch Projects Numbers 7001412 and1021494, respectively. The author(s) declare no conflict of interest. 1. Aboughanem-Sabanadzovic, N., et al. 2019. Plant Dis 103: 1798. 2. Avelar, S., et al. 2019. Plant Dis 103: 592. 3. Chen, Y-K., et al. 2016. J Phytopath 164: 650. 4. Kumar, P.L., et al. 2001. Plant Dis 85: 208. 5. Martelli, G.P., et al. 1998. Arch Virol 143: 1847. 6. Nurk, S., et al. 2017. Genome Res 27: 824. 7. Rochon, D., et al. 2012. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses. Amsterdam, NL, Elsevier Academic Press, pp 1111-1138. 8. Rubino, L., et al. 1995. J Gen Virol 76: 2835. 9. Sabanadzovic, S., et al.1995. Eur J Plant Pathol 101:171.

6.
Front Plant Sci ; 13: 837038, 2022.
Article in English | MEDLINE | ID: mdl-35557715

ABSTRACT

Observable qualitative traits are relatively stable across environments and are commonly used to evaluate crop genetic diversity. Recently, molecular markers have largely superseded describing phenotypes in diversity surveys. However, qualitative descriptors are useful in cataloging germplasm collections and for describing new germplasm in patents, publications, and/or the Plant Variety Protection (PVP) system. This research focused on the comparative analysis of standardized cotton traits as represented within the National Cotton Germplasm Collection (NCGC). The cotton traits are named by 'descriptors' that have non-numerical sub-categories (descriptor states) reflecting the details of how each trait manifests or is absent in the plant. We statistically assessed selected accessions from three major groups of Gossypium as defined by the NCGC curator: (1) "Stoneville accessions (SA)," containing mainly Upland cotton (Gossypium hirsutum) cultivars; (2) "Texas accessions (TEX)," containing mainly G. hirsutum landraces; and (3) Gossypium barbadense (Gb), containing cultivars or landraces of Pima cotton (Gossypium barbadense). For 33 cotton descriptors we: (a) revealed distributions of character states for each descriptor within each group; (b) analyzed bivariate associations between paired descriptors; and (c) clustered accessions based on their descriptors. The fewest significant associations between descriptors occurred in the SA dataset, likely reflecting extensive breeding for cultivar development. In contrast, the TEX and Gb datasets showed a higher number of significant associations between descriptors, likely correlating with less impact from breeding efforts. Three significant bivariate associations were identified for all three groups, bract nectaries:boll nectaries, leaf hair:stem hair, and lint color:seed fuzz color. Unsupervised clustering analysis recapitulated the species labels for about 97% of the accessions. Unexpected clustering results indicated accessions that may benefit from potential further investigation. In the future, the significant associations between standardized descriptors can be used by curators to determine whether new exotic/unusual accessions most closely resemble Upland or Pima cotton. In addition, the study shows how existing descriptors for large germplasm datasets can be useful to inform downstream goals in breeding and research, such as identifying rare individuals with specific trait combinations and targeting breakdown of remaining trait associations through breeding, thus demonstrating the utility of the analytical methods employed in categorizing germplasm diversity within the collection.

7.
Gene ; 820: 146200, 2022 Apr 30.
Article in English | MEDLINE | ID: mdl-35131368

ABSTRACT

Whitefly inflicts both direct and indirect losses to cotton crop. Whitefly resistant cotton germplasm is a high priority and considered among the best possible solutions to mitigate this issue. In this study, we evaluated cotton leaf curl disease (CLCuD) resistant cotton line Mac7 under whitefly stress. Furthermore, we utilized the already available transcriptome data of Mac7 concerning whitefly stress to elucidate associated mechanisms and identify functionally important genes in cotton. In transcriptomic data analysis, differentially expressed genes (DEGs) were found involved in complex relay pathways, activated on whitefly exposure. The response implicates signalling through resistance genes (R-genes), MAPK, ROS, VQs or RLKs, transcription factors, which leads to the activation of defence responses including, Ca2+messengers, phytohormonal cross-talk, gossypol, flavonoids, PhasiRNA and susceptibility genes (S-genes). The qRT-PCR assay of 10 functionally important genes also showed their involvement in differential responses at 24 and 48 h post whitefly infestation. Briefly, our study helps in understanding the resistant nature of Mac7 under whitefly stress.


Subject(s)
Disease Resistance/genetics , Gossypium/genetics , Gossypium/metabolism , Hemiptera , Plant Diseases/genetics , Transcriptome , Animals , Gene Expression Regulation, Plant , Genes, Plant , Gossypium/immunology , Tetraploidy
8.
Plants (Basel) ; 10(6)2021 Jun 07.
Article in English | MEDLINE | ID: mdl-34200224

ABSTRACT

Nutrients, including macronutrients such as Ca, P, K, and Mg, are essential for crop production and seed quality, and for human and animal nutrition and health. Macronutrient deficiencies in soil lead to poor crop nutritional qualities and a low level of macronutrients in cottonseed meal-based products, leading to malnutrition. Therefore, the discovery of novel germplasm with a high level of macronutrients or significant variability in the macronutrient content of crop seeds is critical. To our knowledge, there is no information available on the effects of chromosome or chromosome arm substitution on cottonseed macronutrient content. The objective of this study was to evaluate the effects of chromosome or chromosome arm substitution on the variability and content of the cottonseed macronutrients Ca, K, Mg, N, P, and S in chromosome substitution lines (CS). Nine chromosome substitution lines were grown in two-field experiments at two locations in 2013 in South Carolina, USA, and in 2014 in Mississippi, USA. The controls used were TM-1, the recurrent parent of the CS line, and the cultivar AM UA48. The results showed major variability in macronutrients among CS lines and between CS lines and controls. For example, in South Carolina, the mean values showed that five CS lines (CS-T02, CS-T04, CS-T08sh, CS-B02, and CS-B04) had higher Ca level in seed than controls. Ca levels in these CS lines varied from 1.88 to 2.63 g kg-1 compared with 1.81 and 1.72 g kg-1 for TM-1 and AMUA48, respectively, with CS-T04 having the highest Ca concentration. CS-M08sh exhibited the highest K concentration (14.50 g kg-1), an increase of 29% and 49% over TM-1 and AM UA48, respectively. Other CS lines had higher Mg, P, and S than the controls. A similar trend was found at the MS location. This research demonstrated that chromosome substitution resulted in higher seed macronutrients in some CS lines, and these CS lines with a higher content of macronutrients can be used as a genetic tool towards the identification of desired seed nutrition traits. Also, the CS lines with higher desired macronutrients can be used as parents to breed for improved nutritional quality in Upland cotton, Gossypium hirsutum L., through improvement by the interspecific introgression of desired seed nutrient traits such as Ca, K, P, S, and N. The positive and significant (p ≤ 0.0001) correlation of P with Ca, P with Mg, S with P, and S with N will aid in understanding the relationships between nutrients to improve the fertilizer management program and maintain higher cottonseed nutrient content.

9.
Plants (Basel) ; 9(9)2020 Aug 23.
Article in English | MEDLINE | ID: mdl-32842514

ABSTRACT

Micronutrients are essential for plant growth and development, and important for human health nutrition and livestock feed. Therefore, the discovery of novel germplasm with significant variability or higher micronutrients content in crop seeds is critical. Currently, there is no information available on the effects of chromosome or chromosome arm substitution in cotton on cottonseed micronutrients. Thus, the objective of this study was to evaluate the effects of chromosome or chromosome arm substitution on the variability and levels of micronutrients B, Fe, Cu, Zn, Mn, and Ni in cottonseed from chromosome substitution (CS) cotton lines. Our hypothesis was that interspecific chromosome substitution in cotton can affect cottonseed micronutrients content, resulting in significant differences and variabilities of these nutrients among CS lines and between CS lines and the controls. Nine CS lines were grown in two-field experiments at two locations (in 2013 in South Carolina, USA; and in 2014 in Mississippi, USA). TM-1 (the recurrent parent of the CS line) and AM UA48 (cultivar) were used as control. The results showed significant variability among CS lines compared to the controls AM UA48 and TM-1. For example, in South Carolina (SC), B concentration in cottonseed ranged from 10.35 mg kg-1 in CS-M02 to 13.67 mg kg-1 in CS-T04. The concentration of Cu ranged from 4.81 mg kg-1 in CS-B08sh to 7.65 mg kg-1 in CS-T02, and CS-T02 was higher than both controls. The concentration of Fe ranged from 36.09 mg kg-1 to 56.69 mg kg-1 (an increase up to 57%), and six CS lines (CS-B02, CS-B08sh, CS-M02, CS-M04, CS-T02, and CS-T04) had higher concentration than both controls in 2013. In 2014 at the Mississippi location (MS), similar observation was found with CS lines for micronutrients content. The CS lines with higher concentrations of these micronutrients can be used as a genetic tool toward QTL identification for desired seed traits because these lines are genetically similar with TM-1, except the substituted chromosome or chromosome segment pairs from the alien species. Chromosome substitution provides an effective means for upland cotton improvement by targeted interspecific introgression, yielding CS lines that facilitate trait discovery, such as seed micronutritional qualities, due to increased isogenicity and markedly reduced complexity from epistatic interactions with non-target alien chromosomes. The positive correlation between B, Cu, and Fe at both locations, between Ni and Mn, between Zn and Cu, and between Zn and Ni at both locations signify the importance of a good agricultural and fertilizer management of these nutrients to maintain higher cottonseed nutrient content.

10.
Plant Biotechnol J ; 18(3): 691-706, 2020 03.
Article in English | MEDLINE | ID: mdl-31448544

ABSTRACT

Cultivated cotton (Gossypium hirsutum) is the most important fibre crop in the world. Cotton leaf curl disease (CLCuD) is the major limiting factor and a threat to textile industry in India and Pakistan. All the local cotton cultivars exhibit moderate to no resistance against CLCuD. In this study, we evaluated an exotic cotton accession Mac7 as a resistance source to CLCuD by challenging it with viruliferous whiteflies and performing qPCR to evaluate the presence/absence and relative titre of CLCuD-associated geminiviruses/betasatellites. The results indicated that replication of pathogenicity determinant betasatellite is significantly attenuated in Mac7 and probably responsible for resistance phenotype. Afterwards, to decipher the genetic basis of CLCuD resistance in Mac7, we performed RNA sequencing on CLCuD-infested Mac7 and validated RNA-Seq data with qPCR on 24 independent genes. We performed co-expression network and pathway analysis for regulation of geminivirus/betasatellite-interacting genes. We identified nine novel modules with 52 hubs of highly connected genes in network topology within the co-expression network. Analysis of these hubs indicated the differential regulation of auxin stimulus and cellular localization pathways in response to CLCuD. We also analysed the differential regulation of geminivirus/betasatellite-interacting genes in Mac7. We further performed the functional validation of selected candidate genes via virus-induced gene silencing (VIGS). Finally, we evaluated the genomic context of resistance responsive genes and found that these genes are not specific to A or D sub-genomes of G. hirsutum. These results have important implications in understanding CLCuD resistance mechanism and developing a durable resistance in cultivated cotton.


Subject(s)
Begomovirus , Disease Resistance , Gossypium/genetics , Plant Diseases/genetics , Gene Silencing , Genes, Plant , Gossypium/virology , India , Pakistan , Plant Diseases/virology
11.
Plant Direct ; 3(5): e00141, 2019 May.
Article in English | MEDLINE | ID: mdl-31245779

ABSTRACT

Upland cotton (Gossypium hirsutum L.) produces terpenoid aldehydes (TAs) that protect the plant from microbial and insect infestations. Foliar TAs include plus (+)- and minus (-)-gossypol, hemigossypolone, and heliocides. To examine foliar TAs' response to physical wounding, the four TA derivatives of a fully glanded G. hirsutum variety JACO GL were quantified by ultra-high performance liquid chromatography. The results show that foliar heliocides increased by 1.7-fold in younger leaves after wounding. While the hemigossypolone level was not affected by the physical wounding, the level of heliocides was significantly increased up to 1.8-fold in the younger leaves. Upland cotton accumulates concentrated carbohydrates, amino acids, and fatty acids in foliar extrafloral nectar (EFN) to serve as a nutrient resource, which attracts both beneficial insects and damaging pests. To better understand the nectar physiology, particularly to determine the temporal dynamics of EFN metabolites in response to the wounding, a gas chromatograph-mass spectrometer (GC-MS) was used to perform metabolic profiling analyses of a G. hirsutum variety Deltapine 383 that has fully developed extrafloral nectaries. A total of 301 compounds were monitored, specifically 75 primary metabolites, two secondary metabolites and 224 unidentified compounds. The physical wounding treatment changed the EFN composition and lowered overall production. The accumulation of 30 metabolites was altered in response to the wounding treatment and threonic acid levels increased consistently. GC-MS combined with Kovat's analysis enabled identification of EFN secondary metabolites including furfuryl alcohol and 5-hyrdomethoxyfurfural, which both have antioxidant and antimicrobial properties that may protect the nectar against microbial pathogens. This study provides new insights into the wounding response of cotton plants in terms of cotton metabolites found in leaf glands and extrafloral nectar as well as highlighting some protective functions of secondary metabolites produced in foliar glands and extrafloral nectaries.

12.
BMC Genomics ; 20(1): 507, 2019 Jun 18.
Article in English | MEDLINE | ID: mdl-31215403

ABSTRACT

BACKGROUND: Whiteflies (Bemisia tabaci) are phloem sap-sucking pests that because of their broad host range and ability to transmit viruses damage crop plants worldwide. B. tabaci are now known to be a complex of cryptic species that differ from each other in many characteristics such as mode of interaction with viruses, invasiveness, and resistance to insecticides. Asia II 1 is an indigenous species found on the Indian sub-continent and south-east Asia while the species named as Middle East Asia Minor 1 (MEAM1), likely originated from the Middle-East and has spread worldwide in recent decades. The purpose of this study is to find genomic differences between these two species. RESULTS: Sequencing of the nuclear genome of Asia II 1 with Illumina HiSeq and MiSeq generated 198.90 million reads that covers 88% of the reference genome. The sequence comparison with MEAM1 identified 2,327,972 SNPs and 202,479 INDELs. In Total, 1294 genes were detected with high impact variants. The functional analysis revealed that some of the genes are involved in virus transmission including 4 genes in Tomato yellow leaf curl virus (TYLCV) transmission, 96 in Tomato crinivirus (ToCV) transmission, and 14 genes in insecticide resistance. CONCLUSIONS: These genetic differences between Asia II 1 and MEAM1 may underlie the major biological differences between the two species such as virus transmission, insecticide resistance, and range of host plants. The present study provides new genomic data and information resources for Asia II 1 that will not only contribute to the species delimitation of whitefly, but also help in conceiving future research studies to develop more targeted management strategies against whitefly.


Subject(s)
Genes, Insect/genetics , Genetic Variation , Hemiptera/physiology , Hemiptera/virology , Plant Viruses/physiology , Whole Genome Sequencing , Animals , Cell Nucleus/genetics , Gene Ontology , Genomics , Hemiptera/cytology , Hemiptera/genetics , Insecticide Resistance/genetics , Species Specificity
13.
Plants (Basel) ; 8(5)2019 May 14.
Article in English | MEDLINE | ID: mdl-31091727

ABSTRACT

A collection of cultivated and non-cultivated species of cotton (Gossypium spp.) has been maintained for the last four decades in Multan, Pakistan. This geographical location has been observed as a hotspot for the evolution of begomoviruses and satellites associated with cotton leaf curl disease (CLCuD). Recent studies showed that begomoviruses responsible for the CLCuD epidemic in the 1990s, and that almost disappeared from the CLCuD complex in 2000s, have been observed again in CLCuD-infected cotton fields. To identify host species that acted as probable reservoirs for these viruses, we characterized begomoviruses and satellites in non-cultivated cotton species G. raimondii, G. thurberi and G. mustelinum and identified several species of CLCuD associated begomoviruses and satellites. Further, phylogenetic analysis indicated that the identified begomoviruses and beta/alphasatellites are closely related to the ones associated with the most recent CLCuD complex. qPCR indicated that the comparative level of virus significantly decreased in the presence of alphasatellites. Our results indicated that non-cultivated cotton species have been continuously challenged by diverse begomoviruses and associated satellites and act as reservoirs for CLCuD associated begomoviruses. These results provide novel insights into understanding the spread of begomoviruses and associated satellites in New World cotton species introduced into the Old World.

14.
Plant Biotechnol J ; 17(6): 1142-1153, 2019 06.
Article in English | MEDLINE | ID: mdl-30467959

ABSTRACT

In seeds and other parts of cultivated, tetraploid cotton (Gossypium hirsutum L.), multicellular groups of cells lysigenously form dark glands containing toxic terpenoids such as gossypol that defend the plant against pests and pathogens. Using RNA-seq analysis of embryos from near-isogenic glanded (Gl2 Gl2 Gl3 Gl3 ) versus glandless (gl2 gl2 gl3 gl3 ) plants, we identified 33 genes that expressed exclusively or at higher levels in embryos just prior to gland formation in glanded plants. Virus-induced gene silencing against three gene pairs led to significant reductions in the number of glands in the leaves, and significantly lower levels of gossypol and related terpenoids. These genes encode transcription factors and have been designated the 'Cotton Gland Formation' (CGF) genes. No sequence differences were found between glanded and glandless cotton for CGF1 and CGF2 gene pairs. The glandless cotton has a transposon insertion within the coding sequence of the GoPGF (synonym CGF3) gene of the A subgenome and extensive mutations in the promoter of D subgenome homeolog. Overexpression of GoPGF (synonym CGF3) led to a dramatic increase in gossypol and related terpenoids in cultured cells, whereas CRISPR/Cas9 knockout of GoPGF (synonym CGF3) genes resulted in glandless phenotype. Taken collectively, the results show that the GoPGF (synonym CGF3) gene plays a critical role in the formation of glands in the cotton plant. Seed-specific silencing of CGF genes, either individually or in combination, could eliminate glands, thus gossypol, from the cottonseed to render it safe as food or feed for monogastrics.


Subject(s)
Gene Expression Regulation, Plant , Gossypium , Seeds , Gene Expression Regulation, Plant/genetics , Gossypium/genetics , Gossypol/metabolism , Plant Leaves/cytology , Plant Leaves/genetics , Plant Leaves/metabolism , Seeds/cytology , Seeds/genetics , Seeds/metabolism
15.
Genome Biol Evol ; 11(1): 53-71, 2019 01 01.
Article in English | MEDLINE | ID: mdl-30476109

ABSTRACT

We employed phylogenomic methods to study molecular evolutionary processes and phylogeny in the geographically widely dispersed New World diploid cottons (Gossypium, subg. Houzingenia). Whole genome resequencing data (average of 33× genomic coverage) were generated to reassess the phylogenetic history of the subgenus and provide a temporal framework for its diversification. Phylogenetic analyses indicate that the subgenus likely originated following transoceanic dispersal from Africa about 6.6 Ma, but that nearly all of the biodiversity evolved following rapid diversification in the mid-Pleistocene (0.5-2.0 Ma), with multiple long-distance dispersals required to account for range expansion to Arizona, the Galapagos Islands, and Peru. Comparative analyses of cpDNAversus nuclear data indicate that this history was accompanied by several clear cases of interspecific introgression. Repetitive DNAs contribute roughly half of the total 880 Mb genome, but most transposable element families are relatively old and stable among species. In the genic fraction, pairwise synonymous mutation rates average 1% per Myr, with nonsynonymous changes being about seven times less frequent. Over 1.1 million indels were detected and phylogenetically polarized, revealing a 2-fold bias toward deletions over small insertions. We suggest that this genome down-sizing bias counteracts genome size growth by TE amplification and insertions, and helps explain the relatively small genomes that are restricted to this subgenus. Compared with the rate of nucleotide substitution, the rate of indel occurrence is much lower averaging about 17 nucleotide substitutions per indel event.


Subject(s)
Evolution, Molecular , Genome, Plant , Gossypium/genetics , Phylogeny , DNA Copy Number Variations , DNA Transposable Elements , INDEL Mutation , Mexico
16.
Sci Rep ; 7(1): 15880, 2017 Nov 21.
Article in English | MEDLINE | ID: mdl-29162860

ABSTRACT

Cotton leaf curl disease (CLCuD), caused by cotton leaf curl viruses (CLCuVs), is among the most devastating diseases in cotton. While the widely cultivated cotton species Gossypium hirsutum is generally susceptible, the diploid species G. arboreum is a natural source for resistance against CLCuD. However, the influence of CLCuD on the G. arboreum transcriptome and the interaction of CLCuD with G. arboreum remains to be elucidated. Here we have used an RNA-Seq based study to analyze differential gene expression in G. arboreum under CLCuD infestation. G. arboreum plants were infested by graft inoculation using a CLCuD infected scion of G. hirsutum. CLCuD infested asymptomatic and symptomatic plants were analyzed with RNA-seq using an Illumina HiSeq. 2500. Data analysis revealed 1062 differentially expressed genes (DEGs) in G. arboreum. We selected 17 genes for qPCR to validate RNA-Seq data. We identified several genes involved in disease resistance and pathogen defense. Furthermore, a weighted gene co-expression network was constructed from the RNA-Seq dataset that indicated 50 hub genes, most of which are involved in transport processes and might have a role in the defense response of G. arboreum against CLCuD. This fundamental study will improve the understanding of virus-host interaction and identification of important genes involved in G. arboreum tolerance against CLCuD.


Subject(s)
Begomovirus/physiology , Disease Resistance/genetics , Gossypium/genetics , Gossypium/virology , Plant Diseases/immunology , Plant Diseases/virology , Transcriptome/genetics , Cluster Analysis , Gene Expression Regulation, Plant , Gene Regulatory Networks , Genes, Essential , Genes, Plant , Gossypium/immunology , Metabolic Networks and Pathways/genetics , Oxidative Stress/genetics , Plant Diseases/genetics , Plant Growth Regulators/metabolism , Plant Immunity/genetics , Plant Proteins/genetics , Plant Proteins/metabolism , Reproducibility of Results , Signal Transduction , Species Specificity
17.
Sci Rep ; 7(1): 15274, 2017 11 10.
Article in English | MEDLINE | ID: mdl-29127298

ABSTRACT

Like those of many agricultural crops, the cultivated cotton is an allotetraploid and has a large genome (~2.5 gigabase pairs). The two sub genomes, A and D, are highly similar but unequally sized and repeat-rich, which pose significant challenges for accurate genome reconstruction using standard approaches. Here we report the development of BAC libraries, sub genome specific physical maps, and a new-generation sequencing approach that will lead to a reference-grade genome assembly for Upland cotton. Three BAC libraries were constructed, fingerprinted, and integrated with BAC-end sequences (BES) to produce a de novo whole-genome physical map. The BAC map was partitioned by sub genomes through alignment to the diploid progenitor D-genome reference sequence with densely spaced BES anchor points and computational filtering. The physical maps were validated with FISH and genetic mapping of SNP markers derived from BES. Two pairs of homeologous chromosomes, A11/D11 and A12/D12, were used to assess multiplex sequencing approaches for completeness and scalability. The results represent the first sub genome anchored physical maps of Upland cotton, and a new-generation approach to the whole-genome sequencing, which will lead to the reference-grade assembly of allopolyploid cotton and serve as a general strategy for sequencing other polyploid species.


Subject(s)
Chromosomes, Plant/genetics , Genetic Linkage , Genome, Plant , Gossypium/genetics , Polyploidy , Chromosomes, Artificial, Bacterial , Contig Mapping , Gene Library , Sequence Analysis, DNA
18.
Viruses ; 9(9)2017 09 14.
Article in English | MEDLINE | ID: mdl-28906473

ABSTRACT

Cotton leaf curl virus disease (CLCuD) is caused by a suite of whitefly-transmitted begomovirus species and strains, resulting in extensive losses annually in India and Pakistan. RNA-interference (RNAi) is a proven technology used for knockdown of gene expression in higher organisms and viruses. In this study, a small interfering RNA (siRNA) construct was designed to target the AC1 gene of Cotton leaf curl Kokhran virus-Burewala (CLCuKoV-Bu) and the ßC1 gene and satellite conserved region of the Cotton leaf curl Multan betasatellite (CLCuMB). The AC1 gene and CLCuMB coding and non-coding regions function in replication initiation and suppression of the plant host defense pathway, respectively. The construct, Vß, was transformed into cotton plants using the Agrobacterium-mediated embryo shoot apex cut method. Results from fluorescence in situ hybridization and karyotyping assays indicated that six of the 11 T1 plants harbored a single copy of the Vß transgene. Transgenic cotton plants and non-transgenic (susceptible) test plants included as the positive control were challenge-inoculated using the viruliferous whitefly vector to transmit the CLCuKoV-Bu/CLCuMB complex. Among the test plants, plant Vß-6 was asymptomatic, had the lowest amount of detectable virus, and harbored a single copy of the transgene on chromosome six. Absence of characteristic leaf curl symptom development in transgenic Vß-6 cotton plants, and significantly reduced begomoviral-betasatellite accumulation based on real-time polymerase chain reaction, indicated the successful knockdown of CLCuKoV-Bu and CLCuMB expression, resulting in leaf curl resistant plants.


Subject(s)
Begomovirus/genetics , Gene Knockdown Techniques , Gossypium/genetics , Gossypium/virology , Plant Diseases/virology , RNA Interference , Satellite Viruses/genetics , DNA, Satellite/genetics , DNA, Viral/genetics , Disease Resistance/genetics , Genetic Engineering/methods , In Situ Hybridization, Fluorescence , Phylogeny , Plants, Genetically Modified/genetics , Plants, Genetically Modified/virology , Real-Time Polymerase Chain Reaction , Sequence Analysis, DNA
19.
Mol Biotechnol ; 59(7): 241-250, 2017 Jul.
Article in English | MEDLINE | ID: mdl-28567686

ABSTRACT

A Tobacco rattle virus (TRV)-based virus-induced gene silencing assay was employed as a reverse genetic approach to study gene function in cotton (Gossypium hirsutum). This approach was used to investigate the function of the Enoyl-CoA reductase (GhECR) gene in pathogen defense. Amino acid sequence alignment of Arabidopsis ECR with homologous sequence from G. hirsutum, G. arboreum, G. herbaceum and G. barbadense showed that ECRs are highly conserved among these species. TRV-based silencing of GhECR gene in G. hirsutum induced a cell death/necrotic lesion-like phenotype. Reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative PCR showed reduced GhECR mRNA levels in TRV inoculated plants. Three isolates of Verticillium dahliae (V. dahliae) and Fusarium oxysporum f. sp. vasinfectum (FOV) were used to infect GhECR-silenced plants. Out of 6 races of 2 pathogens, down regulation of GhECR gene resulted in reduced resistance. This is the first report showing that cotton GhECR gene is involved in resistance to different strains of V. dahliae and FOV.


Subject(s)
Disease Resistance , Fatty Acid Desaturases/genetics , Gossypium/enzymology , Plant Viruses/genetics , Amino Acid Sequence , Fatty Acid Desaturases/metabolism , Fusarium/pathogenicity , Gene Silencing , Genetic Vectors/physiology , Gossypium/genetics , Gossypium/microbiology , Plant Diseases/genetics , Plant Diseases/microbiology , Plant Proteins/genetics , Plant Proteins/metabolism , Sequence Alignment , Verticillium/pathogenicity
20.
Sci Rep ; 7(1): 680, 2017 04 06.
Article in English | MEDLINE | ID: mdl-28386113

ABSTRACT

The first epidemic of cotton leaf curl disease (CLCuD) in early 1990's in the Indian subcontinent was associated with several distinct begomoviruses along with a disease-specific betasatellite. Resistant cotton varieties were introduced in late 1990's but soon resistance was broken and was associated with a single recombinant begomovirus named Burewala strain of Cotton leaf curl Kokhran virus that lacks a full complement of a gene encoding a transcription activator protein (TrAP). In order to understand the ongoing changes in CLCuD complex in Pakistan, CLCuD affected plants from cotton fields at Vehari were collected. Illumina sequencing was used to assess the diversity of CLCuD complex. At least three distinct begomoviruses characterized from the first epidemic; Cotton leaf curl Multan virus, Cotton leaf curl Kokhran virus and Cotton leaf curl Alabad virus, several distinct species of alphasatellites and cotton leaf curl Multan betasatellite were found associated with CLCuD. These viruses were also cloned and sequenced through Sanger sequencing to confirm the identity of the begomoviruses and that all clones possessed a full complement of the TrAP gene. A new strain of betasatellite was identified here and named CLCuMuBVeh. The implications of these findings in efforts to control CLCuD are discussed.


Subject(s)
Begomovirus/classification , Begomovirus/genetics , Gossypium/virology , Plant Diseases/virology , DNA, Satellite , DNA, Viral , Genome, Viral , Genomics/methods , High-Throughput Nucleotide Sequencing , Open Reading Frames , Pakistan , Phylogeny , Plant Leaves/virology , Recombination, Genetic
SELECTION OF CITATIONS
SEARCH DETAIL