Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 6 de 6
Filter
Add more filters











Database
Language
Publication year range
1.
J Mol Cell Biol ; 16(2)2024 Jul 29.
Article in English | MEDLINE | ID: mdl-38200711

ABSTRACT

Accurate chromosome segregation in mitosis depends on kinetochores that connect centromeric chromatin to spindle microtubules. Centromeres are captured by individual microtubules via a kinetochore constitutive centromere-associated network (CCAN) during chromosome segregation. CCAN contains 16 subunits, including CENP-W and CENP-T. However, the molecular recognition and mitotic regulation of the CCAN assembly remain elusive. Here, we revealed that CENP-W binds to the histone fold domain and an uncharacterized N-terminal region of CENP-T. Aurora B phosphorylates CENP-W at threonine 60, which enhances the interaction between CENP-W and CENP-T to ensure robust metaphase chromosome alignment and accurate chromosome segregation in mitosis. These findings delineate a conserved signaling cascade that integrates protein phosphorylation with CCAN integrity for the maintenance of genomic stability.


Subject(s)
Aurora Kinase B , Chromosomal Proteins, Non-Histone , Chromosome Segregation , Mitosis , Aurora Kinase B/metabolism , Humans , Chromosomal Proteins, Non-Histone/metabolism , Chromosomal Proteins, Non-Histone/genetics , Phosphorylation , HeLa Cells , Kinetochores/metabolism , Protein Binding , Centromere/metabolism
2.
Amino Acids ; 55(12): 1745-1764, 2023 Dec.
Article in English | MEDLINE | ID: mdl-37500789

ABSTRACT

About 30% of malignant tumors include KRAS mutations, which are frequently required for the development and maintenance of malignancies. KRAS is now a top-priority cancer target as a result. After years of research, it is now understood that the oncogenic KRAS-G12C can be targeted. However, many other forms, such as the G13D mutant, are yet to be addressed. Here, we used a receptor-based pharmacophore modeling technique to generate potential inhibitors of the KRAS-G13D oncogenic mutant. Using a comprehensive virtual screening workflow model, top hits were selected, out of which CSC01 was identified as a promising inhibitor of the oncogenic KRAS mutant (G13D). The stability of CSC01 upon binding the switch II pocket was evaluated through an exhaustive molecular dynamics simulation study. The several post-simulation analyses conducted suggest that CSC01 formed a stable complex with KRAS-G13D. CSC01, through a dynamic protein-ligand interaction profiling analysis, was also shown to maintain strong interactions with the mutated aspartic acid residue throughout the simulation. Although binding free energy analysis through the umbrella sampling approach suggested that the affinity of CSC01 with the switch II pocket of KRAS-G13D is moderate, our DFT analysis showed that the stable interaction of the compound might be facilitated by the existence of favorable molecular electrostatic potentials. Furthermore, based on ADMET predictions, CSC01 demonstrated a satisfactory drug likeness and toxicity profile, making it an exemplary candidate for consideration as a potential KRAS-G13D inhibitor.


Subject(s)
Colorectal Neoplasms , Proto-Oncogene Proteins p21(ras) , Humans , Proto-Oncogene Proteins p21(ras)/genetics , Colorectal Neoplasms/pathology , Mutation , Molecular Dynamics Simulation
3.
iScience ; 26(5): 106621, 2023 May 19.
Article in English | MEDLINE | ID: mdl-37250328

ABSTRACT

Hemogenic endothelium (HE) is the main source of blood cells in the embryo. To improve blood manufacturing from human pluripotent stem cells (hPSCs), it is essential to define the molecular determinants that enhance HE specification and promote development of the desired blood lineage from HE. Here, using SOX18-inducible hPSCs, we revealed that SOX18 forced expression at the mesodermal stage, in contrast to its homolog SOX17, has minimal effects on arterial specification of HE, expression of HOXA genes and lymphoid differentiation. However, forced expression of SOX18 in HE during endothelial-to-hematopoietic transition (EHT) greatly increases NK versus T cell lineage commitment of hematopoietic progenitors (HPs) arising from HE predominantly expanding CD34+CD43+CD235a/CD41a-CD45- multipotent HPs and altering the expression of genes related to T cell and Toll-like receptor signaling. These studies improve our understanding of lymphoid cell specification during EHT and provide a new tool for enhancing NK cell production from hPSCs for immunotherapies.

4.
J Mol Cell Biol ; 14(7)2022 09 27.
Article in English | MEDLINE | ID: mdl-36069839

ABSTRACT

Error-free mitosis depends on accurate chromosome attachment to spindle microtubules via a fine structure called the centromere that is epigenetically specified by the enrichment of CENP-A nucleosomes. Centromere maintenance during mitosis requires CENP-A-mediated deposition of constitutive centromere-associated network that establishes the inner kinetochore and connects centromeric chromatin to spindle microtubules during mitosis. Although previously proposed to be an adaptor of retinoic acid receptor, here, we show that CENP-R synergizes with CENP-OPQU to regulate kinetochore-microtubule attachment stability and ensure accurate chromosome segregation in mitosis. We found that a phospho-mimicking mutation of CENP-R weakened its localization to the kinetochore, suggesting that phosphorylation may regulate its localization. Perturbation of CENP-R phosphorylation is shown to prevent proper kinetochore-microtubule attachment at metaphase. Mechanistically, CENP-R phosphorylation disrupts its binding with CENP-U. Thus, we speculate that Aurora B-mediated CENP-R phosphorylation promotes the correction of improper kinetochore-microtubule attachment in mitosis. As CENP-R is absent from yeast, we reasoned that metazoan evolved an elaborate chromosome stability control machinery to ensure faithful chromosome segregation in mitosis.


Subject(s)
Chromosome Segregation , Kinetochores , Animals , Centromere/metabolism , Centromere Protein A/genetics , Centromere Protein A/metabolism , Chromosomal Proteins, Non-Histone/metabolism , Kinetochores/metabolism , Microtubules/metabolism , Mitosis , Phosphorylation
5.
ChemistrySelect ; 7(7): e202103903, 2022 Feb 18.
Article in English | MEDLINE | ID: mdl-35601809

ABSTRACT

The emergence of the novel coronavirus (SARS-CoV-2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS-CoV-2, a class I fusion protein that aids ACE2 (angiotensin-converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication-defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole-inactivated SARS-CoV-2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA-based) vaccine candidate. The "YLQPRTFLL" peptide sequence (position 269-277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A-0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll-like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence "UACCUGCAGCCGCGUACCUUCCUGCUG" exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS-CoV-2 infection.

6.
Egypt J Med Hum Genet ; 21(1): 65, 2020.
Article in English | MEDLINE | ID: mdl-38624529

ABSTRACT

The reversible process where a homogenous fluid de-mixes into two distinctively separate liquid phases is referred to as LLPS (Liquid-liquid phase separation). The resulting liquid is made up of one dilute phase and one condensed phase. An increasing number of studies have shown that the liquid-liquid phase separation is an important principle that underlies intracellular organization in biological systems, forming liquid condensates without a membrane envelope, otherwise known as MLOs (membraneless organelles). Such organelles include the P bodies, nucleolus and stress granules. Moreover, the regulation of many other biological processes such as signal transduction, chromatin rearrangement and RNA metabolism have been linked to the liquid-liquid phase separation.

SELECTION OF CITATIONS
SEARCH DETAIL