A retrospective study of Crimean-Congo hemorrhagic fever in Iraq.

Background: CCHF is transmitted via ticks biting and directly by contact with tissue or blood of infected patients or viremic animals. This study intends to determine the occurrence of CCHF in Iraq between 2015 and 2019. Methods: This study was designed as a retrospective and descriptive cross-sectional study. It was approved the occurrence of CCHF in Iraq with relation to some epidemiological and demographic data reported in the Iraqi Communicable Diseases Control Center (CDC)/zoonotic diseases section between 2015-2019. Results: Out of 206 suspected cases, only 17 were diagnosed as CCHF with a total fatality ratio of 52%, 25%, and 80% in 2015 and 2018 respectively. However, no mortality was reported during 2016, 2017, and 2019. The mean age of the patients was 33 years± 18 SD, in males mainly (76%). Moreover, the risk groups were 29 %, 23 %, 18 % 12 %, and 6 % for butchers, animal dealers, gainers, both housewives and students and children respectively. Conclusion: Strict precautions and precise surveillance should be implemented to control the disease and protect the community by improving the diagnosis and treatment of CCHF. The authors recommend another future study to detect the genotyping and sequencing of CCHFV in Iraq.

Crimean-Congo Hemorrhagic Fever Virus Kinetics in Serum, Saliva, and Urine, Iran, 2018.

Little is known about using noninvasive samples for diagnosing Crimean-Congo hemorrhagic fever (CCHF). We investigated detection of CCHF virus in serum, saliva, and urine samples. Our results indicate that serum is the best sample type for CCHF diagnosis; saliva can be used for noninvasive sampling.

Predictors of Mortality in Crimean-Congo Hemorrhagic Fever Patients Admitted at a Tertiary Care Hospital in Pakistan over the Last 10 Years: A Case-Control Study.

The objective was to identify predictors of mortality in hospitalized patients with Crimean-Congo hemorrhagic fever (CCHF). A case-control study was conducted on patients hospitalized with CCHF from 2012 to 2022. Risk factors for mortality in CCHF patients were analyzed using logistic regression. A total of 86 patients with a median age of 36 years (interquartile range [IQR], 27-36 years) were included, and the majority were males (78, 90.7%). Thirty-one patients (36%) were cases, whereas 55 (64%) were control patients. Based on univariate logistic regression analysis, patients who were in an age group of ≥40 years (odds ratio [OR]: 4.85; 95% CI: 1.8-12.4) or with presence of gum bleeding (OR: 2.66; 95% CI: 1.0-6.8), unit increase in white blood cell count (WBC) (OR: 1.09; 95% CI: 1.00-1.07), serum glutamate-pyruvate transaminase of ≥500 U/L (OR: 3.68; 95% CI: 1.4-9.3), serum glutamic-oxaloacetic transaminase (SGOT) of ≥1,000 U/L (OR: 8.72; 95% CI: 2.6-28.3), prothrombin time (PT) of ≥120 seconds (OR: 9.85; 95% CI: 3.2-29.8), international normalized ratio of ≥5 (OR: 15.8; 95% CI: 2.0-125.3), or acute respiratory distress syndrome (ARDS) (OR: 28.27; 95% CI: 5.84-136.9) were found to be significantly associated with mortality in CCHF. Factors found to be independently associated with mortality on multivariate analysis included ARDS (adjusted OR [aOR]: 27.7; 95% CI: 4.0-190.5), unit increase in WBC (aOR: 1.02; 95% CI: 1.02-1.26), SGOT of ≥1,000 U/L (aOR: 23.6; 95% CI: 2.32-241.7), and PT of ≥120 seconds (OR: 10.2; 95% CI: 2.00-52.4). CCHF is a rare but fatal disease, and patients with ARDS and increased WBC, high SGOT level, and increased PT indicative of liver injury and coagulopathy at the time of hospitalization are at high risk for mortality.

Looking Beyond the Lens of Crimean-Congo Hemorrhagic Fever in Africa.

Crimean-Congo hemorrhagic fever (CCHF) is a lethal viral disease that has severe public health effects throughout Africa and a case fatality rate of 10%-40%. CCHF virus was first discovered in Crimea in 1944 and has since caused a substantial disease burden in Africa. The shortage of diagnostic tools, ineffective tick control efforts, slow adoption of preventive measures, and cultural hurdles to public education are among the problems associated with continued CCHF virus transmission. Progress in preventing virus spread is also hampered by the dearth of effective serodiagnostic testing for animals and absence of precise surveillance protocols. Intergovernmental coordination, creation of regional reference laboratories, multiinstitutional public education partnerships, investments in healthcare infrastructure, vaccine development, and a One Health approach are strategic methods for solving prevention challenges. Coordinated efforts and financial commitments are needed to combat Crimean-Congo hemorrhagic fever and improve all-around readiness for newly developing infectious illnesses in Africa.

First Broad-Range Serological Survey of Crimean-Congo Hemorrhagic Fever among Hungarian Livestock.

(1) Background: Crimean-Congo hemorrhagic fever (CCHF) is an emerging tick-borne disease endemic in Africa, Asia, the Middle East, and the Balkan and Mediterranean regions of Europe. Although no human CCHF cases have been reported, based on vector presence, serological evidence among small vertebrates, and the general human population, Hungary lies within high evidence consensus for potential CCHF introduction and future human infection. Thus, the aim of our pilot serosurvey was to assess CCHF seropositivity among cattle and sheep as indicator animals for virus circulation in the country. (2) Methods: In total, 1905 serum samples taken from free-range cattle and sheep in 2017 were tested for the presence of anti-CCHF virus IgG antibodies using commercial ELISA and commercial and in-house immunofluorescent assays. (3) Results: We found a total of eleven reactive samples (0.58%) from five administrative districts of Hungary comprising 8 cattle and 3 sheep. The most affected regions were the south-central and northwestern parts of the country. (4) Conclusions: Based on these results, more extended surveillance is advised, especially in the affected areas, and there should be greater awareness among clinicians and other high-risk populations of the emerging threat of CCHF in Hungary and Central Europe.

Crimean-Congo haemorrhagic fever virus in questing non-Hyalomma spp. ticks in Northwest Spain, 2021.

Crimean-Congo haemorrhagic fever (CCHF) unexpectedly emerged in humans in Northwest Spain in 2021, and two additional cases were reported in the region in 2022. The 2021 case was associated with a tick bite on the outskirts of the city where the patient lived. PCR analysis of 95 questing ticks collected in the outskirts of that city in 2021, none of the genus Hyalomma, revealed a prevalence of confirmed CCHF virus (CCHFV) infection of 10.5%. Our results in this emerging scenario suggest the need to consider that CCHFV may be effectively spreading to Northwest Spain and to urgently understand any possible role of non-Hyalomma spp. ticks in the eco-epidemiological dynamics of CCHFV.

Epidemiologic Survey of Crimean-Congo Hemorrhagic Fever Virus in Suids, Spain.

We conducted a cross-sectional study in wild boar and extensively managed Iberian pig populations in a hotspot area of Crimean-Congo hemorrhagic fever virus (CCHFV) in Spain. We tested for antibodies against CCHFV by using 2 ELISAs in parallel. We assessed the presence of CCHFV RNA by means of reverse transcription quantitative PCR protocol, which detects all genotypes. A total of 113 (21.8%) of 518 suids sampled showed antibodies against CCHFV by ELISA. By species, 106 (39.7%) of 267 wild boars and 7 (2.8%) of 251 Iberian pigs analyzed were seropositive. Of the 231 Iberian pigs and 231 wild boars analyzed, none tested positive for CCHFV RNA. These findings indicate high CCHFV exposure in wild boar populations in endemic areas and confirm the susceptibility of extensively reared pigs to CCHFV, even though they may only play a limited role in the enzootic cycle.

Crimean-Congo Hemorrhagic Fever Virus in Ticks Collected from Cattle, Corsica, France, 2023.

We report the detection of Crimean-Congo hemorrhagic fever virus (CCHFV) in Corsica, France. We identified CCHFV African genotype I in ticks collected from cattle at 2 different sites in southeastern and central-western Corsica, indicating an established CCHFV circulation. Healthcare professionals and at-risk groups should be alerted to CCHFV circulation in Corsica.

Prevalence of crimean Congo hemorrhagic fever in Khyber Pakhtunkhwa, Pakistan.

BACKGROUND: CCHFV is well recognized as a major public health threat and its prevalence and epidemiological distribution in Pakistan and specifically in KP province is not well documented. METHODS: We used a gold-standard PCR-based diagnostic assay for confirmation of CCHFV among suspected patients. A total of 150 patients were enrolled from June 2022 to September 2022 and their blood samples were collected for PCR confirmation. RESULTS: The overall positivity rate for CCHFV was 26.67 %, with the virus mostly prevalent in the middle-aged group (21-40 years). In the July of 2022, a significant spike in the prevalence of CCHFV was observed in provincial capital Peshawar with the highest burden (31.57 %). CONCLUSION: Our findings indicate the necessity of strengthening CCHFV monitoring programs and intensifying efforts to identify hotspot regions for effective surveillance and control of CCHFV. The months before the Eid-ul-Adha are crucial in the context of CCHFV control.

A Review on Crimean-Congo Hemorrhagic Fever Infections in Tunisia.

Crimean-Congo hemorrhagic fever (CCHF) is a zoonotic tick-borne disease, caused by an arbovirus of the genus Orthonairovirus and the family Nairoviridae. Crimean-Congo hemorrhagic fever virus (CCHFV) is widespread in several regions of the world. While the virus is not pathogenic to all susceptible livestock and wild mammals, it can lead to severe hemorrhagic fever in humans. In this review, we compiled published data on CCHFV infections in humans, animals, and ticks in Tunisia. Based on that, we discussed the epidemiology and the distribution patterns of CCHFV infections highlighting the risk factors for this virus in the country. CCHF infection prevalence in humans was estimated to 2.76% (5/181) and 5% (2/38) in Tunisian febrile patients and Tunisian slaughterhouse workers, respectively. Concurrently, seroprevalence in domestic ungulates (sheep, goats, cattle, and dromedaries) ranged from zero to 89.7%, and only one Hyalomma impeltatum tick specimen collected from dromedaries in southern Tunisian was positive for CCHFV by reverse transcriptase-polymerase chain reaction (0.6%; 1/165). As Tunisian studies on CCHFV are geographically scattered and limited due to very small sample sizes, further studies are needed to improve the knowledge on the epidemiology of CCHF in Tunisia.

Ticks infected with Crimean-Congo hemorrhagic fever virus (CCHFV): A decision approach systematic review and meta-analysis regarding their role as vectors.

BACKGROUND: There are many studies present in literature performed to isolate CCHFV from ticks. However, gaps in knowledge for estimating global annual CCHFV infection rates; global CCHFV infection rates and records; CCHFV infection trend in ticks and ticks infested animals; and lack a decision regarding the role of ticks as CCHFV vectors caused to conduct this review. METHODS: From 605 papers identified, 150 papers were selected to become the study meta-analysis (57 papers), detailed CCHFV infected ticks (63 papers), and systematic review (99 papers) parts. RESULTS: Since there are no significant differences between the annual tick CCHFV infection rates; tick CCHFV infection rates between continents; and CCHFV infection rates between tick species and gender of ticks, and ticks and tick species infested animals. Given that ticks are considered both as CCHFV reservoirs and vectors. It is possible a little burden of CCHFV in infected ticks in natural enzootic cycles to maintain and disseminate CCHFV in humans. The decision regarding the role of ticks as CCHFV vectors administrated based on the study and a separately literature search regarding the role of ticks as CCHFV vectors; CCHFV infection rates and records; and trend of CCHFV infection records in 31 tick species. The trend of CCHFV infection records in 31 tick species exhibited a decreasing trend indicating the degree and importance of their roles as CCHFV vectors. CONCLUSIONS: Among 31 CCHFV infected tick species, 15 species have been enrolled as proven vectors and 16 species are suspected as potential vectors.

Clinical and Molecular Epidemiology of Crimean-Congo Hemorrhagic Fever in Humans in Uganda, 2013-2019.

Crimean-Congo Hemorrhagic Fever (CCHF) is endemic in Uganda, yet its epidemiology remains largely uncharacterized. To better understand its occurrence within Uganda, case reports of patients hospitalized with CCHF between 2013 and 2019 were reviewed. Further, genome sequences of CCHF-positive RNA obtained during this period were determined for phylogenetic comparisons. We found that a total of 32 cases (75% males; CFR, 31.2%), aged between 9 to 68 years, were reported during the study period. Most cases were detected during July to December of each outbreak year (81.2%; P < 0.01) and were located along the "cattle corridor" (68.7%, P = 0.03). The most common presenting symptoms were fever (93.8%), hemorrhage (81.3%), headache (78.1%), fatigue (68.8%), vomiting (68.8%), and myalgia (65.6%). In five patients for whom hematological data were available, varied abnormalities were observed including thrombocytopenia, leukopenia, anemia, lymphopenia, lymphocytosis, polycythemia, and microcytosis. About 56.3% (P = 0.47) of patients reported tick bites or exposure to livestock as their potential source of infection. Person-to-person transmission was suspected for two cases. Using unbiased metagenomics, we found that the viral S- and L- segments have remained conserved in Africa 2 clade since the 1950s. In contrast, the M segment split into two geographically interspersed clades; one that belongs to Africa 2 and another that is ancestral to Africa 1 and 2. Overall, this data summarizes information on the history and clinical presentation of human CCHF in Uganda. Importantly, it identifies vulnerable populations as well as temporal and geographic regions in Uganda where surveillance and control interventions could be focused.

Sequential determination of viral load, humoral responses and phylogenetic analysis in fatal and non-fatal cases of Crimean-Congo hemorrhagic fever patients from Gujarat, India, 2019.

BACKGROUND: Thirty-four CCHF cases (17 fatal; 17 survived) were confirmed from Gujarat state, India during the year 2019. We aimed to find out the viral load, antibody kinetics, cytokine profile and phylogenetic analysis between fatal and non- fatal cases. METHODS: Thirty four cases were included in this study. Blood and urine samples were collected from all the cases on the day of admission to hospital. Non-fatal cases were followed weekly for understanding the profile of viral kinetics, anti-CCHFV IgM and IgG antibodies. We also quantified the cytokines in both fatal and non-fatal cases. For epidemiological correlation, livestock were screened for anti-CCHF IgG antibodies and the tick pool specimens were tested by real time RT-PCR. Virus isolation was attempted on tick pools and human specimens and phylogenetic analysis performed on human and ticks complete genome sequences. RESULTS: CCHF cases were detected throughout year in 2019 with the peak in August. Out of 34 cases, eight secondary CCHF cases were reported. Cases were predominantly detected in males and in 19-45 years age group (55.88%). The persistence of viremia was observed till 76th POD (post onset date) in one case whereas anti-CCHFV IgM and IgG was detected amongst these cases from the 2nd and 20th POD respectively. Positivity observed amongst livestock and tick pools were was 21.57% and 7.4% respectively. The cytokine analysis revealed a significant increase in the level of serum IL-6, IL-10 and IFN-γ during the acute phase of the infection, but interestingly IL-10 lowered to normal upon clearance of the virus in the clinically recovered case. Fatal cases had high viral RNA copy numbers. Bleeding from one or two mucosal sites was significantly associated with fatality (OR-16.47;p-0.0034 at 95% CI). We could do CCHF virus isolation from two cases. Phylogenetic analysis revealed circulation of re-assortment of Asian-West African genotypes in humans and ticks. CONCLUSIONS: The persistence of CCHF viral RNA was detected till 76th POD in one of the survivors. The circulation of a re-assortment Asian-West African genotype in a CCHF case is also reported first time from India.

Aptamer based diagnosis of crimean-congo hemorrhagic fever from clinical specimens.

Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N40)GGGAGACAAGAATAAGCA). The KD of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.

Detection of Crimean-Congo hemorrhagic fever virus in blood-fed Hyalomma ticks collected from Mauritanian livestock.

BACKGROUND: Crimean-Congo hemorrhagic fever virus (CCHFV) belongs to the genus Orthonairovirus (Nairovididae) and is a (re)emerging tick-borne pathogen. It is endemic in most parts of Africa, Asia and southern Europe, and can cause severe hemorrhagic symptoms in humans, with high fatality rates (5-30%). METHODS: Hyalomma ticks were collected from four different livestock herds (cattle and camels) in Mauritania in 2018. The tick species were determined morphologically and confirmed molecularly by using the cytochrome oxidase 1 gene marker. For the detection of CCHFV, ticks were tested individually by one-step multiplex real-time reverse-transcriptase quantitative polymerase chain reaction. The small segment of all positive samples was sequenced to determine the CCHFV genotype. RESULTS: In total, 39 of the 1523 ticks (2.56%) collected from 63 cattles and 28 camels tested positive for CCHFV. Three Hyalomma species were identified. Hyalomma rufipes had the largest proportion of positivity (5.67%; 16/282), followed by Hyalomma dromedarii (1.89%; 23/1214). No Hyalomma impeltatum tested positive (0%; 0/21). Positive ticks were found in only six out of 91 host animals. Viral sequence analysis revealed the presence of two different CCHFV lineages (Africa I and Africa III). CONCLUSIONS: In this study, 2.56% of Hyalomma ticks collected from camels and cattle in Mauritania tested positive for CCHFV. However, the true prevalence of CCHFV in unfed ticks may be lower, as a considerable number of ticks may have been passively infected during blood-feeding by co-feeding ticks or due to viremia of the host. The results indicate the need to track the actual area of circulation of this virus.

Serologic and molecular evidence for circulation of Crimean-Congo hemorrhagic fever virus in ticks and cattle in Zambia.

Crimean-Congo hemorrhagic fever (CCHF) is a tick-borne zoonosis with a high case fatality rate in humans. Although the disease is widely found in Africa, Europe, and Asia, the distribution and genetic diversity of CCHF virus (CCHFV) are poorly understood in African countries. To assess the risks of CCHF in Zambia, where CCHF has never been reported, epidemiologic studies in cattle and ticks were conducted. Through an indirect immunofluorescence assay, CCHFV nucleoprotein-specific serum IgG was detected in 8.4% (88/1,047) of cattle. Among 290 Hyalomma ticks, the principal vector of CCHFV, the viral genome was detected in 11 ticks. Phylogenetic analyses of the CCHFV S and M genome segments revealed that one of the detected viruses was a genetic reassortant between African and Asian strains. This study provides compelling evidence for the presence of CCHFV in Zambia and its transmission to vertebrate hosts.

Risk factors associated with exposure to Crimean-Congo haemorrhagic fever virus in animal workers and cattle, and molecular detection in ticks, South Africa.

Crimean-Congo haemorrhagic fever (CCHF) is a severe tick-borne viral zoonosis endemic to parts of Africa, Europe, the Middle East and Central Asia. Human cases are reported annually in South Africa, with a 25% case fatality rate since the first case was recognized in 1981. We investigated CCHF virus (CCHFV) seroprevalence and risk factors associated with infection in cattle and humans, and the presence of CCHFV in Hyalomma spp. ticks in central South Africa in 2017-18. CCHFV IgG seroprevalence was 74.2% (95%CI: 64.2-82.1%) in 700 cattle and 3.9% (95%CI: 2.6-5.8%) in 541 farm and wildlife workers. No veterinary personnel (117) or abattoir workers (382) were seropositive. The prevalence of CCHFV RNA was significantly higher in Hyalomma truncatum (1.6%) than in H. rufipes (0.2%) (P = 0.002). Seroprevalence in cattle increased with age and was greater in animals on which ticks were found. Seroprevalence in cattle also showed significant geographic variation. Seroprevalence in humans increased with age and was greater in workers who handled livestock for injection and collection of samples. Our findings support previous evidence of widespread high CCHFV seroprevalence in cattle and show significant occupational exposure amongst farm and wildlife workers. Our seroprevalence estimate suggests that CCHFV infections are five times more frequent than the 215 confirmed CCHF cases diagnosed in South Africa in the last four decades (1981-2019). With many cases undiagnosed, the potential seriousness of CCHF in people, and the lack of an effective vaccine or treatment, there is a need to improve public health awareness, prevention and disease control.

Crimean-Congo hemorrhagic fever virus antibody prevalence in Mauritanian livestock (cattle, goats, sheep and camels) is stratified by the animal's age.

Crimean-Congo hemorrhagic fever virus (CCHFV) is one of the most widespread zoonotic arthropod-borne viruses in many parts of Africa, Europe and Asia. It belongs to the family of Nairoviridae in the genus of Orthonairovirus. The main reservoir and vector are ticks of the genus Hyalomma. Livestock animals (such as cattle, small ruminants and camels) develop a viremias lasting up to two weeks with absence of clinical symptoms, followed by seroconversion. This study was carried out to assess risk factors that affect seroprevalence rates in different species. In total, 928 livestock animal samples (cattle = 201; sheep = 247; goats = 233; camels = 247) from 11 out of 13 regions in Mauritania were assayed for CCHFV-specific immunoglobulin G (IgG) antibodies using enzyme-linked immunosorbent assays (ELISA) (including a novel indirect camel-IgG-specific CCHFV ELISA). Inconclusive results were resolved by an immunofluorescence assay (IFA). A generalized linear mixed-effects model (GLMM) was used to draw conclusions about the impact of certain factors (age, species, sex and region) which might have influenced the CCHFV antibody status of surveyed animals. In goats and sheep, about 15% of the animals were seropositive, whereas in cattle (69%) and camels (81%), the prevalence rate was significantly higher. On average, cattle and camels were up to twice to four times older than small ruminants. Interestingly, the seroprevalence in all species was directly linked to the age of the animals, i.e. older animals had significantly higher seroprevalence rates than younger animals. The highest CCHFV seroprevalence in Mauritania was found in camels and cattle, followed by small ruminants. The large proportion of positive animals in cattle and camels might be explained by the high ages of the animals. Future CCHFV prevalence studies should at least consider the age of surveyed animals in order to avoid misinterpretations.

Update on prevalence and distribution pattern of tick-borne diseases among humans in India: a review.

In the present scenario, tick-borne diseases (TBDs) are well known for their negative impacts on humans as well as animal health in India. The reason lies in their increased incidences due to global warming, environmental and ecological changes, and availability of suitable habitats. On a global basis, they are now considered a serious threat to human as well as livestock health. The major tick-borne diseases in India include Kyasanur forest disease (KFD), Crimean-congo hemorrhagic fever (CCHF), Lyme disease (LD), Q fever (also known as coxiellosis), and Rickettsial infections. In recent years, other tick-borne diseases such as Babesiosis, Ganjam virus (GANV), and Bhanja virus (BHAV) infections have also been reported in India. The purpose of this paper is to review the history and the current state of knowledge of tick-borne diseases in the country. The conclusion of this review is extending the requirement of greater efforts in research and government management for the diagnosis and treatment and as well as prevention of these diseases so that tick-borne disease burden should be minimizing in India.

Evaluation of seroprevalence and clinical and laboratory findings of patients admitted to health institutions in Gümüshane with suspicion of Crimean-Congo hemorrhagic fever

Background/aim: To determine the seroprevalence and evaluate clinical findings and laboratory results of patients prediagnosed with Crimean-Congo hemorrhagic fever (CCHF) in Gümüshane. Materials and methods: Included in the cross-sectional study were 362 patients (162 female, 200 male) between 0 and 94 years of age, who were followed up after receiving a preliminary diagnosis of CCHF between January 2011 and December 2019. Anamnesis, age, sex, clinical findings, laboratory results, epidemiological and clinical evaluations, severity criteria, risk factor reviews, and a comparison of the suspected negative cases with positive cases were analyzed retrospectively. Patients included in the study were evaluated as RNA- positive by polymerase chain reaction (PCR) or IgM-positive by ELISA. Results: Of the 362 patients admitted to health institutions with a preliminary diagnosis of CCHF, 242 were diagnosed as CCHF- positive (66.9%). Moreover, 196 of those CCHF-positive patients (81%) were admitted to health institutions during the summer months. Statistical analyses revealed a significant relationship between the incidence of CCHF and patients who had been in contact with animals, lived in rural areas, and had engaged in farming and animal husbandry. In addition, fever, headache, diffuse bodily pain, nausea and vomiting, diarrhea, fever of 38 °C or higher, tachycardia, elevated ALT/AST, creatine kinase (CK), and lactate dehydrogenase (LDH) levels, leukopenia, and thrombocytopenia were detected in the CCHF-positive patients. Significant relations were found between this disease and these symptoms. However, there was no significant relationship between the statistical evaluation of the disease and bloody diarrhea, bodily bruises, rash, unconsciousness, gingival bleeding, hypotension, epistaxis, petechiae, splenomegaly, ecchymosis, hematuria, maculopapular rash, gastrointestinal system complaints, anemia, or elevation of the international normalized ratio and activated partial thromboplastin time duration, separately. Conclusion: Of the 362 patients, 66.9% (242) of those who received a preliminary diagnosis of CCHF were indeed CCHF-positive in Gümüshane. It was concluded that CCHF remains an important endemic disease in Gümüshane. In addition, elevated ALT/AST, CK, and LDH levels, leukopenia, and thrombocytopenia in patients presenting with headache, fever, fever of 38 °C or higher, generalized body pain, nausea/vomiting, diarrhea, and tachycardia will play a pivotal role in the preliminary diagnosis of CCHF.