Migration patterns and changes in population biology associated with the worldwide spread of the oilseed rape pathogen Leptosphaeria maculans.

Pathogen introductions into novel areas can lead to the emergence of new fungal diseases of plants. Understanding the origin, introduction pathways, possible changes in reproductive system and population size of fungal pathogens is essential in devising an integrated strategy for the control of these diseases. We used minisatellite markers to infer the worldwide invasion history of the fungal plant pathogen Leptosphaeria maculans, which causes stem canker (blackleg) of oilseed and vegetable brassicas. Clustering analyses partitioned genotypes into distinct populations corresponding to major geographic regions, along with two differentiated populations in Western Canada. Comparison of invasion scenarios using Approximate Bayesian Computation suggested an origin of the pathogen in the USA, the region where epidemics were first recorded, and independent introductions from there over the last few decades into Eastern Canada (Ontario), Europe and Australia. The population in Western Canada appeared to be founded from a source in Ontario and the population in Chile resulted from an admixture between multiple sources. A bottleneck was inferred for the introduction into Western Canada but not into Europe, Ontario or Australia. Clonality appeared high in Western Canada, possibly because environmental conditions there were less conducive to sexual reproduction. Leptosphaeria maculans is a model invasive pathogen with contrasting features in different regions: shallow population structure, high genetic variability and regular sexual recombination in some regions, by comparison with reduced genetic variability, high rates of asexual multiplication, strong population structure or admixture in others.

Occurrence of a new subclade of Leptosphaeria biglobosa in Western Australia.

Stem canker of crucifers is caused by an ascomycete species complex comprising of two main species, Leptosphaeria maculans and L. biglobosa. These are composed of at least seven distinct subclades based on biochemical data or on sequences of internal transcribed spacer (ITS), the mating type MAT1-2 or fragments of actin or beta-tubulin genes. In the course of a wide-scale characterization of the race structure of L. maculans from Western Australia, a few isolates from two locations failed to amplify specific sequences of L. maculans, i.e., the mating-type or minisatellite alleles. Based on both pathogenicity tests and ITS size, these isolates were classified as belonging to the L. biglobosa species. Parsimony and distance analyses performed on ITS, actin and beta-tubulin sequences revealed that these isolates formed a new L. biglobosa subclade, more related to the Canadian L. biglobosa 'canadensis' subclade than to the L. biglobosa 'australensis' isolates previously described in Australia (Victoria). They are termed here as L. biglobosa 'occiaustralensis'. These isolates were mainly recovered from resistant oilseed rape cultivars that included the Brassica rapa sp. sylvestris-derived resistance source, but not from the susceptible cv. Westar. The pathogenicity of L. biglobosa 'occiaustralensis' to cotyledons of most oilseed rape genotypes was higher than that of L. biglobosa 'canadensis' or L. biglobosa 'australensis' isolates.

Heterochromatin-like regions as ecological niches for avirulence genes in the Leptosphaeria maculans genome: map-based cloning of AvrLm6.

Map-based cloning of avirulence genes of the AvrLml-2-6 cluster was recently undertaken in Leptosphaeria maculans and led to the identification of AvrLm1. The ensuing chromosome walk toward AvrLm6 resulted in the delineation of a 562-kb bacterial artificial chromosome (BAC) clone contig in an avirulent isolate. Following sequencing of the contig and sequence comparison with a virulent isolate, four AvrLm6 candidate genes were identified. Complementation of the virulent isolate with the four candidates was performed and one gene was found to fully restore the avirulent phenotype on Rlm6 oilseed rape genotypes. AvrLm6 was found to be located in the same genome context as AvrLml, because it is a solo gene surrounded by 85 and 48 kb of degenerated repeats on its 5' and 3' sides, respectively. AvrLm6 is an orphan gene encoding a small, potentially secreted, cysteine-rich protein. Comparison of AvrLm1 and AvrLm6 expressions by quantitative reverse-transcription polymerase chain reaction revealed that both genes are highly overexpressed during primary leaf infection. Using RNA interference, decreasing expression of AvrLm6 was shown to result in virulence toward Rlm6 genotypes whenever the expression was reduced by more than 60% compared with the wild-type isolate.

Analysis of Leptosphaeria maculans Race Structure in a Worldwide Collection of Isolates.

ABSTRACT Leptosphaeria maculans, the causal agent of stem canker of oilseed rape, develops gene-for-gene interactions with its hosts. To date, eight L. maculans avirulence (Avr) genes, AvrLm1 to AvrLm8, have been genetically characterized. An additional Avr gene, AvrLm9, that interacts with the resistance gene Rlm9, was genetically characterized here following in vitro crosses of the pathogen. A worldwide collection of 63 isolates, including the International Blackleg of Crucifers Network collection, was genotyped at these nine Avr loci. In a first step, isolates were classified into pathogenicity groups (PGs) using two published differential sets. This analysis revealed geographical disparities as regards the proportion of each PG. Genotyping of isolates at all Avr loci confirmed the disparities between continents, in terms of Avr allele frequencies, particularly for AvrLm2, AvrLm3, AvrLm7, AvrLm8, and AvrLm9, or in terms of race structure, diversity, and complexity. Twenty-six distinct races were identified in the collection. A larger number of races (n = 18) was found in Australia than in Europe (n = 8). Mean number of virulence alleles per isolate was also higher in Australia (5.11 virulence alleles) than in Europe (4.33) and Canada (3.46). Due to the diversity of populations of L. maculans evidenced here at the race level, a new, open terminology is proposed for L. maculans race designation, indicating all Avr loci for which the isolate is avirulent.

Molecular characterisation and polymorphism of MinLm1, a minisatellite from the phytopathogenic ascomycete Leptosphaeria maculans.

A sequence-characterised amplified region marker was identified in the phytopathogenic fungus Leptosphaeria maculans, which generated a single-banding pattern corresponding to six alleles showing size polymorphism between L. maculans field isolates. The size polymorphism was due to 2-7 tandem repeats of the 23-bp motif 5' TCTTACTTACATACACACCTCCC 3'. The repeated sequence, termed MinLm1, shares many features specific to minisatellites, e.g. a very strong G/C strand asymmetry, the presence of 6-bp direct repeats at both ends of the sequence and its occurrence in a region rich in microsatellites such as (CT)n, (ATG)n, (GTG)n and (CAT)n. MinLm1 shows a very high degree of conservation of the bases from one repeat to another and from one isolate to another (percent match range: 99.6-100%), whatever their geographical or temporal relatedness. MinLm1 is a single-locus minisatellite located on chromosomes sized 2.79 Mb and 2.48 Mb, of L. maculans isolates a.2 and H5, respectively. In agricultural populations of L. maculans, two alleles of MinLm1 were prevalent, corresponding to 2x and 5x repeats of the core motif. Differences in allele frequencies were observed in some cropping conditions, suggesting that MinLm1 is an informative marker for epidemiological studies of the pathogen.