RESUMO
From a panel of monoclonal antibodies (MoAbs) directed against E. coli-derived native and denatured hepatitis B virus (HBV) core antigen we have selected a set of specific MoAbs which recognize different linear antigenic determinants: MoAb C1-5--cl epitope; MoAb 14K8--less immunogenic N-terminal region; and MoAbs 13C9, 10F10 and 14E11, 14G3--the immunodominant region between amino acids 134 and 140. We have applied the polymerase chain reaction technique to clone Ig VH and VL region genes, and appropriate full-length cDNA clones were obtained and characterized by nucleotide sequence analysis. Among the six heavy chain variable region sequences examined, three VH families were represented. Two of them belong to the 7183 (MoAb C1-5) and 3609 (14B8) families respectively and four, having only two amino acid changes in the CDR2 region, to the J558 family. These four probably are derived from a single expanded B-cell clone. The light chain sequences indicate that their VL are encoded by V kappa 21, V kappa 19 and V kappa 3 germline genes. Unlike VH genes, light chain genes are closely related to known representatives of mouse kappa light chain families and are employed also by MoAbs raised against other antigens.
Assuntos
Anticorpos Monoclonais/imunologia , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Cadeias Pesadas de Imunoglobulinas/química , Cadeias Leves de Imunoglobulina/química , Região Variável de Imunoglobulina/química , Sequência de Aminoácidos , Animais , Sequência de Bases , Células Clonais/imunologia , Genes de Imunoglobulinas , Cadeias Pesadas de Imunoglobulinas/genética , Cadeias Leves de Imunoglobulina/genética , Camundongos , Dados de Sequência Molecular , Estrutura Molecular , Reação em Cadeia da Polimerase/métodosRESUMO
Particulate and denatured core protein as well as e-antigen (HBe) of hepatitis B virus (HBV) differ in part immunologically but this has not been studied in sufficient detail. Therefore, in this study the B-cell immune response to native and denatured HBV core protein which both can exhibit HBe-specific epitopes was examined using a panel of mouse MABs and rabbit polyclonal antibodies to native and denatured core protein and polyclonal anti-HBe/anti-HBc antibodies from sera of infected patients. Epitope mapping was performed using a set of partially overlapping synthetic HBc peptides, carboxy-terminally truncated HBc proteins and various HBc fusion proteins. A major immunogenic region between amino acids 134-140 and two less immunogenic regions, one spanning amino acids 2-10 and one with three partially overlapping epitopes between amino acid positions 138 and 154, were defined by mouse MABs. Polyclonal rabbit antibodies to denatured HBc, woodchuck and ground squirrel hepatitis core proteins (WHc and GSHc) recognized similar epitopes but in addition occasionally region 61-85, and the latter was also recognized on particulate HBc. Two antigenic regions (amino acid positions 2-10 and 138-145) were found to be exposed on HBe from human serum, and were recognized by mouse anti-HBe but not by anti-HBc antibodies from sera of infected patients. This study demonstrates a more complex pattern of HBc and HBe epitopes than detected previously and provides tools to study conformational changes which may take place during HBc/HBe processing, transport and core particle assembly.
Assuntos
Anticorpos Monoclonais/imunologia , Epitopos/análise , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Antígenos E da Hepatite B/imunologia , Sequência de Aminoácidos , Animais , Sequência de Bases , Humanos , Camundongos , Camundongos Endogâmicos BALB C , Dados de Sequência Molecular , Conformação Proteica , Desnaturação Proteica , CoelhosRESUMO
A Gag protein segment of human immunodeficiency virus 1 (HIV-1) has been fused to a C terminally truncated core antigen of hepatitis B virus (HBcAg) using an E. coli expression system. Fusion of 90 amino acids of HIV-1 Gag protein to HBcAg still allowed the formation of capsids presenting on their surface epitopes of HIV-1 core protein, whereas fusion of 317, 189, or 100 amino acids of Gag prevented self-assembly of chimeric particles. Mice immunized with recombinant particles emulsified with Freund's complete adjuvant (CFA) or aluminium hydroxide developed high anti-HBcAg titers. However, anti-HIVp24 antibodies were detected only in mice inoculated with immunogen emulsified with CFA.
Assuntos
Anticorpos Anti-HIV/biossíntese , Proteína do Núcleo p24 do HIV/imunologia , Anticorpos Anti-Hepatite B/biossíntese , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Proteínas Recombinantes de Fusão/imunologia , Vacinas contra a AIDS/genética , Vacinas contra a AIDS/imunologia , Animais , Western Blotting , Epitopos/genética , Epitopos/imunologia , Escherichia coli/genética , Adjuvante de Freund , Proteína do Núcleo p24 do HIV/genética , HIV-1/genética , HIV-1/imunologia , Antígenos do Núcleo do Vírus da Hepatite B/genética , Vacinas contra Hepatite B , Vírus da Hepatite B/genética , Vírus da Hepatite B/imunologia , Humanos , Camundongos , Microscopia Eletrônica , Plasmídeos/genética , Proteínas Recombinantes de Fusão/genética , Proteínas Recombinantes de Fusão/ultraestrutura , Vacinas Sintéticas/genética , Vacinas Sintéticas/imunologia , Vacinas contra Hepatite Viral/genética , Vacinas contra Hepatite Viral/imunologiaRESUMO
We suggest a simple approach to localization of antigenic determinants for the monoclonal antibody 13B1 raised against recombinant human interleukin-2. The approach is based on the limited trypsin proteolysis, peptide separation by the O'Farrell method and identification of the peptides, interacting with monoclonal antibodies, and comparison of the charge and length of these peptides with the corresponding values of theoretically possible peptides.
Assuntos
Anticorpos Monoclonais , Epitopos/imunologia , Interleucina-2/imunologia , Sequência de Aminoácidos , Eletroforese em Gel de Poliacrilamida , Humanos , Focalização Isoelétrica , Dados de Sequência Molecular , Proteínas Recombinantes/imunologia , Tripsina/químicaRESUMO
Five different hybridoma clones secreting anti-HBeAg antibody were constructed by fusing cells of mouse myeloma line SP2/0 with splenocytes from BALB/c mice immunized with recombinant HBeAg. The monoclonal antibodies obtained were characterized immunologically and one was used to develop ELISA for detection of HBeAg and anti-HBeAg antibody. These monoclonal assays enabled the detection of 3 U HBeAg/ml and 1 U anti-HBeAg/ml with reference to standards of the Paul Ehrlich Institute, Frankfurt, F.R.G. Both assays compared well with a commercially available kit (Abbott Laboratory) and were used for detection of HBeAg and anti-HBeAg antibody in clinical serum samples.
Assuntos
Anticorpos Monoclonais/imunologia , Anticorpos Anti-Hepatite B/análise , Antígenos E da Hepatite B/imunologia , Vírus da Hepatite B/imunologia , Hepatite B/diagnóstico , Animais , Linhagem Celular , Antígenos de Superfície da Hepatite B/imunologia , Humanos , Hibridomas/imunologia , Camundongos , Camundongos Endogâmicos BALB C , Proteínas Recombinantes/imunologiaAssuntos
Capsídeo/genética , Genes Virais , Antígenos do Núcleo do Vírus da Hepatite B/genética , Peptídeos/genética , Anticorpos Monoclonais , Capsídeo/imunologia , Clonagem Molecular , Ensaio de Imunoadsorção Enzimática , Escherichia coli/genética , Expressão Gênica , Antígenos do Núcleo do Vírus da Hepatite B/química , Espectroscopia de Ressonância Magnética , Peptídeos/química , Peptídeos/imunologia , Recombinação GenéticaAssuntos
Capsídeo/genética , Epitopos/genética , Antígenos do Núcleo do Vírus da Hepatite B/genética , Proteínas Recombinantes/biossíntese , Capsídeo/imunologia , Quimera , Epitopos/imunologia , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Vacinas contra Hepatite B , Proteínas Recombinantes/genética , Proteínas Recombinantes/imunologia , Vacinas Sintéticas/imunologia , Vacinas contra Hepatite Viral/imunologiaRESUMO
Insertion of foreign oligopeptide sequences (40-50 amino acids in length) into the Pro144 position of hepatitis B core antigen (HBcAg) leads to the formation of chimeric capsids in Escherichia coli cells. These capsids are morphologically and immunologically similar to native HBcAg, but expose the inserted oligopeptides on their outer surface and exhibit antigenic and immunogenic characteristics of the latter. As a source of model antigenic determinants, the appropriate DNA copies excised from cloned viral genes such as the pre-S region of hepatitis B virus, the transmembrane protein gp41 of human immunodeficiency virus 1 and the envelope protein gp51 of bovine leukemia virus have been used. The localization of the inserted antigenic determinants on the surface of chimeric capsids does not depend on the presence or absence of the arginine-rich, 39 amino acid-long C terminus of HBcAg.
Assuntos
Antígenos Virais/genética , Antígenos da Hepatite B/genética , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Capsídeo/imunologia , DNA Recombinante , Epitopos , Genes Virais , Vetores Genéticos , Proteína gp41 do Envelope de HIV/genética , Proteína gp41 do Envelope de HIV/imunologia , Antígenos do Núcleo do Vírus da Hepatite B/genética , Vírus da Hepatite B/genética , Vírus da Hepatite B/imunologia , Vírus da Hepatite B/ultraestrutura , Imuno-Histoquímica , Vírus da Leucemia Bovina/genética , Vírus da Leucemia Bovina/imunologia , Dados de Sequência Molecular , Vacinas Sintéticas , Proteínas do Envelope Viral/genética , Proteínas do Envelope Viral/imunologiaRESUMO
We have cloned human interleukin-2 gene and sequenced its 1'-flanking region (-1940 to -936). The region contains promoter-like structures having a high degree of homology with the real promoter.
Assuntos
Interleucina-2/genética , Sequência de Bases , Clonagem Molecular , Humanos , Dados de Sequência Molecular , Regiões Promotoras Genéticas , Conformação Proteica , Mapeamento por RestriçãoRESUMO
Several nucleoside 5'-triphosphate analogs were investigated as inhibitors of human hepatitis B virus replication. Different analogs inhibited DNA synthesis differently, 3'-azido-2',3'-dideoxythymidine 5'triphosphate being the most active compound. This inhibitor blocked DNA synthesis by 50% at inhibitor: substrate molar ratio 1:8, and by 80% - at 1:1. The hypothesis is formulated that 3'-azido-2',3'-dideoxythymidine 5'-triphosphate inhibits RNA directed viral DNA replication due to incorporation of this compound into 3'-termini of newly synthesized DNA chains. The phenomenon observed opens new possibilities for chemotherapy of acute and chronic human hepatitis B.
Assuntos
Antivirais , Vírus da Hepatite B/fisiologia , Replicação Viral/efeitos dos fármacos , Zidovudina/farmacologia , Replicação do DNA/efeitos dos fármacos , DNA Viral/efeitos dos fármacos , Eletroforese em Gel de Ágar , HumanosRESUMO
In the present study, solid phase enzyme immunoassay utilizing antibodies against synthetic IL-2 peptides was used for quantitative measurements of human recombinant and lymphoid IL-2 preparations. The 27-peptide MCF-III-6 (Leu-Glu-His-Leu-Leu-Leu-Asp-Leu-Gln-Met-Ile-Leu-Asn-Gly-Ile-Asn-Asn-- Tyr-Lys-Asn-Pro-Lys-Leu-Thr-Arg-Met-Leu) that comprises the region 14-40 from the IL-2 amino acid sequence was synthesized and used for immunization of rabbits. Resulting anti-MCF-III-6 polyvalent rabbit antibodies reacted specifically in EIA up to dilution of 10(-7) with the MCF-III-6 peptide used for immunization as well as with 16-peptide I-16 (Cys-Nle-Gly-Ile-Asn-Asn-Tyr-Lys-Asn-Pro-Lys-Leu-Thr-Arg-Met-Leu) that comprises the region 27-40 from the IL-2 amino acid sequence. The anti-MCF-III-6 antibody reacted also with human recombinant IL-2 preparations obtained from three producers (Cetus, Riga and Amersham), to the concentration of 0.1 ng/ml, and with various human lymphoid IL-2 preparations. Direct correlation was observed between quantitative measurements of human lymphoid IL-2 by EIA and by CTLL bioassay. It can be concluded that utilization of synthetic IL-2 peptides provides a suitable and comparatively unexpensive immunogen for the production of IL-2 antibodies and that the solid phase EIA using such antibodies can be employed as a rapid, reproducible, and sensitive method for quantitative examination of both recombinant and lymphoid IL-2 preparations.
Assuntos
Técnicas Imunoenzimáticas , Interleucina-2/análise , Peptídeos/síntese química , Proteínas Recombinantes/imunologia , Sequência de Aminoácidos , Animais , Anticorpos/análise , Linhagem Celular , Humanos , Interleucina-2/imunologia , Ativação Linfocitária , Dados de Sequência Molecular , Peptídeos/imunologia , Coelhos , Linfócitos T/imunologiaRESUMO
Age-dependent decline of the anti-tumour efficacy of local IL-2 immunotherapy and chemoimmunotherapy utilizing human recombinant interleukin 2 and cyclophosphamide was investigated in B10 mice bearing syngeneic MC-induced sarcoma. Repeated peritumoral injections of rIL-2 substantially inhibited growth of transplantable MC-induced sarcomas in syngeneic young adult mice whereas no effect was observed in the aged mice. Chemoimmunotherapy of the MC-induced sarcomas in the young adult and in the aged mice treated with cyclophosphamide plus rIL-2 revealed that subthreshold doses of CY were capable of significantly potentiating the immunotherapeutic effect of rIL-2 in young adult mice but not in the aged mice.
Assuntos
Envelhecimento , Ciclofosfamida/uso terapêutico , Interleucina-2/uso terapêutico , Sarcoma Experimental/tratamento farmacológico , Animais , Humanos , Imunoterapia , Masculino , Metilcolantreno , Camundongos , Camundongos Endogâmicos C57BL , Proteínas Recombinantes/uso terapêutico , Sarcoma Experimental/induzido quimicamenteAssuntos
Escherichia coli/metabolismo , Iniciação Traducional da Cadeia Peptídica , Aminoacil-RNA de Transferência/metabolismo , RNA de Transferência de Metionina , Ribossomos/metabolismo , Moldes Genéticos , Sequência de Bases , Códon , Colífagos/genética , Escherichia coli/genética , Conformação de Ácido Nucleico , Aminoacil-RNA de Transferência/genéticaRESUMO
Four different hybridoma clones secreting anti-HBcAg antibodies were constructed by fusing cells of the mouse myeloma line SP2/0 with lymphocytes from mice immunized with bacterially produced HBcAg. The monoclonal antibodies were immunologically characterized and used for HBcAg detection by ELISA. This monoclonal-antibody-based assay was compared with ELISA based on polyclonal human anti-HBcAg IgG for sensitivity and specificity. The monoclonal antibody reacted specifically both with the bacterially produced HBcAg and HBcAg isolated from human liver, but did not react with HBeAg. The human polyclonal antibody reacted with HBcAg, but also with HBeAg.
Assuntos
Anticorpos Monoclonais , Antígenos do Núcleo do Vírus da Hepatite B/imunologia , Proteínas Recombinantes/imunologia , Animais , Anticorpos , Ensaio de Imunoadsorção Enzimática , Antígenos do Núcleo do Vírus da Hepatite B/análise , Antígenos do Núcleo do Vírus da Hepatite B/genética , Humanos , Hibridomas/imunologia , Fígado/imunologia , Camundongos , Camundongos Endogâmicos BALB C , PlasmídeosRESUMO
Affinity labelling of E. coli ribosomes with the 2',3'-O-[4-(N-2-chloroethyl)-N-methylamino]benzylidene derivative of AUGU6 was studied within the initiation complex (complex I) obtained by using fMet-tRNAMetf and initiation factors and within the pretranslocational complex (complex II) obtained by treatment of complex I with the ternary complex Phe-tRNAPhe.GTP.EF-Tu. Both proteins and rRNA of 30 S as well as 50 S subunits were found to be labelled. Sets of proteins labelled within complexes I and II differ considerably. Within complex II, proteins S13 and L10 were labelled preferentially. On the other hand, within complex I, multiple modification is observed (proteins S4, S12, S13, S14, S15, S18, S19, S20/L26 were found to be alkylated) despite the single fixation of a template in the ribosome by interaction of the AUG codon with fMet-tRNAMetf.
Assuntos
Marcadores de Afinidade/metabolismo , Códon , Escherichia coli/genética , Iniciação Traducional da Cadeia Peptídica , RNA Mensageiro , Ribossomos/metabolismo , Sítios de Ligação , Complexo II de Transporte de Elétrons , Escherichia coli/metabolismo , Guanosina Trifosfato/metabolismo , Complexos Multienzimáticos/metabolismo , Compostos de Mostarda , NAD(P)H Desidrogenase (Quinona) , Oxirredutases/metabolismo , Fator Tu de Elongação de Peptídeos/metabolismo , Quinona Redutases/metabolismo , RNA Mensageiro/metabolismo , Aminoacil-RNA de Transferência/metabolismo , Proteínas Ribossômicas/metabolismo , Succinato Desidrogenase/metabolismoRESUMO
Preparative RNA-ligase synthesis of decaribonucleotides, the 5'-and 3'-constituent parts to be used for the synthesis of 20-base polyribonucleotides] simulating minimal translation initiation regions for phage RNA was carried out. The decamers were obtained via appropriate heptamers also by RNA-ligase catalyzed synthesis. Apart from decamers used to prepare the functionally active 20-base polyribonucleotide, the minimal translation initiation region of the replicase gene (R) in MS2 and fr phage--sequence R(-17----3) and two its variants, decanucleotides for other template modification were also synthesized. Three 5'-terminal decamers were isolated and identified including the natural decamer ApApApCpApUpGpApGpG (-17----(-)8) and those with G(-9)----A(-9) and U(-12)----C(-12) nucleotide substitutions, as well as three 3'-terminal products differing from the natural region ApUpUpCpCpCpApUpG (-7----3) in MS2 RNA by U(-6)----A(-6), U(-6)U(-5)----A(-6)A(-5) and CCC----UUU (-3----(-)1) substitutions.
Assuntos
Oligorribonucleotídeos/biossíntese , Polinucleotídeo Ligases , Biossíntese de Proteínas , RNA Ligase (ATP) , RNA Mensageiro/biossíntese , Sequência de Bases , Colífagos/genética , Iniciação Traducional da Cadeia Peptídica , RNA Mensageiro/genética , RNA Viral/biossíntese , Moldes GenéticosRESUMO
2',3'-O-(4-[N-(2-chloroethyl)-N-methylamino]) benzylidene derivative of AUGU6 was used for identification of the proteins in the region of the mRNA-binding centre of E. coli ribosomes. This derivative alkylated ribosomes (preferentially 30S ribosomal) with high efficiency within the 70S initiation complex. In both 30S and 50S ribosomal subunits proteins and rRNA were modified. Specificity of the alkylation of ribosomal proteins and rRNA with the reagent was proved by the inhibitory action of AUGU6. Using the method of two-dimensional electrophoresis in polyacrylamide gel the proteins S4, S12, S13, S14, S15, S18, S19 and S20/L26 which are labelled by the analog of mRNA were identified.
Assuntos
Compostos de Benzilideno/farmacologia , Escherichia coli/metabolismo , Oligorribonucleotídeos/farmacologia , Iniciação Traducional da Cadeia Peptídica , RNA Bacteriano/metabolismo , RNA Mensageiro/metabolismo , Ribossomos/metabolismo , Alquilação , Compostos de Benzilideno/metabolismo , Sítios de Ligação , Eletroforese em Gel de Poliacrilamida , Oligorribonucleotídeos/metabolismo , Proteínas Ribossômicas/metabolismo , Fatores de TempoRESUMO
Three 20-base polyribonucleotides, AAACAUGAGGAAUACCCAUG (I), AAACAUGAGGAAAACCCAUG (II), AAACAUGAAGAAUACCCAUG (III), corresponding to the minimal initiation region for the replicase gene of phage MS2 and fr or having some differences were synthesized using enzymatic methods. The template activity of the synthesized polynucleotides in initiation and their capacity to bind phage coat protein were studied under conditions optimal for native mRNA. Polynucleotides I and II exhibit template activity comparable to that of the native phage RNA fragments. Polynucleotide III with the destroyed SD sequence dit not manifest any functional activity either as template or in binding to MS2 phage coat protein.
Assuntos
Genes , Iniciação Traducional da Cadeia Peptídica , Polirribonucleotídeos/metabolismo , RNA Nucleotidiltransferases/genética , Fagos RNA/genética , RNA Polimerase Dependente de RNA/genética , Sequência de Bases , Sítios de Ligação , Hidrólise , Polirribonucleotídeos/genética , Fagos RNA/enzimologia , Moldes GenéticosRESUMO
The entire genome of human hepatitis B virus (HBV) occurring in Latvia was sequenced. This sequence, which is 3182 nucleotides long, was compared with the other previously published HBV genomes and was shown to share maximum homology with HBV subtype ayw DNA. The coordinates of 4 main open reading frames as well as hairpin structures are very well conserved in the two genomes. The distribution of nucleotide substitutions among different HBV genomes suggest that the open reading frames P and X can fulfil a coding function. On the basis of primary structure comparison for hepadnaviral DNAs several evolutionary conclusions can be drawn.