The complete sequence of a brown algal mitochondrial genome, the ectocarpale Pylaiella littoralis (L.) Kjellm.

We describe here the complete sequence (58,507 bp) of the mitochondrial genome of the brown alga Pylaiella littoralis (Ectocarpales). This molecule displays an AT content of 62.0% and contains seventy-nine genes, most of them (73) encoded on one strand. They include the usual mitochondrial set of protist genes and a number of rarer genes. Among these, several ribosomal protein genes and the rn5 were identified. Twenty-four tRNA genes are present in this genome, insufficient to decode all genes. The other conspicuous features of this molecule are: a large (3018 nucleotides) in-frame insertion of unknown function in the cox2 gene; the presence of two different lineages of group II introns, including complete reverse transcriptase-like genes, one in the cox1 and the other in the rnl gene; the concomitant occurrence of a T7-like RNA polymerase and of several well-conserved alpha-proteobacterial-type promoters; and a small nad11 gene, coding for the first domain only of this NADH dehydrogenase subunit. Altogether, the mitochondrial genome of P. littoralis exhibits both alpha-proteobacterial characteristics and evidences of the independent integration of several exogenous DNA fragments.

The mitochondrial Pylaiella littoralis nad11 gene contains only the N-terminal FeS-binding domain.

We describe a nad11 gene located on the mitochondrial genome of the brown alga Pylaiella littoralis. This gene is cotranscribed with other neighbouring nad genes. It encodes the first domain only of the Nad11 polypeptide, i.e. a 23-kDa, FeS-binding domain instead of the usual 75/80-kDa protein found in the mitochondrial or alpha-proteobacterial complex I enzymes. The second domain of the protein, of unknown function, seems to be entirely missing in this alga. Cyanobacteria, beta-proteobacteria and actinomycetes also feature small homologous genes, known as hoxU, and it has been suggested that these could function in complex I of cyanobacteria. These observations indicate that complex I can probably function with the first domain only of the 75-kDa protein. P. littoralis represents the first such example within the alpha-proteobacterial/mitochondrial lineage.

The reverse-transcriptase-like proteins encoded by group II introns in the mitochondrial genome of the brown alga Pylaiella littoralis belong to two different lineages which apparently coevolved with the group II ribosyme lineages.

The mitochondrial genome of the brown alga Pylaiella littoralis contains two different types of group II introns. They each encode complete complex proteins, i.e., with a reverse transcriptase domain, a maturase or X domain, and an endonuclease or H-N-H/zinc finger domain. To our knowledge, this is the first example of the presence in the same genome of introns belonging to subgroups IIA and IIB which both contain multidomained RT-like proteins. We describe the group IIA introns that interrupt the cox1 gene. The RT-like proteins contained in these introns were compared to those of the LSU rDNA group IIB introns. The phylogenetic relationships of these intron ORFs were investigated and the possible evolution of group II introns is discussed.

A group II self-splicing intron from the brown alga Pylaiella littoralis is active at unusually low magnesium concentrations and forms populations of molecules with a uniform conformation.

We have investigated the reactivity of three of the seven group II introns encoded by the mitochondrial genome of the brown alga Pylaiella littoralis. While the first intron in the protein-coding cox1 gene could not be induced to self-splice under any of the conditions tested, the first two introns in the gene encoding the large ribosomal subunit are reactive in vitro and splice primarily by the standard group II two-step transesterification pathway. Intron 2 proved to be of exceptional interest, because in contrast to all group II molecules known so far, its optimal magnesium concentration is less than 10 mM and it still carries out accurate splicing at concentrations as low as 0.1 mM magnesium. Analysis of reaction products under optimal conditions showed no evidence of hydrolysis at the 5' splice site and up to 90% of precursor molecules could be converted into excised lariat intron, which migrated as a single band on non-denaturing polyacrylamide gels. Absorbance versus temperature profiles generated from the lariat form of intron 2 reveal the existence of an early melting component, the amplitude of which does not depend on the way the molecules were purified, i.e. with or without a denaturation step. This highly cooperative transition, whose position along the temperature axis changes with the concentration of magnesium, is proposed to consist of the unfolding of the tertiary structure of the molecule. We conclude that group II introns, which are the largest known ribozymes, can form conformationally homogeneous populations of molecules suitable for physical-chemical studies of higher-order structure.

The mitochondrial LSU rDNA of the brown alga Pylaiella littoralis reveals alpha-proteobacterial features and is split by four group IIB introns with an atypical phylogeny.

The mitochondrial DNA region coding for the large ribosomal RNA subunit from the brown alga Pylaiella littoralis (L.) Kjellm was sequenced. The LSU rRNA was folded into a secondary structure and aligned with homologous, mitochondrial and eubacterial sequences. Taking into account the primary and secondary structure levels, the mitochondrial LSU rRNA of P. littoralis shares more structural features with alpha-proteobacterial genes than do those of the green alga Prototheca wickerhamii and land plants. In phylogenetic trees, branches leading to brown algae, red algae, the protozoan Acanthamoeba castellanii and land plants, respectively, emerge approximately at the same time, as they do in nuclear-gene based phylogenies. This suggests that there is only one origin for the mitochondrial rRNA genes found in these lineages. The LSU rDNA is split by four group IIB introns. The first two introns each contain one open reading frame which encodes a reverse transcriptase-like protein. Comparison of their amino acid sequences with those of other reverse transcriptase-like genes contained in group II introns shows that these genes are more closely related to plastid and cyanobacterial homologous genes than to any known mitochondrial intronic reverse transcriptase.

Structural features and phylogeny of the actin gene of Chondrus crispus (Gigartinales, Rhodophyta).

We have characterized the cDNA and genomic sequences that encode actin from the multicellular red alga Chondrus crispus. Southern-blot analysis indicates that the C. crispus actin gene (ChAc) is present as a single copy. Northern analysis shows that, like the GapA gene, the actin gene is well expressed in gametophytes but weakly in protoplasts. Compared to actin genes of animals, fungi, green plants and oomycetes, that of C. crispus displays a higher evolutionary rate and does not show any of the amino-acid signatures characteristic of the other lineages. As previously described for GapA, ChAc is interrupted by a single intron at the beginning of the coding region. The site of initiation of transcription was characterized by RNAse protection. The promoter region displays a CAAT box but lacks a canonical TATA motif. Other noticeable features, such as a high content of pyrimidines as well as a 14-nt motif found in both the 5'-untranslated region and the intron, were observed.

Characterization of the single psbA gene of Prochlorococcus marinus CCMP 1375 (Prochlorophyta).

DNA sequence, copy number, expression and phylogenetic relevance of the psbA gene from the abundant marine prokaryote P. marinus CCMP 1375 was analyzed. The 7 amino acids near the C-terminus missing in higher plant and in Prochlorothrix hollandica D1 proteins are present in the derived amino acid sequence. P. marinus contains only a single psbA gene. Thus, this organism lacks the ability to adapt its photosystem II by replacement of one type of D1 by another, as several cyanobacteria do. Phylogenetic trees suggested the D1-1 iso-form from Synechococcus PCC 7942 as the next related D1 protein and place P. marinus separately from Prochlorothrix hollandica among the cyanobacteria.

Physical map and gene organization of the mitochondrial genome of Chondrus crispus (Rhodophyta, Gigartinales).

Organellar DNA, i.e. a mixture of plastid and mitochondrial DNAs, was purified from the rhodophyte Chondrus crispus and analysed with restriction endonucleases. Mitochondrial DNA fragments were identified by heterologous hybridization, cloned, mapped and partially sequenced. The mitochondrial genome of C. crispus consists of a 25.9 kb circular molecule on which twenty genes were localized. Compared with other plant mitochondrial genomes, C. crispus mitochondrial DNA appears as a relatively small molecule with a high coding capacity and a specific gene organization. The use of a modified genetic code and the absence of RNA editing, previously reported for the cox3 gene, is a general characteristic of the sequenced genes of this molecule. This is the first detailed description of a red algal mitochondrial genome.

Secondary structure and phylogeny of the chloroplast 23S rRNA gene from the brown alga Pylaiella littoralis.

The entire nucleotide sequence of a 23S rRNA gene from the brown alga Pylaiella littoralis (L.) Kjellm has been determined. The predicted length of the 23S rRNA is 2948 nucleotides, including the 4.5S rRNA-like region at the 3' end of the molecule. The putative transcript has been folded into a secondary structure by comparison to existing structure models, and the predicted helical regions were inspected by identifying compensatory downstream base changes. The 23S rRNA secondary structure presented here has features that are unique to P. littoralis (no other chromophyte or red algal 23S rRNA sequences are yet available), but has none of the features specific to the chloroplast rRNAs of green plants and green algae. The Pylaiella sequence was aligned with analogous plastidial and eubacterial gene sequences, and the alignment was used to construct a phylogenetic tree. The plastidial sequences formed a coherent cluster closely associated with the 23S rRNA of the cyanobacterium Anacystis nidulans. Within the plastid group, the P. littoralis sequence was most closely related to that of Euglena gracilis confirming earlier analyses based upon 16S rRNA sequences.

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Plastid genomes of the Rhodophyta and Chromophyta constitute a distinct lineage which differs from that of the Chlorophyta and have a composite phylogenetic origin, perhaps like that of the Euglenophyta.

A phylogenetic tree has been constructed from comparisons of entire 16S rRNA gene sequences from different prokaryotes and from several algal plastids. According to this study, and to previous work on the ribulose-1,5-bisphosphate carboxylase oxygenase (Rubisco) large and small subunit genes, we postulate that: (1) rhodophyte and chromophyte plastid genomes have a common, composite phylogenetic origin which implies at least two different ancestors, a cyanobacterial and a beta-proteobacterial ancestor; (2) chlorophyte (green algae and land plants) plastids have a cyanobacterial ancestor which probably differs from that of rhodophyte and chromophyte plastids, and in any case constitute a different lineage; (3) euglenophyte plastid genomes also seem to have a composite phylogenetic origin which involves two different lineages.

Evolution of the Rubisco operon from prokaryotes to algae: structure and analysis of the rbcS gene of the brown alga Pylaiella littoralis.

The rbcS gene coding for the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) of the brown alga Pylaiella littoralis is located within the plastid genome and is transcribed as a single polycistronic mRNA with the gene for the large subunit of Rubisco, rbcL. The structure of the Rubisco operon from P. littoralis was determined. Molecular phylogenies for rbcS and rbcL with a wide range of prokaryotes and eukaryotes were constructed which are congruent with recent evidence for polyphyletic plastid origins. Both rbcL and rbcS of the beta-purple bacterium Alcaligenes eutrophus clearly cluster with the rhodophyte and chromophyte proteins. The data suggest that the Rubisco operons of red algal and chromophytic plastids derive from beta-purple eubacterial antecedents, rather than the cyanobacterial lineage of eubacteria from which other of their genes derive. This implies a lateral transfer of Rubisco genes from beta-purple eubacterial ancestors to the cyanobacterial ancestor of rhodophyte and chromophyte plastids.

Evidence for a composite phylogenetic origin of the plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm.

The nucleotide sequence and the 5' flanking region of the rbcL gene coding for the large subunit of ribulose bisphosphate-1,5-carboxylase/oxygenase of Pylaiella littoralis, a brown alga, has been determined and the deduced amino-acid sequence has been compared to those of various photosynthetic and chemoautotrophic Eubacteria, of a red alga and of green plastids (Euglena gracilis, green algae and higher plants). Unlike the rbcL genes of green plastids which are more closely related to those of cyanobacteria, the P. littoralis rbcL gene is more closely related to that of a beta-purple bacterium, as was found for the rbcS gene of another chromophytic alga [Boczar et al., Proc Natl Acad Sci USA 86: 4996-4999, 1989]. Matrix data of homology between the rbcL gene of P. littoralis and the same gene of other organisms are presented. Based on our previous report, the gene coding for the 16S rRNA from P. littoralis is closely related to that of E. gracilis (Markowicz et al., Curr Genet 14: 599-608, 1988). We suggest that the large plastid DNA molecule of P. littoralis is a phylogenetically composite genome which probably resulted from mixed endosymbiosis events, or from a horizontal transfer of DNA.

Presence of a 16S rRNA pseudogene in the bi-molecular plastid genome of the primitive brown alga Pylaiella littoralis. Evolutionary implications.

The plastid genome of the brown alga Pylaiella littoralis (L.) Kjellm. is composed of two different circular DNA molecules: the largest carries two rrn operons, and the smallest, only one copy of both 16S and 23S rDNAs. 16S rDNA copies located on both molecules have been cloned and their nucleotide sequences determined: they are 65% homologous to one another. The expression of these genes was assayed by hybridizing in vivo labelled P. littoralis rRNAs to both clones, and specific oligonucleotides to total RNA from P. littoralis. Results indicate that the 16S rDNA copy located on the small molecule is a pseudogene. Comparisons of the functional gene with other 16S rRNA genes shows that chloroplasts from green plants emerged earlier from the cyanobacterial lineage than Euglena gracilis and Pylaiella littoralis plastids.