Genetic loss of importin α4 causes abnormal sperm morphology and impacts on male fertility in mouse.

Importin α proteins play a central role in the transport of cargo from the cytoplasm to the nucleus. In this study, we observed that male knock-out mice for importin α4, which is encoded by the Kpna4 gene (Kpna4-/- ), were subfertile and yielded smaller litter sizes than those of wild-type (WT) males. In contrast, mice lacking the closely related importin α3 (Kpna3-/- ) were fertile. In vitro fertilization and sperm motility assays demonstrated that sperm from Kpna4-/- mice had significantly reduced quality and motility. In addition, acrosome reaction was also impaired in Kpna4-/- mice. Transmission electron microscopy revealed striking defects, including abnormal head morphology and multiple axoneme structures in the flagella of Kpna4-/- mice. A five-fold increase in the frequency of abnormalities in Kpna4-/- mice compared to WT mice indicates the functional importance of importin α4 in normal sperm development. Moreover, Nesprin-2, which is a component of the linker of nucleus and cytoskeleton complex, was expressed at lower levels in sperm from Kpna4-/- mice and was localized with abnormal axonemes, suggesting incorrect formation of the nuclear membrane-cytoskeleton structure during spermiogenesis. Proteomics analysis of Kpna4-/- testis showed significantly altered expression of proteins related to sperm formation, which provided evidence that genetic loss of importin α4 perturbed chromatin status. Collectively, these findings indicate that importin α4 is critical for establishing normal sperm morphology in mice, providing new insights into male germ cell development by highlighting the requirement of importin α4 for normal fertility.

Efficacy of a recombinant single-chain fragment variable region, VasSF, as a new drug for vasculitis.

BACKGROUND: Anti-neutrophil cytoplasmic autoantibodies (ANCA) associated vasculitis is a pauci-immune disease with the inflammation of the small blood vessels. The efficacies of antibody drugs for induction therapies of vasculitis vary among cases. Here, we developed a novel clone of a single chain Fv region (ScFv) with vasculitis-specific therapeutic potential. MATERIALS AND METHODS: The clone, termed VasSF, was selected from our Escherichia coli expression library of recombinant human ScFv based on the therapeutic efficacy in an SCG/Kj mouse model of MPO-ANCA-associated vasculitis (MAAV), such as improvement of the urinary score and decreased crescent formation in glomeruli, granulomatous in lung, MPO-ANCA biomarkers, the anti-moesin antibody, and some cytokine levels. RESULTS: We identified vasculitis-associated apolipoprotein A-II (VAP2) as a target molecule of the clone and confirmed the independently-established VAP2 antibodies were also therapeutic in SCG/Kj mice. In MAAV, MPO-ANCA and cytokines stimulate neutrophils by facilitating heterodimer formation of VAP2 with apolipoprotein A-I in HDL. CONCLUSION: VasSF would constitute a novel antibody drug for vasculitis by suppressing the heterodimer formation of the apolipoproteins.

Salt-inducible kinase 3 regulates the mammalian circadian clock by destabilizing PER2 protein.

Salt-inducible kinase 3 (SIK3) plays a crucial role in various aspects of metabolism. In the course of investigating metabolic defects in Sik3-deficient mice (Sik3-/-), we observed that circadian rhythmicity of the metabolisms was phase-delayed. Sik3-/- mice also exhibited other circadian abnormalities, including lengthening of the period, impaired entrainment to the light-dark cycle, phase variation in locomotor activities, and aberrant physiological rhythms. Ex vivo suprachiasmatic nucleus slices from Sik3-/- mice exhibited destabilized and desynchronized molecular rhythms among individual neurons. In cultured cells, Sik3-knockdown resulted in abnormal bioluminescence rhythms. Expression levels of PER2, a clock protein, were elevated in Sik3-knockdown cells but down-regulated in Sik3-overexpressing cells, which could be attributed to a phosphorylation-dependent decrease in PER2 protein stability. This was further confirmed by PER2 accumulation in the Sik3-/- fibroblasts and liver. Collectively, SIK3 plays key roles in circadian rhythms by facilitating phosphorylation-dependent PER2 destabilization, either directly or indirectly.

The effect of supplementation of amino acids and taurine to modified KSOM culture medium on rat embryo development.

The rat is widely used as a laboratory animal for research. In particular, genetically engineered rats are essential for production of animal models of several diseases. Although embryo manipulation techniques are needed to produce them, such technology for rat preimplantation embryos is not as advanced as it is for mouse embryos. One reason is that in vitro culture systems for preimplantation embryos are limited in rats. Therefore, we intended to develop a new culture system for rat preimplantation embryos focusing on supplementation of amino acids as nutrition to the culture media. First, we found that taurine, glycine, glutamate, and alanine were abundant in the oviductal fluid of Wistar rats. The profile of taurine and these three amino acids was unchanged during the estrous cycle and from Days 0 to 3 of pregnancy (Day 0; vaginal plug was confirmed). Second, we assessed the effect of phosphate and phenol red on the development of rat zygotes and confirmed that they caused two-cell block. Third, we examined the effect of changing the medium on zygote development because addition of amino acids into culture medium causes ammonium accumulation, which is detrimental to embryo development. Blastocyst formation was suppressed in cultures with no medium change (P = 0.004; decreased to approximately one-fourth of that with medium change). Fourth, we examined the effect of supplementation of these three amino acids and taurine to modified potassium simplex optimized medium (KSOM). The zygote development rates were increased by the three amino acids and taurine in a concentration-dependent manner at 48, 72, and 96 hours (P = 0.001, 0.005, and 0.009, respectively) in culture. Finally, we confirmed that blastocysts cultured in modified KSOM had the capacity to develop to full term after implantation. These results showed that not only the supply of nutrients but also removal of wastes and toxicants is important for culture of rat preimplantation embryos.

FAM83H and casein kinase I regulate the organization of the keratin cytoskeleton and formation of desmosomes.

FAM83H is essential for the formation of dental enamel because a mutation in the FAM83H gene causes amelogenesis imperfecta (AI). We previously reported that the overexpression of FAM83H often occurs and disorganizes the keratin cytoskeleton in colorectal cancer cells. We herein show that FAM83H regulates the organization of the keratin cytoskeleton and maintains the formation of desmosomes in ameloblastoma cells. FAM83H is expressed and localized on keratin filaments in human ameloblastoma cell lines and in mouse ameloblasts and epidermal germinative cells in vivo. FAM83H shows preferential localization to keratin filaments around the nucleus that often extend to cell-cell junctions. Alterations in the function of FAM83H by its overexpression, knockdown, or an AI-causing truncated mutant prevent the proper organization of the keratin cytoskeleton in ameloblastoma cells. Furthermore, the AI-causing mutant prevents desmosomal proteins from being localized to cell-cell junctions. The effects of the AI-causing mutant depend on its binding to and possible inhibition of casein kinase I (CK-1). The suppression of CK-1 by its inhibitor, D4476, disorganizes the keratin cytoskeleton. Our results suggest that AI caused by the FAM83H mutation is mediated by the disorganization of the keratin cytoskeleton and subsequent disruption of desmosomes in ameloblasts.

Phosphorylation of 4EBP by oral leucine administration was suppressed in the skeletal muscle of PGC-1α knockout mice.

Leucine is known to increase mTOR-mediated phosphorylation of 4EBP. In this study, leucine was administered to skeletal muscle-PGC-1α knockout mice. We observed attenuated 4EBP phosphorylation in the skeletal muscle, but not in the liver, of the PGC-1α knockout mice. These data suggest that skeletal muscle-PGC-1α is important for leucine-mediated mTOR activation and protein biosynthesis.

PGC-1α-mediated changes in phospholipid profiles of exercise-trained skeletal muscle.

Exercise training influences phospholipid fatty acid composition in skeletal muscle and these changes are associated with physiological phenotypes; however, the molecular mechanism of this influence on compositional changes is poorly understood. Peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), a nuclear receptor coactivator, promotes mitochondrial biogenesis, the fiber-type switch to oxidative fibers, and angiogenesis in skeletal muscle. Because exercise training induces these adaptations, together with increased PGC-1α, PGC-1α may contribute to the exercise-mediated change in phospholipid fatty acid composition. To determine the role of PGC-1α, we performed lipidomic analyses of skeletal muscle from genetically modified mice that overexpress PGC-1α in skeletal muscle or that carry KO alleles of PGC-1α. We found that PGC-1α affected lipid profiles in skeletal muscle and increased several phospholipid species in glycolytic muscle, namely phosphatidylcholine (PC) (18:0/22:6) and phosphatidylethanolamine (PE) (18:0/22:6). We also found that exercise training increased PC (18:0/22:6) and PE (18:0/22:6) in glycolytic muscle and that PGC-1α was required for these alterations. Because phospholipid fatty acid composition influences cell permeability and receptor stability at the cell membrane, these phospholipids may contribute to exercise training-mediated functional changes in the skeletal muscle.

Altered Actions of Memantine and NMDA-Induced Currents in a New Grid2-Deleted Mouse Line.

Memantine is a non-competitive antagonist of the N-methyl-D-aspartate (NMDA) receptor, and is an approved drug for the treatment of moderate-to-severe Alzheimer's disease. We identified a mouse strain with a naturally occurring mutation and an ataxic phenotype that presents with severe leg cramps. To investigate the phenotypes of these mutant mice, we screened several phenotype-modulating drugs and found that memantine (10 mg/kg) disrupted the sense of balance in the mutants. Moreover, the mutant mice showed an attenuated optokinetic response (OKR) and impaired OKR learning, which was also observed in wild-type mice treated with memantine. Microsatellite analyses indicated that the Grid2 gene-deletion is responsible for these phenotypes. Patch-clamp analysis showed a relatively small change in NMDA-dependent current in cultured granule cells from Grid2 gene-deleted mice, suggesting that GRID2 is important for correct NMDA receptor function. In general, NMDA receptors are activated after the activation of non-NMDA receptors, such as AMPA receptors, and AMPA receptor dysregulation also occurs in Grid2 mutant mice. Indeed, the AMPA treatment enhanced memantine susceptibility in wild-type mice, which was indicated by balance sense and OKR impairments. The present study explores a new role for GRID2 and highlights the adverse effects of memantine in different genetic backgrounds.

A new mouse allele of glutamate receptor delta 2 with cerebellar atrophy and progressive ataxia.

Spinocerebellar degenerations (SCDs) are a large class of sporadic or hereditary neurodegenerative disorders characterized by progressive motion defects and degenerative changes in the cerebellum and other parts of the CNS. Here we report the identification and establishment from a C57BL/6J mouse colony of a novel mouse line developing spontaneous progressive ataxia, which we refer to as ts3. Frequency of the phenotypic expression was consistent with an autosomal recessive Mendelian trait of inheritance, suggesting that a single gene mutation is responsible for the ataxic phenotype of this line. The onset of ataxia was observed at about three weeks of age, which slowly progressed until the hind limbs became entirely paralyzed in many cases. Micro-MRI study revealed significant cerebellar atrophy in all the ataxic mice, although individual variations were observed. Detailed histological analyses demonstrated significant atrophy of the anterior folia with reduced granule cells (GC) and abnormal morphology of cerebellar Purkinje cells (PC). Study by ultra-high voltage electron microscopy (UHVEM) further indicated aberrant morphology of PC dendrites and their spines, suggesting both morphological and functional abnormalities of the PC in the mutants. Immunohistochemical studies also revealed defects in parallel fiber (PF)-PC synapse formation and abnormal distal extension of climbing fibers (CF). Based on the phenotypic similarities of the ts3 mutant with other known ataxic mutants, we performed immunohistological analyses and found that expression levels of two genes and their products, glutamate receptor delta2 (grid2) and its ligand, cerebellin1 (Cbln1), are significantly reduced or undetectable. Finally, we sequenced the candidate genes and detected a large deletion in the coding region of the grid2 gene. Our present study suggests that ts3 is a new allele of the grid2 gene, which causes similar but different phenotypes as compared to other grid2 mutants.

A symptomatic Fabry disease mouse model generated by inducing globotriaosylceramide synthesis.

Fabry disease is a lysosomal storage disorder in which neutral glycosphingolipids, predominantly Gb3 (globotriaosylceramide), accumulate due to deficient α-Gal A (α-galactosidase A) activity. The GLAko (α-Gal A-knockout) mouse has been used as a model for Fabry disease, but it does not have any symptomatic abnormalities. In the present study, we generated a symptomatic mouse model (G3Stg/GLAko) by cross-breeding GLAko mice with transgenic mice expressing human Gb3 synthase. G3Stg/GLAko mice had high Gb3 levels in major organs, and their serum Gb3 level at 5-25 weeks of age was 6-10-fold higher than that in GLAko mice of the same age. G3Stg/GLAko mice showed progressive renal impairment, with albuminuria at 3 weeks of age, decreased urine osmolality at 5 weeks, polyuria at 10 weeks and increased blood urea nitrogen at 15 weeks. The urine volume and urinary albumin concentration were significantly reduced in the G3Stg/GLAko mice when human recombinant α-Gal A was administered intravenously. These data suggest that Gb3 accumulation is a primary pathogenic factor in the symptomatic phenotype of G3Stg/GLAko mice, and that this mouse line is suitable for studying the pathogenesis of Fabry disease and for preclinical studies of candidate therapies.

Zygosity determination in hairless mice by PCR based on Hr(hr) gene analysis.

We analyzed the Hr gene of a hairless mouse strain of unknown origin (HR strain, http://animal.nibio.go.jp/e_hr.html) to determine whether the strain shares a mutation with other hairless strains, such as HRS/J and Skh:HR-1, both of which have an Hr(hr) allele. Using PCR with multiple pairs of primers designed to amplify multiple overlapping regions covering the entire Hr gene, we found an insertion mutation in intron 6 of mutant Hr genes in HR mice. The DNA sequence flanking the mutation indicated that the mutation in HR mice was the same as that of Hr(hr) in the HRS/J strain. Based on the sequence, we developed a genotyping method using PCR to determine zygosities. Three primers were designed: S776 (GGTCTCGCTGGTCCTTGA), S607 (TCTGGAACCAGAGTGACAGACAGCTA), and R850 (TGGGCCACCATGGCCAGATTTAACACA). The S776 and R850 primers detected the Hr(hr) allele (275-bp amplicon), and S607 and R850 identified the wild-type Hr allele (244-bp amplicon). Applying PCR using these three primers, we confirmed that it is possible to differentiate among homozygous Hr(hr) (longer amplicons only), homozygous wild-type Hr(shorter amplicons only), and heterozygous (both amplicons) in HR and Hos:HR-1 mice. Our genomic analysis indicated that the HR, HRS/J, and Hos:HR-1 strains, and possibly Skh:HR-1 (an ancestor of Hos:HR-1) strain share the same Hr(hr) gene mutation. Our genotyping method will facilitate further research using hairless mice, and especially immature mice, because pups can be genotyped before their phenotype (hair coat loss) appears at about 2 weeks of age.

Blockade of sarcolemmal TRPV2 accumulation inhibits progression of dilated cardiomyopathy.

AIMS: Dilated cardiomyopathy (DCM) is a severe disorder defined by ventricular dilation and contractile dysfunction. Abnormal Ca(2+) handling is hypothesized to play a critical pathological role in DCM progression. The transient receptor potential vanilloid 2 (TRPV2) has been previously suggested as a candidate pathway for enhanced Ca(2+) entry. Here, we examined the sarcolemmal accumulation of TRPV2 in various heart-failure model animals and DCM patients, and assessed whether presently available inhibitory tools against TRPV2 ameliorate DCM symptoms. METHODS AND RESULTS: Immunological and cell physiological analyses revealed that TRPV2 is highly concentrated and activated in the ventricular sarcolemma of DCM patients and three animal models-δ-sarcoglycan-deficient hamsters (J2N-k), transgenic mice over-expressing sialytransferase (4C30), and doxorubicin (DOX)-induced DCM mice. Over-expression of the amino-terminal (NT) domain of TRPV2 could block the plasma membrane accumulation and influx of Ca(2+) via TRPV2. Transgenic (Tg) or adenoviral expression of the NT domain in DCM animals caused effective removal of sarcolemmal TRPV2 along with reduction in the phosphorylation of calmodulin-dependent protein kinase II (CaMKII) and reactive oxygen species (ROS) production, which were activated in DCM; further, it prevented ventricular dilation and fibrosis, ameliorated contractile dysfunction in DCM, and improved survival of the affected animals. The TRPV2 inhibitor tranilast markedly suppressed DCM progression. CONCLUSION: Sarcolemmal TRPV2 accumulation appears to have considerable pathological impact on DCM progression, and blockade of this channel may be a promising therapeutic strategy for treating advanced heart failure.

Involvement of SIK3 in glucose and lipid homeostasis in mice.

Salt-inducible kinase 3 (SIK3), an AMP-activated protein kinase-related kinase, is induced in the murine liver after the consumption of a diet rich in fat, sucrose, and cholesterol. To examine whether SIK3 can modulate glucose and lipid metabolism in the liver, we analyzed phenotypes of SIK3-deficent mice. Sik3(-/-) mice have a malnourished the phenotype (i.e., lipodystrophy, hypolipidemia, hypoglycemia, and hyper-insulin sensitivity) accompanied by cholestasis and cholelithiasis. The hypoglycemic and hyper-insulin-sensitive phenotypes may be due to reduced energy storage, which is represented by the low expression levels of mRNA for components of the fatty acid synthesis pathways in the liver. The biliary disorders in Sik3(-/-) mice are associated with the dysregulation of gene expression programs that respond to nutritional stresses and are probably regulated by nuclear receptors. Retinoic acid plays a role in cholesterol and bile acid homeostasis, wheras ALDH1a which produces retinoic acid, is expressed at low levels in Sik3(-/-) mice. Lipid metabolism disorders in Sik3(-/-) mice are ameliorated by the treatment with 9-cis-retinoic acid. In conclusion, SIK3 is a novel energy regulator that modulates cholesterol and bile acid metabolism by coupling with retinoid metabolism, and may alter the size of energy storage in mice.

Therapeutic chaperone effect of N-octyl 4-epi-ß-valienamine on murine G(M1)-gangliosidosis.

Therapeutic chaperone effect of a valienamine derivative N-octyl 4-epi-ß-valienamine (NOEV) was studied in G(M1)-gangliosidosis model mice. Phamacokinetic analysis revealed rapid intestinal absorption and renal excretion after oral administration. Intracellular accumulation was not observed after continuous treatment. NOEV was delivered to the central nervous system through the blood-brain barrier to induce high expression of the apparently deficient ß-galactosidase activity. NOEV treatment starting at the early stage of disease resulted in remarkable arrest of neurological progression within a few months. Survival time was significantly prolonged. This result suggests that NOEV chaperone therapy will be clinically effective for prevention of neuronal damage if started early in life hopefully also in human patients with G(M1)-gangliosidosis.

Adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy.

Sugar chain abnormalities in glycolipids and glycoproteins are associated with various diseases. Here, we report an adult onset cardiac dilatation in a transgenic mouse line with Galß1,3GalNAc α2,3-sialyltransferase II (ST3Gal-II) transgenes. The transgenic hearts at the end-stage, at around 7 months old, were enlarged, with enlarged cavities and thin, low-tensile walls, typical of dilated cardiomyopathy. Although no apparent change was found in heart gangliosides, glycosylation of heart proteins was altered. Interestingly, sugar moieties not directly related to the ST3Gal-II catalytic reaction were also changed. Significant increases in calreticulin and calnexin were observed in hearts of the transgenic mice. These results suggest that expression of ST3Gal-II transgenes induces abnormal protein glycosylation, which disorganizes the endoplasmic/sarcoplasmic reticulum quality control system and elevates the calreticulin/calnexin level, resulting in suppression of cardiac function. The transgenic mice showed 100% incidence of adult onset cardiac dilatation, suggesting great potential as a new model for dilated cardiomyopathy.

Dynamic replacement of histone H3 variants reprograms epigenetic marks in early mouse embryos.

Upon fertilization, reprogramming of gene expression is required for embryo development. This step is marked by DNA demethylation and changes in histone variant composition. However, little is known about the molecular mechanisms causing these changes and their impact on histone modifications. We examined the global deposition of the DNA replication-dependent histone H3.1 and H3.2 variants and the DNA replication-independent H3.3 variant after fertilization in mice. We showed that H3.3, a euchromatic marker of gene activity, transiently disappears from the maternal genome, suggesting erasure of the oocyte-specific modifications carried by H3.3. After fertilization, H3.2 is incorporated into the transcriptionally silent heterochromatin, whereas H3.1 and H3.3 occupy unusual heterochromatic and euchromatin locations, respectively. After the two-cell stage, H3.1 and H3.3 variants resume their usual respective locations on heterochromatin and euchromatin. Preventing the incorporation of H3.1 and H3.2 by knockdown of the histone chaperone CAF-1 induces a reciprocal increase in H3.3 deposition and impairs heterochromatin formation. We propose that the deposition of different H3 variants influences the functional organization of chromatin. Taken together, these findings suggest that dynamic changes in the deposition of H3 variants are critical for chromatin reorganization during epigenetic reprogramming.

Lysosomal accumulation of Trk protein in brain of GM1 -gangliosidosis mouse and its restoration by chemical chaperone.

G(M1) -gangliosidosis is a fatal neurodegenerative disorder caused by deficiency of lysosomal acid ß-galactosidase (ß-gal). Accumulation of its substrate ganglioside G(M1) (G(M1) ) in lysosomes and other parts of the cell leads to progressive neurodegeneration, but underlying mechanisms remain unclear. Previous studies demonstrated an essential role for interaction of G(M1) with tropomyosin receptor kinase (Trk) receptors in neuronal growth, survival and differentiation. In this study we demonstrate accumulation of G(M1) in the cell-surface rafts and lysosomes of the ß-gal knockout (ß-gal-/-) mouse brain association with accumulation of Trk receptors and enhancement of its downstream signaling. Immunofluorescence and subcellular fractionation analysis revealed accumulation of Trk receptors in the late endosomes/lysosomes of the ß-gal-/- mouse brain and their association with ubiquitin and p62. Administration of a chemical chaperone to ß-gal-/- mouse expressing human mutant R201C protein resulted in a marked reduction of intracellular storage of G(M1) and phosphorylated Trk. These findings indicate that G(M1) accumulation in rafts causes activation of Trk signaling, which may participate in the pathogenesis of G(M1) -gangliosidosis.

Use of sample mixtures for standard curve creation in quantitative western blots.

For accurate protein quantification when using quantitative western blot analysis with chemiluminescence reagents, standard curves are needed because of the narrow quantifiable ranges. However, they are often difficult to obtain because authentic proteins are not always available. Here we present our original and convenient method using a sample mixture as a scale to create standard curves. This method allowed us to determine the quantifiable range of target and loading control proteins, making quantitative comparisons among independent blots more reproducible. Our results indicate that using a sample mixture to create standard curves is a practical method that guarantees the accuracy and reproducibility of quantitative western blot analysis.

Chemical chaperone therapy: chaperone effect on mutant enzyme and cellular pathophysiology in ß-galactosidase deficiency.

ß-Galactosidase deficiency is a group of lysosomal lipid storage disorders with an autosomal recessive trait. It causes two clinically different diseases, G(M1) -gangliosidosis and Morquio B disease. It is caused by heterogeneous mutations in the GLB1 gene coding for the lysosomal acid ß-galactosidase. We have previously reported the chaperone effect of N-octyl-4-epi-ß-valienamine (NOEV) on mutant ß-galactosidase proteins. In this study, we performed genotype analyses of patients with ß-galactosidase deficiency and identified 46 mutation alleles including 9 novel mutations. We then examined the NOEV effect on mutant ß-galactosidase proteins by using six strains of patient-derived skin fibroblast. We also performed mutagenesis to identify ß-galactosidase mutants that were responsive to NOEV and found that 22 out of 94 mutants were responsive. Computational structural analysis revealed the mode of interaction between human ß-galactosidase and NOEV. Moreover, we confirmed that NOEV reduced G(M1) accumulation and ameliorated the impairments of lipid trafficking and protein degradation in ß-galactosidase deficient cells. These results provided further evidence to NOEV as a promising chaperone compound for ß-galactosidase deficiency.