First Report of Epicoccum latusicollum Causing Leaf Spot Disease on Banana in China.

Banana (Musa acuminata) is one of the most important fruit crops in the world. In June 2020, a leaf spot disease was detected on M. acuminata (AAA Cavendish cv. Williams B6) in a commercial plantation (∼1.2 ha), Nanning, Guangxi province, China. The disease occurred on ~30% of plants. The first symptoms were round or irregular dark brown spots on the leaf surface, which progressively expanded into large, suborbicular or irregular-shaped dark brown necrotic areas. Finally, the lesions coalesced and resulted in leaf abscission. Fragments of tissues (~5 mm) were cut from six symptomatic leaves, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and incubated on potato dextrose agar (PDA) at 28°C for 3 days. The hyphal tips from emerging colonies were transferred onto fresh PDA plates to obtain pure cultures. From the 23 isolates, 19 exhibited similar morphology. The colonies on PDA and Oatmeal agar (OA) were villose, dense, white to grey. NaOH spot test resulted in a dark green discolouration on malt extract agar (MEA) cultures. After 15 days of incubation, pycnidia were observed, which were dark, spherical or flat spherical, 67.1 to 173.1 µm (n = 64) in diameter. Conidia were oval mostly, aseptate, hyaline, guttulate, 4.1 to 6.3 × 1.6 to 2.8 µm (n = 72). Morphological features were similar to Epicoccum latusicollum (Chen et al. 2017, Qi et al. 2021). The internal transcribed spacer (ITS), the partial 28S large subunit rDNA (LSU), beta-tubulin (TUB), and RNA polymerase II second largest subunit (RPB2) genes of the three representative isolates (GX128.6.3, GX132.14.1, GX140.4.3) were amplified and sequenced using the primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), TUB2-Ep-F/TUB2-Ep-R (GTTCACCTTCAAACCGGTCAATG/AAGTTGTCGGGACGGAAGAGCTG), and RPB2-Ep-F/RPB2-Ep-R (GGTCTTGTGTGCCCCGCTGAGAC/TCGGGTGACATGACAATCATGGC), respectively. The ITS (OL614830-32), LSU (OL739128-30), TUB (OL739131-33), and RPB2 (OL630965-67) sequences were 99% (478/479, 478/479, and 478/479 bp), 99% (881/882, 867/868, and 877/878 bp), 99 to 100% (332/333, 333/333, and 333/333 bp), and 100% (556/556, 559/559, and 555/555 bp) identical to those of the ex-type E. latusicollum LC5181 (KY742101, KY742255, KY742343, KY742174) (Chen et al. 2017). A phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular data, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on 1.5 months old banana plants (cv. Williams B6) were stab-wounded using a needle and inoculated with either mycelial discs (5 mm) or aliquots of 10 µl conidial suspension (106 conidia/ml). Three leaves on each of six plants were inoculated. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free PDA discs or sterile water served as controls. All plants were incubated in a greenhouse at 28°C (12-h photoperiod, 80% humidity). After seven days, leaf spot appeared on the inoculated leaves. No symptoms were detected on controls. The experiments were repeated three times showed similar results. To fulfill Koch's postulates, the Epicoccum isolates were consistently re-isolated from symptomatic tissue and confirmed by morphology and sequencing. To our knowledge, this is the first report of E. latusicollum causing leaf spot on banana in China. This study may provide the basis for control of the disease.

First Report of Epicoccum latusicollum Causing Leaf Blight on Curcuma kwangsiensis in China.

Curcuma kwangsiensis S. G. Lee et C. F. Liang is a traditional Chinese medicinal plant distributed in Guangxi and Yunnan Province, China. In May 2021, a leaf blight disease on C. kwangsiensi was observed in a plantation (~ 2 ha) in Lingshan county (21°51'00″N, 108°44'00″E), Guangxi Province. Disease incidence was up to 30% (n = 200). Initially, yellow to brown, irregular, water-soaked spots appeared at the tips or margins of leaves. As the disease progressed, the lesions gradually enlarged, merged. Finally, the entire leaf wilted, leading to defoliation. To isolate the pathogen, eighteen small pieces ( ~ 5 mm2) were cut from the margin of the necrotic lesions, surface disinfected with 1% NaOCl solution for 2 min, and rinsed three times in sterile water. Then the tissues were plated onto potato dextrose agar (PDA) and incubated for 3 days at 28°C. Hyphal tips from recently germinated spores were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which ten isolates with similar morphological characterization. Two single-spore isolates (CK45.1 and CK45.2) were subjected to further morphological and molecular characterization. Colonies on PDA were villose, had a dense growth of aerial mycelia, and appeared white to grayish eventually. Pycnidia were brown, predominantly spheroidal, and 45.0 to 205.4 µm in diameter (n = 60). Conidia were ellipsoidal, aseptate, and 3.8 to 6.1 × 1.8 to 3.6 µm (n = 90). Morphological characteristics are similar to those of Epicoccum latusicollum (Chen et al. 2017).For molecular identification, primers ITS1/ITS4 (White et al. 1990), LR0R/LR5 (Vilgalys and Hester 1990, Rehner and Samuels 1994), RPB2-Ep-F (GGTCTTGTGTGCCCCGCTGAGAC)/RPB2-Ep-R TCGGGTGACATGACAATCATGGC), and TUB2-Ep-F (GTTCACCTTCAAACCGGTCAATG)/TUB2-Ep-R (AAGTTGTCGGGACGGAAGAGCTG) were used to amplify the internal transcribed spacer (ITS), partial nuclear large subunit rDNA (LSU), RNA polymerase II second largest subunit (rpb2), and ß-tubulin (tub2) genes, respectively. The obtained ITS (OP788080-81), LSU (OP811325-26), rpb2 (OP811267-68) and tub2 (OP811269-70) sequences showed 99.8% (478/479, and 478/479 bp), 99.9% (881/882, and 870/871 bp), 99.8 to 100% (429/431, and 429/430 bp), and 99.7% (332/333, and 332/333 bp) identity with those of ex-type strain E. latusicollum CGMCC 3.18346 (KY742101, KY742255, KY742174, KY742343). In addition, a phylogenetic analysis confirmed the isolates as E. latusicollum. Therefore, based on morphological and molecular characteristics, the isolates were identified as E. latusicollum. To verify pathogenicity, healthy leaves on nine plants (1 leaf per plant) were inoculated with mycelial discs from 5-day-old water-agar medium (WA) cultures of the strain CK45.1. Each leaf had four inoculation sites, two were inoculated with a representative strain, and two treated with pollution-free WA discs served as control. Plants were covered with transparent plastic bags and maintained in a greenhouse at 25°C with a 12 h photoperiod. Six days post-inoculation, the inoculated sites of leaves showed brown lesions, while the control remained healthy. The experiments repeated three times showed similar results. Koch's postulates were fulfilled by re-isolation of E. latusicollum from the lesions. To our knowledge, this is the first report of E. latusicollum causing leaf blight of C. kwangsiensi in China. This report might provide important information for growers to manage this disease.

Identification of Neofusicoccum parvum as the causative agent of leaf spot disease on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is an essential traditional Chinese medicinal plant used to treat hemorrhage, swelling, inflammation, ulcers, and pulmonary diseases (Xu et al. 2019). In April of 2020, an unknown leaf spot disease was observed on B. striata in a plantation (~ 0.2 ha) in Nanning, Guangxi province, China. Disease incidence was estimated at approximately 25% (n = 150 plants). The initial symptoms were small brown circular spots, which then expanded into reddish to brown, circular to irregular lesions 5-10 mm in diameter. As the disease developed, the whole leaf became densely covered with lesions. Finally, the lesions coalesced, killing the leaf and resulting in defoliation. To isolate the causal agent, six symptomatic leaves were collected from individual plants. Small pieces (~ 5 mm2) were cut from the margin of the necrotic lesions (n = 18), disinfected in 1% NaOCl for 2 min before rinsing three times in sterile water, and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips from the resulting cultures were transferred to PDA to obtain pure cultures. Fifteen isolates were obtained, of which twelve isolates exhibited similar morphology. Colonies on PDA were initially white, then turned dark gray after 7 days. Pycnidia were produced on the surface of PDA after 50 days. Conidia were hyaline, aseptate, ellipsoidal to fusiform, externally smooth, thin-walled, and measuring 11.5 to 15.2 × 4.9 to 6.1 µm (mean ± SD: 13.4 ± 1.0 × 5.4 ± 0.3 µm, n = 60). Morphological features were similar to N. parvum (Phillips et al. 2013). For further molecular identification, the internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), ß-tubulin (TUB2) genes were amplified and sequenced using the primer pairs ITS1/ITS4 (White et al. 1990), EF1-728F (Carbone and Kohn 1999)/EF-2 (O'Donnell et al. 1998), and Bt2a/Bt2b (Glass and Donaldson 1995), respectively. Sequences of the two isolates BJ-111.1 and BJ-111.4 were deposited in NCBI GenBank under the following accession numbers: OM348509-10, OM397537-40. The obtained ITS, EF1-α, and TUB2 sequences showed 99% (514/516, and 513/516 bp), 99% (275/276, and 274/275 bp), and 99% (429/431, and 429/430 bp) homology with several GenBank sequences of the ex-type strain N. parvum CMW 9081 (AY236943, AY236888, and AY236917, respectively) (Zhang et al. 2017). In addition, a phylogenetic analysis confirmed the isolates as N. parvum. Therefore, the isolates were identified as N. parvum based on morphological and molecular evidence. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on six plants (1 leaf per plant) were inoculated with a 10-µl droplet of conidial suspensions (106 conidia/mL). Three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and incubated in a greenhouse at 26°C with a 12 h photoperiod. Six days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, N. parvum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. No fungus was isolated from the controls. To our knowledge, this is the first report of N. parvum causing leaf spot of B. striata worldwide. This result will help develop disease management strategies against this pathogen.

Occurrence of Leaf Spot Caused by Diaporthe phaseolorum on Bletilla striata in China.

Bletilla striata (Thunb.) Rchb. f. (Orchidaceae) is a traditional Chinese medicinal plant widely distributed in eastern and southern Asia. In April of 2020, a leaf spot disease on B. striata was observed in plant nurseries in Guilin, Guangxi Province, China. Disease incidence was estimated at approximately 20% (n = 150 plants) across the survey area (~ 0.3 ha). The initial symptoms were small, reddish to brown spots, circular or irregular in shape. Subsequently, they developed into large dark brown, irregular lesions. As the lesions coalesced, leaves withered and defoliated. To isolate the causal agent, eighteen small pieces (~ 5 mm2) were collected from the margin of the necrotic lesions on Chinese ground orchid, surface disinfected (2 min in 1% NaOCl, and rinsed three times in sterile water), and placed on potato dextrose agar (PDA) at 26°C for 3 days. Hyphal tips were transferred to PDA to obtain pure cultures. Twelve isolates were obtained, of which eight isolates had similar morphological characteristics. After 7 days growth on PDA, colonies were grayish-white, fluffy, with white aerial mycelium. After 3 weeks, colonies formed white aerial mycelial mats, and pycnidia developed. The α-conidia were abundant, hyaline, aseptate, ellipsoidal to fusiform, measuring 4.6 to 6.7 µm × 2.1 to 3.0 µm (n = 55), whereas the ß-conidia were hyaline, long, slender, straight or curved, measuring 10.3 to 17.2 µm × 0.9 to 1.8 µm (n = 59). Morphological features were similar to Diaporthe sp. (Santos et al. 2011, Udayanga et al. 2015). For further molecular identification, DNA was extracted from the mycelia of the representative isolate BJ26.3 following the CTAB (cetyltrimethylammonium bromide) method (Guo et al. 2000). The internal transcribed spacer (ITS) region, partial translational elongation factor subunit 1-α (EF-1α), calmodulin (CAL) , histone H3 (HIS3), ß-tubulin (TUB) genes were amplified and sequenced using the primer pairs ITS1/ITS4, EF1-728F/EF1-986R, CAL-228F/CAL-737R, CYLH3F/H3-1b, and Bt2a/Bt2b, respectively (White et al. 1990, Guarnaccia et al. 2018). The obtained sequences were deposited in NCBI GenBank under the following accession numbers: OK560457, OK539595, OK539592, OK506726, OK539598. BLAST analysis of the deposited sequences showed 99 to 100% identity with accession numbers KC343177 (563/566 bp), KC343903 (521/523 bp), KC343419 (423/427 bp), KC343661 (340/340 bp), KC344145 (658/662 bp) of D. phaseolorum CBS 127465 (Guarnaccia et al. 2018). In addition, a phylogenetic analysis using concatenated sequences confirmed BJ26.3 as D. phaseolorum. Furthermore, pathogenicity tests were carried out on 1.5-year-old B. striata plants. Healthy leaves on three plants (1 leaf per plant) were inoculated with 5 × 5 mm mycelial discs of strain BJ-26.3 from 3-day-old PDA cultures. Another three plants treated with sterile water served as the control. All plants were covered with transparent plastic bags and maintained in a greenhouse at 26°C with a 12 h photoperiod. Nine days post-inoculation, the inoculated leaves showed leaf spot symptoms, while the control plants remained healthy. The experiments repeated three times showed similar results. Finally, D. phaseolorum was consistently re-isolated from the infected leaves and confirmed by morphology and sequencing, fulfilling Koch's postulates. To our knowledge, this is the first report of D. phaseolorum causing leaf spot of B. striata worldwide. This study might provide important information for growers to manage this disease.