Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 697
Filtrar
2.
Artigo em Inglês | MEDLINE | ID: mdl-31935182

RESUMO

Strain CPCC 203383T, isolated from the surface-sterilized fruit of Cerasus pseudocerasus (Lindl.) G. Don, was taxonomically characterized based on a polyphasic investigation. It had the highest 16S rRNA gene sequence similarities with Ornithinimicrobium pekingense DSM 21552 (97.2 %) and O. kibberense DSM 17687T (97.2%). Phylogenetic analysis based on 16S rRNA gene sequences showed that the strain formed a distinct phyletic branch within the genus Ornithinimicrobium and the whole genome sequence data analyses supported that strain CPCC 203383T was phylogenetically related to the Ornithinimicrobium species. The isolate shared a range of phenotypic patterns reported for members of the genus Ornithinimicrobium, but also had a range of cultural, physiological and biochemical characteristics that separated it from related Ornithinimicrobium species. The menaquinone was MK-8(H4). The polar lipid profile consisted of diphosphatidylglycerol (DPG), phosphatidylglycerol (PG), phosphatidylinositol (PI) and unidentified lipids (ULs). The major fatty acids (>5 %) were iso-C15 : 0, anteiso-C15 : 0, iso-C16:0, 9-methyl C16 : 0, iso-C17 : 0 and anteiso-C17 : 0. The cell wall peptidoglycan contains l-ornithine as diagnostic diamino acid and an interpeptide bridge consisting of L-Orn←L-Ala←Gly←D-Asp. The combined genotypic and phenotypic data indicated that the isolate represents a novel species of the genus Ornithinimicrobium, for which the name Ornithinimicrobium cerasi sp. nov. is proposed, with CPCC 203383T(=NBRC 113522T=KCTC 49200T) as the type strain. The DNA G+C composition is 72.3 mol%. The availability of new data allows for an emended description of the genus Ornithinimicrobium.

3.
J Clin Ultrasound ; 48(1): 19-28, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31609458

RESUMO

OBJECTIVES: To summarize the contrast-enhanced ultrasound (CEUS) features of mediastinal lymphomas and thymic epithelial tumors (including thymomas and thymic carcinomas) and to explore the value of CEUS in the differential diagnosis of lymphomas and thymic epithelial tumors. METHODS: Sixty-nine patients with 69 mediastinal lesions who underwent CEUS and had disease confirmed by histopathology were enrolled in the study. There were 33 cases of lymphoma, 19 cases of thymic carcinoma, and 17 cases of thymoma. CEUS features, including the enhancement pattern, enhancement distribution, enhancement time, inner necrosis status, wash out pattern, and vascular morphology, were evaluated in each group. RESULTS: Thymomas often presented with homogeneous (88.2%, 15/17) and late (88.2%, 15/17) enhancement and a low rate of inner necrosis (17.6%, 3/17). Late (73.7%, 14/19), heterogeneous (68.4%, 13/19), and centripetal (63.2%, 12/19) enhancement were more often observed in thymic carcinoma, as was a high rate of inner necrosis (78.9%, 15/19). Lymphomas showed a homogeneous enhancement rate of 57.6% (19/33) and a late enhancement rate of 54.5% (18/33). The rate of inner necrosis for lymphomas was 45.5% (15/33). The diagnostic accuracy of this finding for distinguishing thymic epithelial tumors from lymphomas was 63.8%, the sensitivity was 80.6%, and the specificity was 45.5%. Enlarged blood vessels were a feature specific to lymphomas, while small vessels arranged in a comb shape was a feature specific to thymic epithelial tumors. CONCLUSION: This study describes the CEUS features of common mediastinal tumors and may stimulate further studies in this field.

4.
Res Vet Sci ; 128: 153-161, 2019 Nov 28.
Artigo em Inglês | MEDLINE | ID: mdl-31809972

RESUMO

Hen eggs (HEs) provide valuable nutrients for humans, including proteins, carbohydrates, lipids and vitamins. Recent studies revealed a number of novel egg-derived proteins/peptides (EDPs), and EDPs may play a crucial role in food industry and medical therapy. First, these EDPs were purified from the enzyme-catalyzed hydrolysates of egg proteins and were characterized by biochemical assays such as gel electrophoresis, HPLC, mass spectrometry, proteomic and peptideomic analysis, etc. Second, some EDPs can be used as nontoxic bio-preservatives and functional nutraceuticals for replacing harmful sodium nitrite, inhibiting foodborne pathogens, promoting metal-ion absorption and improving meat-product quality, and these new features will be widely used in the field of food production. Third, novel medical properties of EDPs comprise anti-oxidative, anti-microbial, anti-inflammatory and anti-nociceptive activities, which will benefit prevention of cardiovascular diseases, cancers, diabetic mellitus, immune disorders, etc. In summary, this review gives a real insight into the novel nutritional, biological and medical functions of EDPs, predictably facilitating the applications of EDPs in production of nutritive supplements, functional nutraceuticals and therapeutic medicines.

5.
Ecotoxicol Environ Saf ; 189: 110051, 2019 Dec 04.
Artigo em Inglês | MEDLINE | ID: mdl-31812022

RESUMO

Naphthalene has remained a challenge how to eradicate it from the water because of its carcinogenic risk to humans. In the present study, naphthalene prominently increased the rates of embryonic mortality and malformation, and decreased the hatchability of zebrafish which have a high developmental similarity to humans. Moreover, multiple-organ toxicity were notably found in naphthalene-treated zebrafish. Here, irradiated graphene aerogel (IGA) was successfully prepared from high-energy electron beam to generate more wrinkles, folds, defects and a strong absorption capability for naphthalene, compared with the non-irradiated graphene aerogel. IGA was outstandingly found to remove naphthalene from the embryo culture medium, and subsequently inhibit the embryotoxicity and maintain tissue integrity by restoring cardiac function, attenuating apoptosis signals, recovering eye morphology and structure, reducing expression of heat shock protein 70 in the tissues and promoting behavioral capacity. Meanwhile, no obvious negative impact of IGA was found in the developing zebrafish from embryo to larvae. Consequently, reduction in the toxicity of naphthalene during zebrafish embryogenesis was mediated by IGA as an advanced strategy.

6.
Water Res ; 170: 115357, 2019 Nov 30.
Artigo em Inglês | MEDLINE | ID: mdl-31812812

RESUMO

Urea is a major source of nitrogen pollution in domestic sewage and its denitrification is difficult since it is very likely to be converted into ammonia or nitrate instead of expected N2. Herein, we propose an exhaustive denitrification method for urea via the oxidation of amine/ammonia-N with chlorine oxide radical, which induced from a bi-functional RuO2//WO3 anode, and the highly selective reduction of nitrate-N on cathode in photoelectrochemical cell (PEC). Under illumination, the WO3 photoanode side promotes the quantities hydroxyl and reactive chlorine radical, and these radicals are immediately combined to stronger chlorine oxide radical by RuO2 side, which obviously enhances the efficiency and speed of the urea oxidation. Synchronously, the over-oxidized nitrate can be selectively reduced by Pd and Au nanoparticles on the surface of cathode. Eventually, exhaustive denitrification is realized by the circulative reaction. Experimental observations and theoretical calculation revealed that chlorine oxide radical promoted significant denitrification of urea with an efficiency of 99.74% in 60 min under the optimum condition. The removal rate constant of the RuO2//WO3 anode was 3.08 times than that of single WO3 anode and 2.64 times than that of single RuO2 anode, confirming the chlorine oxide radical had stronger ability on denitrification than reactive chlorine radical. Also, the bi-functional anode contributed to best current efficiencies, utilizing the energy availably. This work proposes a promising method of exhaustive denitrification for urea.

7.
Ying Yong Sheng Tai Xue Bao ; 30(11): 3795-3803, 2019 Nov.
Artigo em Chinês | MEDLINE | ID: mdl-31833693

RESUMO

With the increase of global environmental changes and intensive anthropogenic activities, it is important to maintain and improve soil function. Here, we evaluated the effects of environmental stress (i.e., drying, high temperature and the combination of drying and high temperature) on soil functional stability (resistance and resilience) under three kinds of water management mea-sures, which included conventional-flooded cultivation, non-flooded with uncovered cultivation and non-flooded with straw mulching. Results showed that, compared to single environmental stress (drying or high temperature), combined stress led to lower soil fungal biomass, bacterial biomass, basal respiration, and soil functional resistance, and higher contents of dissolved organic carbon (DOC) and NH4+-N after one day treatment of stress. Combined stress significantly decreased soil functional resilience after 56 days treatment of stress. Results from the correlation analysis showed that bacterial and fungal biomass were significantly related to soil resistance and resilience. Different water management measures could regulate the effects of environmental stress on soil functional stability. Non-flooded with straw mulching treatment significantly increased the contents of soil DOC, NH4+-N, fungal biomass and bacterial biomass, resulting in higher soil functional resistance and resilience compared with conventional-flooded cultivation and non-flooded with uncovered cultivation under both single and combined stress. In summary, non-flooded with straw mulching could improve soil functional stability under environmental stress, and it could be a suitable agricultural management for non-continuously flooded rice cultivation under multiple stresses.

8.
Food Funct ; 2019 Dec 11.
Artigo em Inglês | MEDLINE | ID: mdl-31825421

RESUMO

Soybean products are limited in terms of safe consumption because of the sensitization of raw materials. In this study, the allergenicity of cross-linked tofu with microbial transglutaminase (MTG) was evaluated on the basis of a BALB/c mouse model. The mice were randomly divided into five groups. Cholera toxin was used as an adjuvant to sensitize the mice through intragastric administration, and tofu was given orally to investigate its sensitization effect on the mice. The allergy symptoms, body temperature, and weight of the mice were detected. The immunoglobulin E (IgE), immunoglobulin G (IgG), and spleen cytokines of the mice were determined through an enzyme-linked immunosorbent assay. The regulation of the differentiation balance of the different subsets of splenic T lymphocyte (Th1, Th2) and regulatory T cells (Tregs) in the mice was measured through flow cytometry. Results showed that the mice administered with MTG-cross-linked tofu had fewer allergic symptoms compared with those of the control group. The concentrations of serum-specific IgE and IgG, plasma histamine, and mast cell protease 1 (mMCP-1) significantly decreased. The Th2-related cytokine levels reduced, and the IFN-γ levels increased. The proportion of Th2 cells decreased, and the proportion of CD4+CD25+Foxp+ Tregs increased as the percentage of Th1 cells increased. Therefore, the sensitization of enzymatic cross-linked tofu decreased.

9.
Int J Biol Macromol ; 2019 Dec 09.
Artigo em Inglês | MEDLINE | ID: mdl-31830454

RESUMO

Biological metal-organic frameworks (BioMOFs), an emerging sub-class of MOFs, are prepared from metals and biological ligands (bioligands). Benefit from the low toxicity and good biocompatibility of bioligands, BioMOFs can be used in biomedicine and biocatalysis. In this work, a novel approach was developed for fabricating BioMOFs materials (Co-Cys BioMOFs) from cobalt salt and cystine, meanwhile nitrile hydratase (NHase) was in-situ encapsulated during the synthesis process. The obtained NHase-BioMOFs biocomposits named NHase@Co-Cys was characterized by SEM, TEM, XPS, etc. The preparation parameters and stabilities of NHase@Co-Cys were investigated. The maximum encapsulation yield and specific activity of NHase@Co-Cys were 92.71% and 139.04 U/gimmobilized NHase, respectively. The thermal stability of NHase@Co-Cys was improved by approximately 5-fold at 55 °C. The activity of NHase after immobilization was retained nearly 60% after incubating at pH 4.0 and 10.0 for 7 h. The NHase@Co-Cys showed similar catalytic capacity compared with free NHase in producing nicotinamide. After 7 h of reaction catalyzed by free NHase (14.51 U) and NHase@Co-Cys (12.76 U), the yield of nicotinamide was 90.94% and 86.36%, respectively. The activity of NHase@Co-Cys remained 83.85% of the original activity after recycling for 10 times. These results suggested that the NHase@Co-Cys is an effective approach to enhance the enzymatic properties and demonstrated a broad application prospect in industrial production.

10.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artigo em Inglês | MEDLINE | ID: mdl-31870337

RESUMO

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.

11.
Aging (Albany NY) ; 11(24): 12452-12475, 2019 Dec 26.
Artigo em Inglês | MEDLINE | ID: mdl-31881007

RESUMO

Sorafenib is the standard first-line systemic therapy for hepatocellular carcinoma (HCC). However, the low objective response rates in clinical studies suggest the existence of certain HCC cells that are inherently insensitive to sorafenib. To understand the molecular basis of insensitivity of HCC cells to sorafenib, this study developed 3 kinds of insensitive HCC cells through exposure to various concentrations of sorafenib and performed a quantitative proteome analysis of the surviving HepG2 cells. 520 unique proteins were concentration-dependently upregulated by sorafenib. Bioinformatics-assisted analysis of 520 proteins revealed that the metabolic pathways involved in central carbon metabolism were significantly enriched, and 102 mitochondrial proteins, especially components of the electron transport chain (ETC), were incrementally upregulated in the 3 kinds of insensitive cells. Conversely, we identified a rapid holistic inhibitory effect of sorafenib on mitochondrial function by the direct targeting of the complex I-linked electron transport and the uncoupling of mitochondrial oxidative phosphorylation (OXHPOS) in HCC cells. Core metabolic reprogramming involved in a compensatory upregulation of OXHPOS combined with elevated glycolysis supports the survival of HCC cells under the highest dose of sorafenib treatment. Altogether, our work thus elaborates an ETC inhibitor and unveils the proteomic landscape of metabolic reprogramming in drug insensitivity.

12.
Zhongguo Zhong Yao Za Zhi ; 44(21): 4605-4611, 2019 Nov.
Artigo em Chinês | MEDLINE | ID: mdl-31872654

RESUMO

To analysis the SSR loci information in the transcriptome of Cordyceps sinensis and develop SSR molecular markers,MISA(MicroSatellite) software was used to analyze the microsatellites information from 16 875 unigene sequences and SSR primer designed by Primer 3. 0. In total,5 899 SSRs were detected in 4 252 unigene with the distribution frequency of 34. 99%,which was represented by 74 repeat motifs and SSR loci occurred per 7 952 bp in length. In the SSRs,the mono-nucleotide was the most abundant repeat motif(42. 5%),followed by tri-nucleotide(34. 48%),C/G and CCG/CGG were the dominant repeat motifs,respectively. The number of repetitions of the six SSR repeat types was concentrated on 5 to 12 times,and the length was mostly less than 24 bp. A total of 12 282 pairs of primers were screened and selected 20 pairs of primers for validity detection randomly,10 pairs of primers amplified the expected specific bands,and primer P1 has significant polymorphism. Moreover,it was found that unigene containing SSR loci is mainly related to genetic and environmental functions after GO and KEGG annotation. In conclusion,these SSR loci in the transcriptome of O. sinensis are high in frequency,rich in primitive types,high in polymorphism,and highly available,which will provides abundant candidate molecular markers for its genetic diversity analysis,resource identification protection,and gene function research.


Assuntos
Cordyceps/genética , Transcriptoma , Etiquetas de Sequências Expressas , Repetições de Microssatélites , Polimorfismo Genético
13.
J Geriatr Cardiol ; 16(10): 749-755, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31700514

RESUMO

Background: Cardiac rehabilitation (CR) has proven beneficial for patients with coronary artery disease. However, adherence to CR programs is the key to the health improvement in those patients. Identifying predictors for adherence, which is very much unknown in China, would be valuable for effective rehabilitation. This study aims to determine the adherence to home-based CR programs in Chinese coronary artery disease patients and determine predictors of adherence. Methods: The current study included 1033 outpatients with coronary heart disease in the First Medical Center of Chinese PLA General Hospital in Beijing from July 2015 to June 2017. Participants were given an exercise prescription and took part in home-based exercise training lasting for 3-24 months. A questionnaire was used to evaluate the completion of the CR program, understanding of the program, motivation of the patients, and family/peer support. Results: Two thirds of the patients adhered well to the home-based CR program. Elder patients (≥ 65-year-old) adhere to the program better, while men adhered better than women. Patients who used to exercise (B = 6.756, P < 0.001), understood the program (B = 0.078, P = 0.002), with stronger motivation to participate (B = 0.376, P < 0.001), and received better family support (B = 0.487, P < 0.001) also adhere better to the program. Conclusions: Understanding the program, self-motivation of patients, and family support help to keep patients engaged in a home-based CR program. Improvement of family support by educating both patients and families may be helpful in improving adherence to home-based CR programs.

14.
Aging Clin Exp Res ; 2019 Nov 25.
Artigo em Inglês | MEDLINE | ID: mdl-31768878

RESUMO

BACKGROUND: Low-energy fracture risk is significantly increased in diabetes mellitus, the purpose of this article is to systematically evaluate the association between diabetes mellitus and risk for low-energy fracture. METHODS: We conducted a systematic literature search of Medline, Embase, Science Citation Index, Wiley Online Library database through January 2019. Pooled relative risks (RR) with corresponding 95% confidence intervals (95% CI) were calculated with random-effects model to assess the strength of association. RESULTS: Thirty-seven studies met the inclusion criteria, which included 3,123,382 participants. The pooled RR of any fracture in people with diabetes mellitus was 1.5 (95% CI 1.3-1.8; P < 0.05). The significant association not found in subgroup analysis of prospective design, follow-up period ≥ 10 year (all P > 0.05). The pooled RR of hip fracture in people with diabetes mellitus was 2.0 (95% CI 1.8-2.3; P < 0.05). In addition, subgroup analysis shown higher risk of hip fracture in type 1 diabetes (RR: 5.3). The pooled RR of vertebral fracture with diabetes mellitus was 1.4 (95% CI 0.9-2.2; P = 0.196). Subgroup analysis by type of diabetes showed that the RR of vertebral fracture for patients with unknown-type diabetes was 2.4 (95% CI 1.4-4.0; P < 0.05). Diabetes mellitus was associated with fractures at other sites, and effect estimates was statically significant. CONCLUSIONS: Diabetes mellitus is an independent risk factor for low-energy fracture, and this relationship is more pronounced in hip fracture.

15.
Free Radic Biol Med ; 2019 Nov 23.
Artigo em Inglês | MEDLINE | ID: mdl-31770582

RESUMO

Corticosteroid insensitivity is a feature of airway inflammation in chronic obstructive pulmonary disease (COPD). Erythromycin exhibits anti-inflammatory activity in COPD, but the concrete mechanism is still unclear. This study aimed to investigate the effects of erythromycin on corticosteroid sensitivity in peripheral blood mononuclear cells (PBMCs) and U937 cells (a human monocytic cell line). PBMCs were collected from non-smokers, healthy smoker volunteers, and COPD subjects. U937 cells were incubated with or without erythromycin and stimulated with TNF-α in the presence or absence of cigarette smoke extract (CSE). The dexamethasone (Dex) concentration required to achieve 50% inhibition of TNF-α-induced interleukin (IL)-8 production was determined and the mitogen-activated protein kinase (MAPK)/Activator protein-1 (AP-1) pathway was also evaluated. Erythromycin improved corticosteroid sensitivity in PBMCs obtained from COPD patients and CSE-treated U937 cells. This improvement in corticosteroid sensitivity was associated with reduced c-Jun expression, which resulted from the inhibition of P38 Mitogen-activated protein kinase (P38MAPK), extracellular signal-regulated protein kinase (ERK)1/2, and c-Jun N-terminal kinase (JNK) phosphorylation. Erythromycin had no effects on the phosphorylated and total protein expression levels of P38MAPK and ERK; however, it induced inhibition of the phosphorylated and total protein expression levels of JNK. This study provides evidence that erythromycin restores corticosteroid sensitivity in PBMCs and U937 cells. JNK inhibition by erythromycin restores corticosteroid sensitivity via the inhibition of c-Jun expression. Thus, JNK/c-Jun is a potential novel therapeutic target for COPD.

16.
Environ Sci Pollut Res Int ; 26(34): 35140-35150, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31686334

RESUMO

In this study, the effects of medium carbon chain alcohol (1-heptanol)-enhanced air sparging (AS) on the remediation of benzene-contaminated aquifers in different media (medium sand, channelized flow; gravel, bubbly flow) were investigated by comparison with a commonly used surfactant (sodium dodecylbenzene sulfonate (SDBS)). The results showed that the addition of 1-heptanol and SDBS significantly increased the air saturation in AS process under different airflow modes. Combined with water retention curves, 1-heptanol had the same effect on reducing the surface tension of groundwater and stabilizing bubbles as SDBS. In the study of benzene pollution removal, when the removal efficiency of the benzene pollutant exceeded 95%, the time required for surfactant-enhanced AS (SEAS) and alcohol-enhanced AS (AEAS) in medium sand was shortened by 28.6% and 52.4%, respectively, and the time required for SEAS and AEAS in gravel media was shortened by 16.7% and 58.3%, respectively, compared with the time required for AS. This finding indicated that the addition of SDBS or 1-heptanol could significantly increase the removal rate of benzene pollutants. Under the same surface tension conditions, the removal effect of 1-heptanol on the benzene pollutant was better than that of SDBS. This difference was due to the disturbance of the flow field during AEAS process causing the 1-heptanol on the gas-liquid interface to volatilize in the carrying gas, thereby inducing Marangoni convection on the interface, enhancing the gas-liquid mass transfer rate, and increasing the removal rate of benzene on the interface. Therefore, 1-heptanol is promising as a new reagent to enhance AS to remediate groundwater pollution.

17.
Clin Lab ; 65(10)2019 Oct 01.
Artigo em Inglês | MEDLINE | ID: mdl-31625349

RESUMO

BACKGROUND: The pneumonia severity index (PSI) scoring system is one of the tools used to evaluate and predict the prognosis of patients with community-acquired pneumonia (CAP). Although PSI has been widely used in clinical studies of pneumonia, it is still rare to combine it with blood indexes to predict the prognosis of pneumonia. Neutrophil-to-lymphocyte ratio (NLR) is a promising candidate predictor of mortality in CAP patients. The aim of this study was to investigate the efficacy of pneumonia severity index combined with NLR in predicting 30-day mortality in CAP patients. METHODS: We conducted a retrospective study. We analyzed data on 400 non-immune individuals over the age of 18 in this study. All patients received blood routine measurement and PSI score calculation after admission. The primary outcome measures were mortality and survival in CAP patients. The sensitivity and specificity of PSI score, NLR, and the combination of PSI score and NLR in predicting 30-day mortality were assessed using the subject operating characteristic curve (ROC). RESULTS: Data from 400 patients were analyzed, in which the 30-day mortality was 10.5% (42/400). The AUC of NLR and PSI in predicting 30-day mortality of CAP patients were 0.81 (95% CI 0.73 - 0.89) and 0.94 (95% CI 0.90 - 0.98), respectively, with statistically significant differences (p = 0.00). The sensitivity and specificity of NLR were 0.80 and 0.7, respectively. The sensitivity and specificity of PSI were 0.78 and 0.94, respectively. The combined AUC of the two indicators for predicting death in CAP patients was 0.95 (95% CI 0.92 - 0.99), and the sensitivity and specificity were 0.85 and 0.94, respectively. CONCLUSIONS: Neutrophil-to-lymphocyte ratio improves the accuracy and sensitivity of the pneumonia severity index in predicting 30-day mortality of CAP patients.

18.
Light Sci Appl ; 8: 78, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31645924

RESUMO

The manipulation and characterization of light polarization states are essential for many applications in quantum communication and computing, spectroscopy, bioinspired navigation, and imaging. Chiral metamaterials and metasurfaces facilitate ultracompact devices for circularly polarized light generation, manipulation, and detection. Herein, we report bioinspired chiral metasurfaces with both strong chiral optical effects and low insertion loss. We experimentally demonstrated submicron-thick circularly polarized light filters with peak extinction ratios up to 35 and maximum transmission efficiencies close to 80% at near-infrared wavelengths (the best operational wavelengths can be engineered in the range of 1.3-1.6 µm). We also monolithically integrated the microscale circular polarization filters with linear polarization filters to perform full-Stokes polarimetric measurements of light with arbitrary polarization states. With the advantages of easy on-chip integration, ultracompact footprints, scalability, and broad wavelength coverage, our designs hold great promise for facilitating chip-integrated polarimeters and polarimetric imaging systems for quantum-based optical computing and information processing, circular dichroism spectroscopy, biomedical diagnosis, and remote sensing applications.

19.
Yonsei Med J ; 60(11): 1036-1044, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31637885

RESUMO

PURPOSE: This study aimed to investigate the effect of adipose-derived stem cell (ADSC) transplantation on atherosclerosis (AS) and its underlying mechanisms. MATERIALS AND METHODS: In our study, rat AS model was established, and ADSCs were isolated and cultured. Atherosclerotic plaque and pathological symptoms of thoracic aorta were measured by Oil Red O staining and Hematoxylin-Eosin staining, respectively. Total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) levels were measured by an automatic biochemical analyzer. Expressions of vascular endothelial growth factor (VEGF), vascular cell adhesion molecule-1 (VCAM-1), intercellular adhesion molecule-1 (ICAM-1), aortic endothelin-1 (ET-1), interleukin-6 (IL-6), c-reactive protein (CRP), and tumor necrosis factor α (TNF-α) were measured by enzyme linked immunosorbent assay, VEGF, VCAM-1, ICAM-1, ET-1, respectively, and NF-κB p65 mRNA expressions were detected by quantitative real-time polymerase chain reaction. Protein expressions of VEGF, VCAM-1, ICAM-1, ET-1, NF-κB p65, p-NF-κB p65, and IκBα were measured by western blot. Moreover, NF-κB p65 expression was measured by immunofluorescence staining. RESULTS: ADSC transplantation alleviated the pathological symptoms of aortic AS. ADSC transplantation decreased the levels of TC, TG, and LDL-C and increased serum HDL-C level. Meanwhile, ADSC transplantation decreased the levels of IL-6, CRP, and TNF-α in AS rats. Moreover, the expressions of VEGF, ET-1, VCAM-1, and ICAM-1 were decreased by ADSC transplantation. ADSC transplantation inhibited phosphorylation of NF-κB p65 and promoted IκBα expression in AS rats. CONCLUSION: Our study demonstrated that ADSC transplantation could inhibit vascular inflammatory responses and endothelial dysfunction by suppressing NF-κB pathway in AS rats.

20.
Chin Med ; 14: 34, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31558913

RESUMO

Epithelial-mesenchymal transition (EMT) is a critical biological process allowing epithelial cells to de-differentiate into mesenchymal cells. Orchestrated signaling pathways cooperatively induce EMT and effect physiological, sometimes pathological outcomes. Traditional Chinese Medicine (TCM) has been clinically prescribed for thousands of years and recent studies have found that TCM therapies can participate in EMT regulation. In this review, the historical discovery of EMT will be introduced, followed by a brief overview of its major roles in development and diseases. The second section will focus on EMT in organ fibrosis and tissue regeneration. The third section discusses EMT-induced cancer metastasis, and details how EMT contribute to distant dissemination. Finally, new EMT players are described, namely microRNA, epigenetic modifications, and alternative splicing. TCM drugs that affect EMT proven through an evidence-based research approach will be presented in each section.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA