Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 53
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Front Genet ; 13: 866504, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35495126

RESUMO

Present research discovered novel miRNA-SSRs for seed type trait from 761 potential precursor miRNA sequences of pomegranate. SSR mining and BLASTx of the unique sequences identified 69 non-coding pre-miRNA sequences, which were then searched for BLASTn homology against Dabenzi genome. Sixty three true pri-miRNA contigs encoding 213 pre-miRNAs were predicted. Analysis of the resulting sequences enabled discovery of SSRs within pri-miRNA (227) and pre-miRNA sequences (79). A total of 132 miRNA-SSRs were developed for seed type trait from 63 true pri-miRNAs, of which 46 were specific to pre-miRNAs. Through ePCR, 123 primers were validated and mapped on eight Tunisia chromosomes. Further, 80 SSRs producing specific amplicons were ePCR-confirmed on multiple genomes i.e. Dabenzi, Taishanhong, AG2017 and Tunisia, yielding a set of 63 polymorphic SSRs (polymorphism information content ≥0.5). Of these, 32 miRNA-SSRs revealed higher polymorphism level (89.29%) when assayed on six pomegranate genotypes. Furthermore, target prediction and network analysis suggested a possible association of miRNA-SSRs i.e. miRNA_SH_SSR69, miRNA_SH_SSR36, miRNA_SH_SSR103, miRNA_SH_SSR35 and miRNA_SH_SSR53 with seed type trait. These miRNA-SSRs would serve as important genomic resource for rapid and targeted improvement of seed type trait of pomegranate.

2.
Front Genet ; 13: 874648, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35518351

RESUMO

Plants offer a habitat for a range of interactions to occur among different stress factors. Epigenetics has become the most promising functional genomics tool, with huge potential for improving plant adaptation to biotic and abiotic stresses. Advances in plant molecular biology have dramatically changed our understanding of the molecular mechanisms that control these interactions, and plant epigenetics has attracted great interest in this context. Accumulating literature substantiates the crucial role of epigenetics in the diversity of plant responses that can be harnessed to accelerate the progress of crop improvement. However, harnessing epigenetics to its full potential will require a thorough understanding of the epigenetic modifications and assessing the functional relevance of these variants. The modern technologies of profiling and engineering plants at genome-wide scale provide new horizons to elucidate how epigenetic modifications occur in plants in response to stress conditions. This review summarizes recent progress on understanding the epigenetic regulation of plant stress responses, methods to detect genome-wide epigenetic modifications, and disentangling their contributions to plant phenotypes from other sources of variations. Key epigenetic mechanisms underlying stress memory are highlighted. Linking plant response with the patterns of epigenetic variations would help devise breeding strategies for improving crop performance under stressed scenarios.

3.
Genes (Basel) ; 13(4)2022 03 27.
Artigo em Inglês | MEDLINE | ID: mdl-35456404

RESUMO

Advances in sequencing technologies and bioinformatics tools have fueled a renewed interest in whole genome sequencing efforts in many organisms. The growing availability of multiple genome sequences has advanced our understanding of the within-species diversity, in the form of a pangenome. Pangenomics has opened new avenues for future research such as allowing dissection of complex molecular mechanisms and increased confidence in genome mapping. To comprehensively capture the genetic diversity for improving plant performance, the pangenome concept is further extended from species to genus level by the inclusion of wild species, constituting a super-pangenome. Characterization of pangenome has implications for both basic and applied research. The concept of pangenome has transformed the way biological questions are addressed. From understanding evolution and adaptation to elucidating host-pathogen interactions, finding novel genes or breeding targets to aid crop improvement to design effective vaccines for human prophylaxis, the increasing availability of the pangenome has revolutionized several aspects of biological research. The future availability of high-resolution pangenomes based on reference-level near-complete genome assemblies would greatly improve our ability to address complex biological problems.


Assuntos
Melhoramento Vegetal , Plantas , Mapeamento Cromossômico , Humanos , Plantas/genética
4.
Biology (Basel) ; 11(2)2022 Feb 10.
Artigo em Inglês | MEDLINE | ID: mdl-35205141

RESUMO

Breeding crops in a conventional way demands considerable time, space, inputs for selection, and the subsequent crossing of desirable plants. The duration of the seed-to-seed cycle is one of the crucial bottlenecks in the progress of plant research and breeding. In this context, speed breeding (SB), relying mainly on photoperiod extension, temperature control, and early seed harvest, has the potential to accelerate the rate of plant improvement. Well demonstrated in the case of long-day plants, the SB protocols are being extended to short-day plants to reduce the generation interval time. Flexibility in SB protocols allows them to align and integrate with diverse research purposes including population development, genomic selection, phenotyping, and genomic editing. In this review, we discuss the different SB methodologies and their application to hasten future plant improvement. Though SB has been extensively used in plant phenotyping and the pyramiding of multiple traits for the development of new crop varieties, certain challenges and limitations hamper its widespread application across diverse crops. However, the existing constraints can be resolved by further optimization of the SB protocols for critical food crops and their efficient integration in plant breeding pipelines.

5.
Trends Biotechnol ; 40(4): 412-431, 2022 04.
Artigo em Inglês | MEDLINE | ID: mdl-34629170

RESUMO

Crop wild relatives (CWRs) have provided breeders with several 'game-changing' traits or genes that have boosted crop resilience and global agricultural production. Advances in breeding and genomics have accelerated the identification of valuable CWRs for use in crop improvement. The enhanced genetic diversity of breeding pools carrying optimum combinations of favorable alleles for targeted crop-growing regions is crucial to sustain genetic gain. In parallel, growing sequence information on wild genomes in combination with precise gene-editing tools provide a fast-track route to transform CWRs into ideal future crops. Data-informed germplasm collection and management strategies together with adequate policy support will be equally important to improve access to CWRs and their sustainable use to meet food and nutrition security targets.


Assuntos
Produtos Agrícolas , Melhoramento Vegetal , Produtos Agrícolas/genética , Edição de Genes , Genômica , Fenótipo
6.
Trends Plant Sci ; 27(3): 217-219, 2022 03.
Artigo em Inglês | MEDLINE | ID: mdl-34865982

RESUMO

Genome sequences provide an unprecedented resource to rapidly develop modern crops. A recent paper by Varshney et al. provides genome variation maps of 3366 chickpea accessions. Here, we highlight how this breakthrough research can fundamentally change breeding practices of chickpea and potentially other crops.


Assuntos
Cicer , Cicer/genética , Produtos Agrícolas/genética , Genoma de Planta/genética , Genômica , Melhoramento Vegetal
7.
Commun Biol ; 4(1): 1266, 2021 11 04.
Artigo em Inglês | MEDLINE | ID: mdl-34737387

RESUMO

Climate change with altered pest-disease dynamics and rising abiotic stresses threatens resource-constrained agricultural production systems worldwide. Genomics-assisted breeding (GAB) approaches have greatly contributed to enhancing crop breeding efficiency and delivering better varieties. Fast-growing capacity and affordability of DNA sequencing has motivated large-scale germplasm sequencing projects, thus opening exciting avenues for mining haplotypes for breeding applications. This review article highlights ways to mine haplotypes and apply them for complex trait dissection and in GAB approaches including haplotype-GWAS, haplotype-based breeding, haplotype-assisted genomic selection. Improvement strategies that efficiently deploy superior haplotypes to hasten breeding progress will be key to safeguarding global food security.


Assuntos
Produtos Agrícolas/genética , Genoma de Planta , Haplótipos , Melhoramento Vegetal , Mudança Climática , Genômica , Estresse Fisiológico
9.
Plant Genome ; 14(3): e20132, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34494714

RESUMO

Cytoplasmic male sterility(CMS), a maternally inherited trait, provides a promising means to harness yield gains associated with hybrid vigor. In pigeonpea [Cajanus cajan (L.) Huth], nine types of sterility-inducing cytoplasm have been reported, of which A2 and A4 have been successfully deployed in hybrid breeding. Unfortunately, molecular mechanism of the CMS trait is poorly understood because of limited research invested. More recently, an association between a mitochondrial gene (nad7) and A4 -CMS has been demonstrated in pigeonpea; however, the mechanism underlying A2 -CMS still remains obscure. The current investigation aimed to analyze the differences in A2 -CMS line (ICPL 88039A) and its isogenic maintainer line (ICPL 88039B) at transcriptome level using next-generation sequencing. Gene expression profiling uncovered a set of 505 genes that showed altered expression in response to CMS, of which, 412 genes were upregulated while 93 were downregulated in the fertile maintainer line vs. the CMS line. Further, gene ontology (GO), Kyoto Encyclopedia of Genes and Genomes (KEGG), and protein-protein interaction (PPI) network analyses revealed association of CMS in pigeonpea with four major pathways: glucose and lipid metabolism, ATP production, pollen development and pollen tube growth, and reactive oxygen species (ROS) scavenging. Patterns of digital gene expression were confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) of six candidate genes. This study elucidates candidate genes and metabolic pathways having potential associations with pollen development and male sterility in pigeonpea A2 -CMS. New insights on molecular mechanism of CMS trait in pigeonpea will be helpful to accelerate heterosis utilization for enhancing productivity gains in pigeonpea.


Assuntos
Infertilidade Masculina , Infertilidade das Plantas , Citoplasma , Infertilidade Masculina/metabolismo , Melhoramento Vegetal , Infertilidade das Plantas/genética , Transcriptoma
10.
Trends Genet ; 37(12): 1124-1136, 2021 12.
Artigo em Inglês | MEDLINE | ID: mdl-34531040

RESUMO

Crop production systems need to expand their outputs sustainably to feed a burgeoning human population. Advances in genome sequencing technologies combined with efficient trait mapping procedures accelerate the availability of beneficial alleles for breeding and research. Enhanced interoperability between different omics and phenotyping platforms, leveraged by evolving machine learning tools, will help provide mechanistic explanations for complex plant traits. Targeted and rapid assembly of beneficial alleles using optimized breeding strategies and precise genome editing techniques could deliver ideal crops for the future. Realizing desired productivity gains in the field is imperative for securing an adequate future food supply for 10 billion people.


Assuntos
Genoma de Planta , Melhoramento Vegetal , Produtos Agrícolas/genética , Edição de Genes/métodos , Genoma de Planta/genética , Humanos , Fenótipo , Melhoramento Vegetal/métodos
11.
Plant Genome ; 14(3): e20125, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34337867

RESUMO

Whole-genome resequencing (WGRS) of 396 lines, consisting of 104 hybrid parental lines and 292 germplasm lines, were used to study the molecular basis of mid-parent heterosis (MPH) and to identify complementary heterotic patterns in pigeonpea [Cajanus cajan (L.) Millsp.] hybrids. The lines and hybrids were assessed for yield and yield-related traits in multiple environments. Our analysis showed positive MPH values in 78.6% of hybrids, confirming the potential of hybrid breeding in pigeonpea. By using genome-wide prediction and association mapping approaches, we identified 129 single nucleotide polymorphisms and 52 copy number variations with significant heterotic effects and also established a high-yielding heterotic pattern in pigeonpea. In summary, our study highlights the role of WGRS data in the study and use of heterosis in crops where hybrid breeding is expected to boost selection gain in order to ensure global food security.


Assuntos
Vigor Híbrido , Melhoramento Vegetal , Variações do Número de Cópias de DNA , Genômica , Locos de Características Quantitativas
12.
Theor Appl Genet ; 134(6): 1829-1843, 2021 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-34014373

RESUMO

KEY MESSAGE: Integrating genomics technologies and breeding methods to tweak core parameters of the breeder's equation could accelerate delivery of climate-resilient and nutrient rich crops for future food security. Accelerating genetic gain in crop improvement programs with respect to climate resilience and nutrition traits, and the realization of the improved gain in farmers' fields require integration of several approaches. This article focuses on innovative approaches to address core components of the breeder's equation. A prerequisite to enhancing genetic variance (σ2g) is the identification or creation of favorable alleles/haplotypes and their deployment for improving key traits. Novel alleles for new and existing target traits need to be accessed and added to the breeding population while maintaining genetic diversity. Selection intensity (i) in the breeding program can be improved by testing a larger population size, enabled by the statistical designs with minimal replications and high-throughput phenotyping. Selection priorities and criteria to select appropriate portion of the population too assume an important role. The most important component of breeder's equation is heritability (h2). Heritability estimates depend on several factors including the size and the type of population and the statistical methods. The present article starts with a brief discussion on the potential ways to enhance σ2g in the population. We highlight statistical methods and experimental designs that could improve trait heritability estimation. We also offer a perspective on reducing the breeding cycle time (t), which could be achieved through the selection of appropriate parents, optimizing the breeding scheme, rapid fixation of target alleles, and combining speed breeding with breeding programs to optimize trials for release. Finally, we summarize knowledge from multiple disciplines for enhancing genetic gains for climate resilience and nutritional traits.


Assuntos
Mudança Climática , Produtos Agrícolas/genética , Genômica , Valor Nutritivo , Melhoramento Vegetal , Alelos , Edição de Genes , Interação Gene-Ambiente , Genes de Plantas , Variação Genética , Fenótipo , Seleção Genética
13.
Plant Cell Rep ; 40(7): 1071-1085, 2021 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-33860345

RESUMO

KEY MESSAGE: WRKY transcription factors are among the largest families of transcriptional regulators. In this review, their pivotal role in modulating various signal transduction pathways during biotic and abiotic stresses is discussed. Transcription factors (TFs) are important constituents of plant signaling pathways that define plant responses against biotic and abiotic stimuli besides playing a role in response to internal signals which coordinate different interacting partners during developmental processes. WRKY TFs, deriving their nomenclature from their signature DNA-binding sequence, represent one of the largest families of transcriptional regulators found exclusively in plants. By modulating different signal transduction pathways, these TFs contribute to various plant processes including nutrient deprivation, embryogenesis, seed and trichome development, senescence as well as other developmental and hormone-regulated processes. A growing body of research suggests transcriptional regulation of WRKY TFs in adapting plant to a variety of stressed environments. WRKY TFs can regulate diverse biological functions from receptors for pathogen triggered immunity, modulator of chromatin for specific interaction and signal transfer through a complicated network of genes. Latest discoveries illustrate the interaction of WRKY proteins with other TFs to form an integral part of signaling webs that regulate several seemingly disparate processes and defense-related genes, thus establishing their significant contributions to plant immune response. The present review starts with a brief description on the structural characteristics of WRKY TFs followed by the sections that present recent evidence on their roles in diverse biological processes in plants. We provide a comprehensive overview on regulatory crosstalks involving WRKY TFs during multiple stress responses in plants and future prospects of WRKY TFs as promising molecular diagnostics for enhancing crop improvement.


Assuntos
Proteínas de Plantas/fisiologia , Estresse Fisiológico/fisiologia , Fatores de Transcrição/fisiologia , Produtos Agrícolas/genética , Produtos Agrícolas/fisiologia , Família Multigênica , Reguladores de Crescimento de Plantas/genética , Reguladores de Crescimento de Plantas/metabolismo , Fenômenos Fisiológicos Vegetais , Proteínas de Plantas/química , Proteínas de Plantas/genética , Plantas/genética , Transdução de Sinais , Fatores de Transcrição/química
14.
Trends Plant Sci ; 26(6): 631-649, 2021 06.
Artigo em Inglês | MEDLINE | ID: mdl-33893045

RESUMO

Over the past decade, genomics-assisted breeding (GAB) has been instrumental in harnessing the potential of modern genome resources and characterizing and exploiting allelic variation for germplasm enhancement and cultivar development. Sustaining GAB in the future (GAB 2.0) will rely upon a suite of new approaches that fast-track targeted manipulation of allelic variation for creating novel diversity and facilitate their rapid and efficient incorporation in crop improvement programs. Genomic breeding strategies that optimize crop genomes with accumulation of beneficial alleles and purging of deleterious alleles will be indispensable for designing future crops. In coming decades, GAB 2.0 is expected to play a crucial role in breeding more climate-smart crop cultivars with higher nutritional value in a cost-effective and timely manner.


Assuntos
Genoma de Planta , Melhoramento Vegetal , Produtos Agrícolas/genética , Genoma de Planta/genética , Genômica
15.
Front Plant Sci ; 12: 645055, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33796127

RESUMO

The simple sequence repeat (SSR) survey of 'Tunisia' genome (296.85 Mb) identified a total of 365,279 perfect SSRs spanning eight chromosomes, with a mean marker density of 1,230.6 SSRs/Mb. We found a positive trend in chromosome length and the SSR abundance as marker density enhanced with a shorter chromosome length. The highest number of SSRs (60,708) was mined from chromosome 1 (55.56 Mb), whereas the highest marker density (1,294.62 SSRs/Mb) was recorded for the shortest chromosome 8 (27.99 Mb). Furthermore, we categorized all SSR motifs into three major classes based on their tract lengths. Across the eight chromosomes, the class III had maximum number of SSR motifs (301,684, 82.59%), followed by the class II (31,056, 8.50%) and the class I (5,003, 1.37%). Examination of the distribution of SSR motif types within a chromosome suggested the abundance of hexanucleotide repeats in each chromosome followed by dinucleotides, and these results are consistent with 'Tunisia' genome features as a whole. Concerning major repeat types, AT/AG was the most frequent (14.16%), followed by AAAAAT/AAAAAG (7.89%), A/C (7.54%), AAT/AAG (5.23%), AAAT/AAAG (4.37%), and AAAAT/AAAAG (1.2%) types. We designed and validated a total of 3,839 class I SSRs in the 'Tunisia' genome through electronic polymerase chain reaction (ePCR) and found 1,165 (30.34%) SSRs producing a single amplicon. Then, we selected 906 highly variable SSRs (> 40 nt) from the ePCR-verified class I SSRs and in silico validated across multiple draft genomes of pomegranate, which provided us a subset of 265 highly polymorphic SSRs. Of these, 235 primers were validated on six pomegranate genotypes through wet-lab experiment. We found 221 (94%) polymorphic SSRs on six genotypes, and 187 of these SSRs had ≥ 0.5 PIC values. The utility of the developed SSRs was demonstrated by analyzing genetic diversity of 30 pomegranate genotypes using 16 HvSSRs spanning eight pomegranate chromosomes. In summary, we developed a comprehensive set of highly polymorphic genome-wide SSRs. These chromosome-specific SSRs will serve as a powerful genomic tool to leverage future genetic studies, germplasm management, and genomics-assisted breeding in pomegranate.

16.
Plant Dis ; 2021 Mar 24.
Artigo em Inglês | MEDLINE | ID: mdl-33761772

RESUMO

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

17.
Planta ; 253(2): 59, 2021 Feb 04.
Artigo em Inglês | MEDLINE | ID: mdl-33538916

RESUMO

MAIN CONCLUSION: Comparative analysis of genome-wide miRNAs and their gene targets between cytoplasmic male sterile (CMS) and fertile lines of pigeonpea suggests a possible role of miRNA-regulated pathways in reproductive development. Exploitation of hybrid vigor using CMS technology has delivered nearly 50% yield gain in pigeonpea. Among various sterility-inducing cytoplasms (A1-A9) reported so far in pigeonpea, A2 and A4 are the two major sources that facilitate hybrid seed production. Recent evidence suggests involvement of micro RNA in vast array of biological processes including plant reproductive development. In pigeonpea, information about the miRNAs is insufficient. In view of this, we sequenced six small RNA libraries of CMS line UPAS 120A and isogenic fertile line UPAS 120B using Illumina technology. Results revealed 316 miRNAs including 248 known and 68 novel types. A total of 637 gene targets were predicted for known miRNAs, while 324 genes were associated with novel miRNAs. Degradome analysis revealed 77 gene targets of predicted miRNAs, which included a variety of transcription factors playing key roles in plant reproduction such as F-box family proteins, apetala 2, auxin response factors, ethylene-responsive factors, homeodomain-leucine zipper proteins etc. Differential expression of both known and novel miRNAs implied roles for both conserved as well as species-specific players. We also obtained several miRNA families such as miR156, miR159, miR167 that are known to influence crucial aspects of plant fertility. Gene ontology and pathway level analyses of the target genes showed their possible implications for crucial events during male reproductive development such as tapetal degeneration, pollen wall formation, retrograde signaling etc. To the best of our knowledge, present study is first to combine deep sequencing of small RNA and degradome for elucidating the role of miRNAs in flower and male reproductive development in pigeonpea.


Assuntos
Cajanus/genética , MicroRNAs , Infertilidade das Plantas/genética , RNA de Plantas/genética , Cajanus/fisiologia , Citoplasma , Perfilação da Expressão Gênica , Regulação da Expressão Gênica de Plantas , Sequenciamento de Nucleotídeos em Larga Escala , MicroRNAs/genética
18.
Funct Integr Genomics ; 21(2): 251-263, 2021 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-33635500

RESUMO

Cytoplasmic male sterility (CMS) offers a unique system to understand cytoplasmic nuclear crosstalk, and is also employed for exploitation of hybrid vigor in various crops. Pigeonpea A4-CMS, a predominant source of male sterility, is being used for efficient hybrid seed production. The molecular mechanisms of CMS trait remain poorly studied in pigeonpea. We performed genome-wide transcriptome profiling of A4-CMS line ICPA 2043 and its isogenic maintainer ICPB 2043 at two different stages of floral bud development (stage S1 and stage S2). Consistent with the evidences from some other crops, we also observed significant difference in the expression levels of genes in the later stage, i.e., stage S2. Differential expression was observed for 143 and 55 genes within the two stages of ICPA 2043 and ICPB 2043, respectively. We obtained only 10 differentially expressed genes (DEGs) between the stage S1 of the two genotypes, whereas expression change was significant for 582 genes in the case of stage S2. The qRT-PCR assay of randomly selected six genes supported the differential expression of genes between ICPA 2043 and ICPB 2043. Further, GO and KEGG pathway mapping suggested a possible compromise in key bioprocesses during flower and pollen development. Besides providing novel insights into the functional genomics of CMS trait, our results were in strong agreement with the gene expression atlas of pigeonpea that implicated various candidate genes like sucrose-proton symporter 2 and an uncharacterized protein along with pectate lyase, pectinesterase inhibitors, L-ascorbate oxidase homolog, ATPase, ß-galactosidase, polygalacturonase, and aldose 1-epimerase for pollen development of pigeonpea. The dataset presented here provides a rich genomic resource to improve understanding of CMS trait and its deployment in heterosis breeding in pigeonpea.


Assuntos
Cajanus/genética , Genoma de Planta/genética , Infertilidade das Plantas/genética , Transcriptoma/genética , Hibridização Genômica Comparativa , Citoplasma/genética , Flores/genética , Perfilação da Expressão Gênica , Regulação da Expressão Gênica de Plantas/genética , Humanos , Melhoramento Vegetal
19.
Theor Appl Genet ; 134(1): 367-379, 2021 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-33079215

RESUMO

Fusarium wilt (FW) and sterility mosaic diseases (SMD) are key biotic constraints to pigeonpea production. Occurrence of these two diseases in congenial conditions is reported to cause complete yield loss in susceptible pigeonpea cultivars. Various studies to elucidate genomic architecture of the two traits have revealed significant marker-trait associations for use in breeding programs. However, these DNA markers could not be used effectively in genomics-assisted breeding for developing FW and SMD resistant varieties primarily due to pathogen variability, location or background specificity, lesser phenotypic variance explained by the reported QTL and cost-inefficiency of the genotyping assays. Therefore, in the present study, a novel approach has been used to develop a diagnostic kit for identification of suitable FW and SMD resistant lines. This kit was developed with 10 markers each for FW and SMD resistance. Investigation of the diversity of these loci has shown the role of different alleles in different resistant genotypes. Two genes (C.cajan_03691 and C.cajan_18888) for FW resistance and four genes (C.cajan_07858, C.cajan_20995, C.cajan_21801 and C.cajan_17341) for SMD resistance have been identified. More importantly, we developed a customized and cost-effective Kompetitive allele-specific PCR genotyping assay for the identified genes in order to encourage their downstream applications in pigeonpea breeding programs. The diagnostic marker kit developed here will offer great strength to pigeonpea varietal development program, since the resistance against these two diseases is essentially required for nominating an improved line in varietal release pipeline.


Assuntos
Cajanus/genética , Resistência à Doença/genética , Fusarium/patogenicidade , Doenças das Plantas/genética , Infertilidade das Plantas/genética , Alelos , Genes de Plantas , Marcadores Genéticos , Genótipo , Técnicas de Genotipagem , Mutação INDEL , Fenótipo , Doenças das Plantas/microbiologia , Polimorfismo de Nucleotídeo Único , Seleção Genética
20.
Front Genet ; 11: 1001, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-33193586

RESUMO

Fusarium wilt (FW) disease is the key constraint to grain legume production worldwide. The projected climate change is likely to exacerbate the current scenario. Of the various plant protection measures, genetic improvement of the disease resistance of crop cultivars remains the most economic, straightforward and environmental-friendly option to mitigate the risk. We begin with a brief recap of the classical genetic efforts that provided first insights into the genetic determinants controlling plant response to different races of FW pathogen in grain legumes. Subsequent technological breakthroughs like sequencing technologies have enhanced our understanding of the genetic basis of both plant resistance and pathogenicity. We present noteworthy examples of targeted improvement of plant resistance using genomics-assisted approaches. In parallel, modern functional genomic tools like RNA-seq are playing a greater role in illuminating the various aspects of plant-pathogen interaction. Further, proteomics and metabolomics have also been leveraged in recent years to reveal molecular players and various signaling pathways and complex networks participating in host-pathogen interaction. Finally, we present a perspective on the challenges and limitations of high-throughput phenotyping and emerging breeding approaches to expeditiously develop FW-resistant cultivars under the changing climate.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...