Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 55
Filtrar
1.
Int J Med Sci ; 18(1): 176-186, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33390786

RESUMO

Objective: The aim of this study was to observe the liver function recovery of COVID-19 patients after discharge. Patients and Methods: A total of 253 discharged COVID-19 patients in Shenzhen city, China were selected. The clinical characteristics of these patients were assessed. A 2-month follow-up and laboratory hematology test were performed to examine the status of patients' liver function. Results: Patients combined with liver diseases, especially fatty liver, are more likely to progress to severe condition (P<0.05). Patients in severe condition and those with liver diseases have higher rates of liver injuries during hospitalization, characterized by a significant increase in alanine aminotransferase (ALT) and aspartate aminotransferase (AST, P<0.01). The ALT, AST/ALT, gamma-glutamyl transferase (GGT), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), and A/G levels showed significant differences in comparison with the control group (P<0.05, and P<0.001); and the outlier ratio of A/G, ALT, GGT and ALP of patients remained abnormal higher within 14 days after discharge (P<0.001). Liver injuries of COVID-19 patients may be related to the epidemiological characteristics, clinical indexes, basic diseases, symptoms, drug treatment during hospitalization and the complications. Indicators of liver function were correlated with cardiac function, renal function, thyroid function, lipid metabolism, glucose metabolism, immune index, leukocyte, erythrocyte, hemoglobin and platelet related indexes. The outlier ratio of TP, ALB and GLB remained extremely low throughout the follow-up period; the outlier ratio of ALT, AST and GGT decreased below 10% from a high level at 40 days after discharged. However, the outlier ratio of A/G, AST/ALT and ALP remained high during the follow-up period. Conclusions: Abnormal liver function might indicate worse recovery of COVID-19 patients. Changes in liver function should be emphasized during long-term follow-up of COVID-19 patients after hospital discharge; the necessity of employing appropriate interventions for liver function repair should be emphasized.


Assuntos
/complicações , Insuficiência Hepática/virologia , Adolescente , Adulto , Idoso , Idoso de 80 Anos ou mais , Criança , Pré-Escolar , Estudos Transversais , Feminino , Seguimentos , Humanos , Lactente , Testes de Função Hepática , Masculino , Pessoa de Meia-Idade , Recuperação de Função Fisiológica , Adulto Jovem
3.
Sci Rep ; 10(1): 17900, 2020 10 21.
Artigo em Inglês | MEDLINE | ID: mdl-33087797

RESUMO

This study aimed to explore the association of tumor sidedness with the prognosis of patients with colon signet ring cell carcinoma (SRCC). Eligible patients were retrieved from the Surveillance, Epidemiology, and End Results database between 2004 and 2015. Cancer-specific survival (CSS) and overall survival (OS) were compared between patients with left-sided colon SRCC and those with right-sided lesions. A total of 2660 patients were included, among them, 1983 (74.5%) had right-sided colon SRCC. Compared to patients with left-sided colon SRCC, those who had the right-sided colon SRCC showed higher proportion of white race, female, aged ≥ 65 years, receiving total colectomy and ≥ 4 regional lymph node dissection; while had lower proportion of advanced AJCC stage. Besides, right-sided patients exhibited superior 5-year CSS (32.74% vs. 25.89%, P = 0.001) and OS (27.38% vs. 23.02%, P = 0.024) rates compared with left-sided ones. Multivariate analysis revealed that tumor sidedness was an independent prognostic factor. To be specific, patients with right-sided colon SRCC showed better CSS (HR: 0.873; 95% CI 0.777-0.981; P = 0.023) and OS (HR: 0.838; 95% CI 0.753-0.965; P = 0.002). Moreover, subgroup analysis demonstrated superior CSS and OS for right-sided patients in most subgroups. Tumor sidedness was an independent prognostic indicator for colon SRCC. Besides, patients with right-sided colon SRCC have superior prognosis than those with left-sided lesions.

4.
Biochem Biophys Res Commun ; 532(4): 576-583, 2020 Nov 19.
Artigo em Inglês | MEDLINE | ID: mdl-32900488

RESUMO

Spinal cord injury (SCI) leads to severe and long-lasting neurological disability. Presently, the lack of effective therapies for SCI is largely attributable to an incomplete understanding of its pathogenesis. F-box and WD repeat domain-containing protein 7 (FBW7, also known as FBXW7) is a type of E3 ubiquitin ligase complex, and plays essential roles in regulating different pathological and physiological processes. In this study, we attempted to explore the effects of FBW7 on SCI progression by the in vivo and in vitro experiments. SCI mice showed significantly reduced expression of FBW7 in spinal cord tissues. Promoting FBW7 expression via intrathecal injection of AAV9/FBW7 effectively improved locomotor function in SCI mice. Neuronal death in spinal cords of SCI mice was obviously ameliorated by FBW7 over-expression, along with greatly decreased expression of cleaved Caspase-3. In addition, microglial activation in spinal cord specimens was detected in SCI mice through increasing Iba-1 expression levels, which was, however, attenuated in SCI mice injected with AAV9/FBW7. Additionally, FBW7 over-expression dramatically restrained inflammatory response in spinal cord tissues of SCI mice, as evidenced by the down-regulated expression of tumor necrosis factor-α (TNF-α) and interleukin 1ß (IL-1ß) through blocking the activation of nuclear factor-κB (NF-κB) signaling. These anti-inflammatory effects of FBW7 were confirmed in LPS-stimulated mouse microglial BV2 cells. Finally, our in vitro studies showed that conditional medium (CM) collected from LPS-incubated BV2 cells markedly induced apoptosis in the isolated primary spinal neurons; However, this effect was overtly ameliorated by CM from LPS-exposed BV2 cells over-expressing FBW7. Thus, FBW7-regulated inflammation in microglial cells was involved in the amelioration of neuronal apoptosis during SCI development. Collectively, these findings illustrated that FBW7 expression was down-regulated in spinal cords of SCI mice, and promoting its expression could effectively mitigate SCI progression by repressing microglial inflammation and neuronal death.

5.
Oncol Rep ; 44(4): 1596-1604, 2020 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-32945475

RESUMO

The aim of the present study was to explore the antitumor effects of sinoporphyrin sodium (DVDMS)­mediated photodynamic therapy (PDT) and sonodynamic therapy (SDT) in glioma, and to reveal the underlying mechanisms. The uptake of DVDMS by U­118 MG cells was detected by flow cytometry (FCM). A 630­nm semiconductor laser and 1­MHz ultrasound were used to perform PDT and SDT, respectively. Cell proliferation and apoptosis were evaluated using the Cell Counting Kit­8 assay, FCM and Hoechst 33258 staining, respectively. Western blot analysis was used to detect protein expression and phosphorylation levels. BALB/c nude mice were used to establish a xenograft model of U­118 MG cells. DVDMS was injected intravenously and PDT and SDT were performed 24 h later. An in vivo imaging system was used to evaluate the fluorescence of DVDMS, to measure tumor sizes, and to evaluate the therapeutic effects. The uptake of DVDMS by U­118 MG cells was optimal after 4 h. PDT and SDT following DVDMS injection significantly inhibited the proliferation and increased apoptosis of glioma cells in vitro (P<0.05, P<0.01) respectively. In vivo, the fluorescence intensity of DVDMS was lower in the PDT and SDT groups compared with the DVDMS group, while tumor cell proliferation and weight were lower in the PDT and SDT groups than in the control group (P<0.05, P<0.01). However, there was no significant difference when laser, ultrasound or DVDMS were applied individually, compared with the control group. Hematoxylin and eosin staining suggested that both PDT and SDT induced significant apoptosis and vascular obstruction in cancer tissues. DVDMS­mediated PDT and SDT inhibited the expression levels of proliferating cell nuclear antigen (PCNA) and Bcl­xL, increased cleaved ­caspase 3 levels, and decreased the protein phosphorylation of the PI3K/AKT/mTOR signaling pathway. Changes in the expression of PCNA, and Bcl­xL and in the levels of cleaved­caspase 3 were partly reversed by N­acetyl­L­cysteine, a reactive oxygen species (ROS) scavenger. Similar results were obtained with FCM. DVDMS­mediated PDT and SDT inhibited glioma cell proliferation and induced cell apoptosis in vitro and in vivo, potentially by increasing the generation of ROS and affecting protein expression and phosphorylation levels.

6.
Electrophoresis ; 41(23): 2029-2035, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-32770833

RESUMO

Massively parallel sequencing of forensic STRs simultaneously provides length-based genotypes and core repeat sequences as well as flanking sequence variations. Here, we report primer sequences and concentrations of a next-generation sequencing (NGS)-based in-house panel covering 28 autosomal STR loci (CSF1PO, D1GATA113, D1S1627, D1S1656, D1S1677, D2S441, D2S1776, D3S3053, D5S818, D6S474, D6S1017, D6S1043, D8S1179, D9S2157, D10S1435, D11S4463, D13S317, D14S1434, D16S539, D18S51, D18S853, D20S482, D20S1082, D22S1045, FGA, TH01, TPOX, and vWA) and the sex determinant locus Amelogenin. Preliminary evaluation experiments showed that the panel yielded intralocus- and interlocus-balanced sequencing data with a sensitivity as low as 62.5 pg input DNA. A total of 203 individuals from Yunnan Bai population were sequenced with this panel. Comparative forensic genetic analyses showed that sequence-based matching probability of this 29-plex panel reached 2.37 × 10-29 , which was 23 times lower than the length-based data. Compound stutter sequences of eight STRs were compared with parental alleles. For seven loci, repeat motif insertions or deletions occurred in the longest uninterrupted repeat sequences (LUS). However, LUS and non-LUS stutters co-existed in the locus D6S474 with different sequencing depth ratios. These results supplemented our current knowledge of forensic STR stutters, and provided a sound basis for DNA mixture deconvolution.

7.
Sci Rep ; 10(1): 14126, 2020 08 24.
Artigo em Inglês | MEDLINE | ID: mdl-32839528

RESUMO

This study aimed to assess the benefit of postoperative adjuvant chemotherapy in stage II-III colorectal signet ring cell carcinoma (SRCC). Qualified postoperative patients were extracted from Surveillance, Epidemiology, and End Results (SEER) database from 2004 until 2015. We collected 1675 patients in the research, and 936 patients were subjected to adjuvant chemotherapy group. The proportions of married status, male, rectal cancer, grade III/IV, AJCC stage III and radiotherapy were higher; While, the rates of white race, ≥ 65 years old and located in cecum-transverse colon were lower in patients of chemotherapy group compared to no chemotherapy group (all P < 0.05). K-M plots revealed significantly better OS of adjuvant chemotherapy group than no chemotherapy group (P < 0.001). Meanwhile, there was no significantly different in CSS between the two groups (P = 0.93). However, after adjusting for confounding factors by multivariable Cox regression analysis, receipt of postoperative chemotherapy was still associated with better CSS and OS (CSS: hazard ratio [HR] = 0.719, 95% CI 0.612-0.844, P < 0.001) ; (OS: HR = 0.618, 95% CI 0.537-0.713, P < 0.001). Patients with stage II/III colorectal SRCC could receive survival benefit from postoperative adjuvant chemotherapy.

8.
Sci Rep ; 10(1): 13310, 2020 08 06.
Artigo em Inglês | MEDLINE | ID: mdl-32764626

RESUMO

To compare the clinicopathological characteristics and survival outcomes of children and adult diagnosed with medullary thyroid carcinoma (MTC). MTC patients were extracted from the Surveillance, Epidemiology and End Results (SEER) database from 1998 to 2016, followed by stratification into pediatric (< 20 years) or adult (≥ 20 years) groups. In total, 2,197 patients (110 pediatric and 2087 adult) with MTC were identified. Pediatric patients were more likely to have localized stage (70.0% vs. 51.6%), negative regional nodes (48.2% vs. 30.8%) and receive total/subtotal thyroidectomy surgery (97.3% vs. 85.3%). Moreover, CSS and OS rates were significantly higher in pediatric patients (both P < 0.001). Multivariable Cox regression analysis revealed that adult patients were significantly correlated with worse CSS and OS rates [(CSS: HR 11.60, 95% CI 1.62-83.02, P = 0.015); (OS: HR 5.63, 95% CI 2.08-15.25, P = 0.001)]. Further stratified analysis indicated that pediatric group might have significant better CSS and OS for patients with more advanced stage. Patients in the pediatric group were more likely to have earlier stage. Moreover, the prognosis of pediatric MTC patients was significantly better than that in adult patients.

9.
Nanoscale Res Lett ; 15(1): 117, 2020 May 24.
Artigo em Inglês | MEDLINE | ID: mdl-32449120

RESUMO

Bimetallic nanomaterials, which exhibit a combination of the properties associated with two different metals, have enabled innovative applications in nanoscience and nanotechnology. Here, we introduce the fabrication of dendritic Au/Ag bimetallic nanostructures for surface-enhanced Raman scattering (SERS) and catalytic applications. The dendritic Au/Ag bimetallic nanostructures were prepared by combining the electrochemical deposition and replacement reaction. The formation of Au nanoparticle shell on the surface of Ag dendrites greatly improves the stability of dendritic nanostructures, followed by a significant SERS enhancement. In addition, these dendritic Au/Ag bimetallic nanostructures are extremely efficient in degrading 4-nitrophenol (4-NP) compared with the initial dendritic Ag nanostructures. These experimental results indicate the great potential of the dendritic Au/Ag bimetallic nanostructures for the development of excellent SERS substrate and highly efficient catalysts.

10.
PeerJ ; 8: e8512, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32117621

RESUMO

Objectives: The survival benefit of postmastectomy radiotherapy (PMRT) has not been fully proven in inflammatory breast cancer (IBC). Thus, in the present research, we aimed at elucidating the effects of PMRT on the survival of IBC patients. Methods: Eligible patients were collected from the Surveillance, Epidemiology, and End Results (SEER) dataset between 2010 and 2013. The Kaplan-Meier method along with the log-rank test was utilized for the comparison of both the overall survival (OS) andthe cancer-specific survival (CSS) in patients undergoing PMRT or not. Additionally, multivariate survival analysis of CSS and OS were performed using the Cox proportional hazard model. Results: In total, 293 eligible cases were identified, with the median follow-up time of 27 months (range: 5-59 months). After propensity score matching (PSM), 188 patients (94 for each) were classified intothe No-PMRT and the PMRT group. Consequently, significantly higher OS rates were detected in the PMRT group compared with the No-PMRT group prior to PSM (P = 0.034), and significantly higher CSS (P = 0.013) and OS (P = 0.0063) rates were observed following PSM. Furthermore, multivariate analysis revealed thatPMRT [CSS (HR: 0.519, 95% CI [0.287-0.939], P = 0.030); OS (HR: 0.480, 95% CI [0.269-0.859], P = 0.013)], as well as Her2+/HR+ subtype, was independent favorable prognostic factors.Besides, black ethnicity, AJCC stage IV and triple-negative subtype were independent unfavorable prognostic factors. Further subgroup analysis revealed that most of the study population could benefit from PMRT, no matter OS or CSS. Conclusions: Our findings support that PMRT could improve the survival of IBC patients.

11.
Biosci Rep ; 40(1)2020 01 31.
Artigo em Inglês | MEDLINE | ID: mdl-31840737

RESUMO

The overall survival rate of patients with hepatocellular carcinoma (HCC) has remained unchanged over the last several decades. Therefore, novel drugs and therapies are required for HCC treatment. Isoliquiritigenin (ISL), a natural flavonoid predominantly isolated from the traditional Chinese medicine Glycyrrhizae Radix (Licorice), has a high anticancer potential and broad application value in various cancers. Here, we aimed to investigate the anticancer role of ISL in the HCC cell line Hep3B. Functional analysis revealed that ISL inhibited the proliferation of Hep3B cells by causing G1/S cell cycle arrest in vitro. Meanwhile, the inhibitory effect of ISL on proliferation was also observed in vivo. Further analysis revealed that ISL could suppress the migration and metastasis of Hep3B cells in vitro and in vivo. Mechanistic analysis revealed that ISL inhibited cyclin D1 and up-regulated the proteins P21, P27 that negatively regulate the cell cycle. Furthermore, ISL induced apoptosis while inhibiting cell cycle transition. In addition, phosphatidylinositol 3'-kinase/protein kinase B (PI3K/AKT) signal pathway was suppressed by ISL treatment, and the epithelial marker E-cadherin was up-regulated when the mesenchymal markers Vimentin and N-cadherin were down-regulated. In brief, our findings suggest that ISL could be a promising agent for preventing HCC tumorigenesis and metastasis.


Assuntos
Movimento Celular/efeitos dos fármacos , Proliferação de Células/efeitos dos fármacos , Chalconas/farmacologia , Ciclina D1/metabolismo , Fosfatidilinositol 3-Quinases/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Transdução de Sinais/efeitos dos fármacos , Animais , Apoptose/efeitos dos fármacos , Carcinoma Hepatocelular/tratamento farmacológico , Carcinoma Hepatocelular/metabolismo , Ciclo Celular/efeitos dos fármacos , Linhagem Celular Tumoral , Regulação para Baixo/efeitos dos fármacos , Feminino , Humanos , Neoplasias Hepáticas/tratamento farmacológico , Neoplasias Hepáticas/metabolismo , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Nus
12.
Bioorg Chem ; 94: 103487, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31831161

RESUMO

Based on the structural characteristics of aztreonam (AZN) and its target PBP3, a series of new monobactam derivatives bearing various substituents on oxime residue were prepared and evaluated for their antibacterial activities against susceptible and resistant Gram-negative bacteria. Among them, compounds 8p and 8r displayed moderate potency with MIC values of 0.125-32 µg/mL against most tested Gram-negative strains, comparable to AZN. Meanwhile, the combination of 8p and 8r with avibactam as a ß-lactamases inhibitor, in a ratio of 1:16, showed a promising synergistic effect against both ESBLs- and NDM-1-producing K. pneumoniae, with significantly reduced MIC values up to 8-fold and >256-fold respectively. Furthermore, both of them demonstrated excellent safety profiles both in vitro and in vivo. The results provided powerful information for further structural optimization of monobactam antibiotics to fight ß-lactamase-producing resistant Gram-negative bacteria.

13.
World J Clin Cases ; 7(23): 4119-4129, 2019 Dec 06.
Artigo em Inglês | MEDLINE | ID: mdl-31832417

RESUMO

BACKGROUND: Pancreatic mixed serous-neuroendocrine neoplasms (MSNNs) are mixed tumors containing two components with different pathologies, namely, pancreatic serous cystic neoplasm (PSCN) and pancreatic neuroendocrine tumor (PanNET). For MSNNs, diffuse PSCN involving the whole pancreas is extremely rare, with only eight previous case reports. CASE SUMMARY: A 45-year-old Chinese woman, with a free previous medical history and no obvious symptoms, was found to have a pancreatic neoplasm and admitted to our hospital for further diagnosis in March 2018. Abdominal palpation revealed a painless, mobile mass in the epigastrium, and no abnormalities were observed in an examination of the nervous system and ocular system. A computed tomography scan showed multiple cystic lesions involving the whole pancreas ranging in diameter from 0.4 to 2 cm and also revealed an enhanced mass, 2.2 cm in diameter, in the head of the pancreas. Moreover, multiple cysts were found in the kidneys bilaterally, and the right lobe of the liver contained a small cyst. A Whipple operation with total pancreatectomy and splenectomy was performed. A diagnosis of pancreatic MSNN was established, consisting of diffuse serous microcystic cystadenoma with a concomitant grade 2 PanNET. Of note, the patient had no personal or family history of Von Hippel-Lindau syndrome or other disease. CONCLUSION: We report the first case of MSNN with a diffuse PSCN component involving the entire pancreas in a Chinese woman. It is important to be aware of its relationship with VHL syndrome, and close clinical follow-up is recommended.

14.
Chin Med J (Engl) ; 132(23): 2827-2834, 2019 Dec 05.
Artigo em Inglês | MEDLINE | ID: mdl-31856054

RESUMO

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.


Assuntos
Meningite Criptocócica/líquido cefalorraquidiano , Meningite Criptocócica/genética , Biologia Computacional , Cryptococcus/patogenicidade , Testes Diagnósticos de Rotina , Feminino , Genótipo , Humanos , Masculino , Meningite Criptocócica/diagnóstico , Análise Multivariada
15.
PeerJ ; 7: e7837, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31632852

RESUMO

Objective: The study was designed to construct and validate a nomogram for predicting overall survival (OS) of male breast cancer (MBC) patients with infiltrating duct carcinoma (IDC). Methods: The cohort was selected from the Surveillance, Epidemiology, and End Results (SEER) database between January 1, 2004 and December 31, 2013. Univariate and multivariate Cox proportional hazard (PH) regression models were performed. A nomogram was developed based on the significant prognostic indicators of OS. The discriminatory and predictive capacities of nomogram were assessed by Harrell's concordance index (C-index), calibration plots, area under the curve (AUC) and the decision curve analysis (DCA). Results: The median and maximal survival time of 1862 eligible patients were 49 and 131 months, respectively. Multivariate analysis showed that age (P < 0.0001), marital status (P = 0.002), T stage (P < 0.0001), N stage (P = 0.021), M stage (P < 0.0001), progesterone receptor (PR) (P = 0.046), human epidermal growth factor receptor-2 (HER2) (P = 0.009), and chemotherapy (P = 0.003) were independent prognostic indicators of IDC of MBC. The eight variables were then combined to construct a 3-and 5-year nomogram. The C-indexes of the nomogram were0.740 (95% confidence interval [CI] [0.709-0.771]) and 0.718 (95% CI [0.672-0.764]) for the internal validation and external validation, respectively. A better discriminatory capacity was observed in the nomogram compared with the SEER summary stage (P < 0.001) and AJCC TNM staging systems (6th edition; P < 0.001) with respect to OS prediction. Good consistency was detected between the nomogram prediction and actual findings, as indicated by calibration curves. The AUC for 3-and 5-year OS was 0.739 (95% CI [0.693-0.786]) and 0.764 (95% CI [0.725-0.803]) in the training cohort and 0.737 (95% CI [0.671-0.803]) and 0.735 (95% CI [0.678-0.793]) in the validation cohort, respectively. The DCA demonstrated that the survival nomogram was clinically useful. Conclusions: The nomogram was able to more accurately predict 3-and 5-year OS of MBC patients with IDC histology than were existing models.

16.
Breast Cancer Res Treat ; 178(2): 379-388, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31414242

RESUMO

OBJECTIVES: The aim of this analysis was to study the impact of marital status on inflammatory breast cancer (IBC) patients, as the prognostic impact is yet to be studied in detail. METHODS: Data of IBC patients from 2004 to 2010 were sorted out from the database of surveillance, epidemiology, and end results (SEER), and overall survival (OS) rates and breast cancer-specific survival (CSS) rates were compared between a group of married and unmarried patients. The comparison was performed by Kaplan-Meier method with log-rank test, and multivariate survival analysis of CSS and OS was performed using the Cox proportional hazard model. RESULTS: Data of 1342 patients were collected from the SEER database, on an average 52% of married patients (n = 698, 52.01%) and 48% of unmarried patients (n = 644, 47.99%) for this analysis. Married patients were more likely to be more younger (aged ≤ 56) (52.44% vs. 43.94%), white ethnicity (83.24% vs. 71.58%), HoR positive (48.28% vs. 41.61%), more patients received surgery (78.51% vs. 64.60%), chemotherapy (90.69% vs. 80.12%) and radiotherapy (53.44% vs. 44.41%) compared to unmarried group, and less likely to be AJCC stage IV (26.22% vs. 35.40%) (All P ˂ 0.05). Married patients had better 5-year CSS (74.90% vs. 65.55%, P < 0.0001) and OS rates (45.43% vs. 33.11%, P < 0.0001). The multivariate analysis revealed that marital status is an independent prognostic factor, whereas the data of unmarried patients showed worse CSS (HR 1.188; 95% CI 1.033-1.367; P = 0.016) and OS rates (HR 1.245; 95% CI 1.090-1.421; P = 0.001).The subgroup analysis further revealed that the OS and CSS rates in the married group were better than the unmarried group, regardless of different AJCC stages. CONCLUSION: Marital status was an independent prognostic indicator in IBC patients. As the study reveals, the CSS and OS rates of the married patients were better than those of the unmarried patients.


Assuntos
Neoplasias Inflamatórias Mamárias/epidemiologia , Estado Civil , Adulto , Idoso , Idoso de 80 Anos ou mais , Animais , Bases de Dados Factuais , Modelos Animais de Doenças , Suscetibilidade a Doenças , Feminino , Humanos , Neoplasias Inflamatórias Mamárias/diagnóstico , Neoplasias Inflamatórias Mamárias/mortalidade , Neoplasias Inflamatórias Mamárias/terapia , Estimativa de Kaplan-Meier , Pessoa de Meia-Idade , Gradação de Tumores , Estadiamento de Neoplasias , Vigilância da População , Prognóstico , Modelos de Riscos Proporcionais , Medição de Risco , Fatores de Risco , Programa de SEER , Adulto Jovem
17.
Acta Neuropsychiatr ; 31(6): 316-324, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31405402

RESUMO

OBJECTIVE: To explore whether and how group cognitive-behavioural therapy (GCBT) plus medication differs from medication alone for the treatment of generalised anxiety disorder (GAD). METHODS: Hundred and seventy patients were randomly assigned to the GCBT plus duloxetine (n=89) or duloxetine group (n=81). The primary outcomes were Hamilton Anxiety Scale (HAMA) response and remission rates. The explorative secondary measures included score reductions from baseline in the HAMA total, psychic, and somatic anxiety subscales (HAMA-PA, HAMA-SA), the Hamilton Depression Scale, the Severity Subscale of Clinical Global Impression Scale, Global Assessment of Functioning, and the 12-item Short-Form Health Survey. Assessments were conducted at baseline, 4-week, 8-week, and 3-month follow-up. RESULTS: At 4 weeks, HAMA response (GCBT group 57.0% vs. control group 24.4%, p=0.000, Cohen's d=0.90) and remission rates (GCBT group 21.5% vs. control group 6.2%, p=0.004; d=0.51), and most secondary outcomes (all p<0.05, d=0.36-0.77) showed that the combined therapy was superior. At 8 weeks, all the primary and secondary significant differences found at 4 weeks were maintained with smaller effect sizes (p<0.05, d=0.32-0.48). At 3-month follow-up, the combined therapy was only significantly superior in the HAMA total (p<0.045, d=0.43) and HAMA-PA score reductions (p<0.001, d=0.77). Logistic regression showed superiority of the combined therapy for HAMA response rates [odds ratio (OR)=2.12, 95% confidence interval (CI) 1.02-4.42, p=0.04] and remission rates (OR=2.80, 95% CI 1.27-6.16, p=0.01). CONCLUSIONS: Compared with duloxetine alone, GCBT plus duloxetine showed significant treatment response for GAD over a shorter period of time, particularly for psychic anxiety symptoms, which may suggest that GCBT was effective in changing cognitive style.


Assuntos
Transtornos de Ansiedade/terapia , Terapia Cognitivo-Comportamental/métodos , Terapia Combinada/métodos , Cloridrato de Duloxetina/uso terapêutico , Adolescente , Adulto , Idoso , Transtornos de Ansiedade/tratamento farmacológico , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Escalas de Graduação Psiquiátrica , Psicoterapia de Grupo , Inibidores da Recaptação de Serotonina e Norepinefrina/uso terapêutico , Resultado do Tratamento , Adulto Jovem
18.
PeerJ ; 7: e6539, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-30944773

RESUMO

Background: This study was designed to investigate the clinicopathological characteristics, treatment and survival of patients with pulmonary large cell neuroendocrine carcinoma (LCNEC). Methods: The Surveillance, Epidemiology and End Results database was utilized to identify patients diagnosed with pulmonary LCNEC between 2004 and 2013. Kaplan-Meier analysis was conducted to determine the overall survival (OS) and cancer-specific survival (CSS) rate. Univariate survival analysis along with log-rank test, and Cox proportional hazards model were employed to detect independent prognostic factors. Results: Pulmonary LCNEC accounted for 0.58% (2972/510607) of the total number of lung and bronchus carcinoma. And a total of 1,530 eligible cases were identified, with the median follow-up time of 11 months. To be specific, the 3-, 5-year OS and CSS rates were 22.8%, 16.8% and 26.5%, 20.8% respectively. Generally, pulmonary LCNEC was commonly detected in the elderly (72.2%), males (55.9%), the upper lobe (62.0%) and advanced AJCC stage (65.5%). Multivariate analysis revealed that elderly [(≥60 and <80 years) HR:1.203, 95% CI [1.053-1.375], P = 0.007; (≥80 years) HR:1.530, 95% CI [1.238-1.891], P < 0.001] and advanced AJCC stage [(stage III) HR:2.606, 95% CI [2.083-3.260], P < 0.001; (stage IV) HR:4.881, 95% CI [3.923-6.072], P < 0.001] were independent unfavorable prognostic factors, and that female (HR:0.845, 95% CI [0.754-0.947], P = 0.004)), surgery [(Segmentectomy/wedge resection) HR:0.526, 95% CI [0.413-0.669], P < 0.001; (Lobectomy/Bilobectomy) HR:0.357, 95% CI [0.290-0.440], P < 0.001;(Pneumonectomy) HR:0.491, 95% CI [0.355-0.679], P < 0.001] , chemotherapy (HR:0.442, 95% CI [0.389-0.503], P < 0.001) and radiation (HR:0.837, 95% CI [0.738-0.949], P = 0.005) were independent favorable prognostic factors. Conclusion: To sum up, age at diagnosis, sex, AJCC 8th edition stage, surgery, chemotherapy and radiation were significantly associated with OS of patients with pulmonary LCNEC.

19.
Nanoscale Res Lett ; 14(1): 89, 2019 Mar 12.
Artigo em Inglês | MEDLINE | ID: mdl-30868364

RESUMO

Highly branched metallic nanostructures, which possess a large amount of catalyst active sites and surface-enhanced Raman scattering (SERS) hot spots owing to their large surface areas, multi-level branches, corners, and edges, have shown potential in various applications including catalysis and SERS. In this study, well-defined dendritic silver (Ag) nanostructures were prepared by a facile and controllable electrochemical deposition strategy. The morphology of Ag nanostructures is controlled by regulating electrodeposition time and concentration of AgNO3 in the electrolyte solution. Compared to conventional Ag nanoparticle films, dendritic Ag nanostructures exhibited larger SERS enhancement ascribed to the numerous hot spots exist in the nanogaps of parallel and vertically stacked multilayer Ag dendrites. In addition, the prepared dendritic Ag nanostructures show 3.2-fold higher catalytic activity towards the reduction of 4-nitrophenol (4-NP) by NaBH4 than the Ag nanoparticle films. The results indicate that the dendritic Ag nanostructures represent a unique bifunctional nanostructure that serves as both efficient catalysts and excellent SERS substrates, which may be further employed as a nanoreactor for in situ investigation and real-time monitoring of catalytic reactions by SERS technique.

20.
Molecules ; 24(3)2019 Feb 02.
Artigo em Inglês | MEDLINE | ID: mdl-30717338

RESUMO

Nineteen new quinoline derivatives were prepared via the Mannich reaction and evaluated for their antibacterial activities against both Gram-positive (G⁺) and Gram-negative (G-) bacteria, taking compound 1 as the lead. Among the target compounds, quinolone coupled hybrid 5d exerted the potential effect against most of the tested G⁺ and G- strains with MIC values of 0.125⁻8 µg/mL, much better than those of 1. Molecular-docking assay showed that compound 5d might target both bacterial LptA and Top IV proteins, thereby displaying a broad-spectrum antibacterial effect. This hybridization strategy was an efficient way to promote the antibacterial activity of this kind, and compound 5d was selected for the further investigation, with an advantage of a dual-target mechanism of action.


Assuntos
Antibacterianos/química , Bactérias Gram-Negativas/efeitos dos fármacos , Bactérias Gram-Positivas/efeitos dos fármacos , Quinolinas/química , Antibacterianos/síntese química , Antibacterianos/farmacologia , Proteínas de Transporte/química , Proteínas de Escherichia coli/química , Bactérias Gram-Negativas/patogenicidade , Bactérias Gram-Positivas/patogenicidade , Testes de Sensibilidade Microbiana , Simulação de Acoplamento Molecular , Quinolinas/síntese química , Quinolinas/farmacologia , Relação Estrutura-Atividade
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...