Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 214
Filtrar
2.
Environ Int ; 139: 105688, 2020 Mar 31.
Artigo em Inglês | MEDLINE | ID: mdl-32244100

RESUMO

This study examined the associations between concentrations of cobalt (Co), iron (Fe), manganese (Mn), molybdenum (Mo), selenium (Se), and zinc (Zn) in placental tissue and risks for NTDs with a case-control design consisting of 408 fetuses or newborns with neural tube defects (NTDs) and 593 non-malformed fetuses or newborns. The concentrations of Zn and Fe were determined by inductively coupled plasma-emission spectrometer and the other four elements by inductively coupled plasma-mass spectrometer. Element concentrations were presented in ng/g or µg/g dry weight of placental tissue. The associations between the levels of each of the six ETEs and risk for NTDs were evaluated using multivariable logistic regression, and the associations between overall levels of all six ETEs and risk for NTDs were examined using Bayesian kernel machine regression (BKMR). Concentrations above the median concentration of all participants for an individual element were associated with increased risk for NTDs: Mn, 3.17-fold (95% CI 2.35-4.28); Mo, 3.73-fold (95% CI 2.74-5.07); Se, 3.28-fold (95% CI 2.44-4.42); and Zn, 2.85-fold (95% CI 2.13-3.83), and a decreased risk for Co [OR, 0.18 (95% CI 0.14-0.25)]. The risk for NTDs increased with the increase in the concentrations of Mn, Mo, Se, and Zn, but decreased for Co, in the second, third, and fourth quartiles, respectively, compared to their lowest quartile (all Pstrend < 0.01). In BKMR model, the risk for NTDs increased constantly when the overall exposure levels were higher than the median of the six ETEs as a co-exposure mixture, and the associations between Co, Mn, Se, and Zn and NTD risk remained when the remaining five elements were taken into consideration simultaneously. Taken together, when evaluated individually, higher levels of Mn, Se, and Zn in placental tissue are associated with increased risk for NTDs, while higher levels of Co are associated with decreased risk for NTDs; when examined collectively, the risk of NTDs increases continuously when exposure levels are higher than the median of the six ETE mixture.

3.
Hypertens Res ; 2020 Apr 22.
Artigo em Inglês | MEDLINE | ID: mdl-32322045

RESUMO

Our objective was to examine whether high blood pressure in the preconception period was associated with gestational hypertension and preeclampsia in Chinese women. Data were obtained from the China-US Collaborative Project for Neural Tube Defects Prevention, a large population-based cohort study. We included 45,628 women who were registered before pregnancy in seven counties in South China. Blood pressure was measured during registration by trained health care workers, and other health-related information was recorded prospectively. We used logistic regression to evaluate the associations between preconception blood pressure and the risk of gestational hypertension and preeclampsia, adjusting for potential confounders. The prevalence of hypertension in the preconception study population was 4.57% (2083/45,628). The incidences of gestational hypertension and preeclampsia were 11.95% and 4.08%, respectively, in the hypertension group and 8.60% and 2.28%, respectively, in the nonhypertension group. Compared with the nonhypertension group, the hypertension group showed a significantly increased risk for gestational hypertension [adjusted risk ratio (RR) = 1.40, 95% confidence interval (CI): 1.22-1.60] and preeclampsia [adjusted RR = 1.75, 95% CI: 1.39-2.19]. When participants with normal blood pressure were used as the reference, the adjusted ORs for gestational hypertension were 1.48 (95% CI: 1.37-1.59), 1.70 (95% CI: 1.44-2.01), and 1.29 (95% CI: 1.02-1.64), and for preeclampsia, the adjusted ORs were 1.55 (95% CI: 1.35-1.78), 1.95 (95% CI: 1.46-2.60), and 1.99 (95% CI: 1.39-2.85) for the participants with prehypertension, stage 1 hypertension, and stage 2 hypertension, respectively. Our results support an association between hypertension or higher blood pressure prior to pregnancy and an increased risk of gestational hypertension and preeclampsia.

5.
Ecotoxicol Environ Saf ; 194: 110405, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-32163773

RESUMO

The association between environmental pollution and risk of influenza-like illness (ILI) among general population has been reported. However, the relationships between the individual pollutants and ILI risk are still under discussion. Our study aimed to explore the associations of the typical environmental polycyclic aromatic hydrocarbons (PAHs) and metal(loid)s with ILI risk among women population. We carried out a cross-sectional study and included a total of 396 housewives in Shanxi Province, China. The information on their general characteristics and ILI frequency was collected by questionnaire. We collected their hair samples and analyzed the concentrations of PAHs and various metal(loid)s. The results indicated that only acenaphthylene concentration of the nine detected PAH congeners in the hair was significantly associated with ILI risk with adjusted odds ratio (AOR) and 95% confidence interval (95% CI) of 0.58 (0.38 - 0.91). Among the concerned 4 toxic metal(loid)s and 15 rare earth elements, only the hair concentration of arsenic had a positive dose-response relationship with ILI risk. In addition, we found that there were negative dose-response associations of the three essential trace elements (i.e. chromium, cobalt, and nickel), and four essential alkaline earth elements (i.e. magnesium, calcium, strontium, barium) with ILI risk. It was concluded that the environmental exposure to certain compounds of housewives may contribute to their ILI development.

6.
Sci Total Environ ; 718: 137300, 2020 May 20.
Artigo em Inglês | MEDLINE | ID: mdl-32097838

RESUMO

Hair analysis has been an important approach in evaluating population exposure to various environmental factors. To meet the requirements of human environmental epidemiology studies, we aimed to develop an efficient method for simultaneous analysis of various metal(loid)s and some typical environmental halogenated endocrine disrupting chemicals (hEDCs) (i.e., polychlorinated biphenyls, polybrominated diphenyl ethers, and organochlorine pesticides, as well as some of their hydroxyl substituted metabolites) in a single hair sample. The hair was washed successively with surfactant solutions, methanol solvent, and deionized water to remove impurities attached to the hair surface. Efficiency was comprehensively compared among various washing strategies. The hair sample was further pulverized into fine powder with a median diameter (25th-75th percentile) of 8.6 (5.9-13.5) µm. The hair organic components were extracted by acetonitrile solvent and compared with the microwave-assisted extraction method. The hEDCs in the supernatant acetonitrile phase were quantified by gas chromatography-mass spectrometry, and the metal(loid)s in the precipitate hair were further analyzed by inductively coupled plasma mass spectrometry. Our developed method was further applied to analyze the hair samples of 165 pregnant women. The results showed that particles attached to the surface of the hair could not be washed off completely. However, we proposed a protocol framework to wash hair with relatively high efficience, which includes warm water incubation, and use of surfactant and organic solvent. The recoveries of the concerned hEDCs and metal(loid)s were overall in the range of 80% to 120%. For the women population, the method can efficiently recognize the typical exposure characteristics of the concerned hEDCs and metal(loid)s. Our study significantly ameliorated the deficiencies of the traditional hair washing strategy and developed an efficient method for simultaneous analysis of various metal(loid)s and hEDCs in a single hair sample. This method will provide important support for population complex exposure analysis and facilitate environmental exposome studies.

7.
Environ Int ; 137: 105542, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32059143

RESUMO

Rare earth elements (REEs) are ubiquitous in the environment. Animal experiments have shown that many REEs have adverse impacts on the health of fetuses. However, data from humans are scarce. In this study, we examined the associations between concentrations of 10 REEs in maternal serum and the risk for fetal neural tube defects (NTDs). The study included 200 pregnant women with pregnancies affected by NTDs and 400 pregnant women with healthy fetuses/infants. Fifteen REEs in maternal serum were assessed; 10 of them were detectable in over 60% of samples and were included in statistical analyses, including lanthanum (La), cerium (Ce), praseodymium (Pr), neodymium (Nd), samarium (Sm), europium (Eu), terbium (Tb), dysprosium (Dy), lutetium (Lu), and yttrium (Y). When the elements were considered individually with the use of Logistic regression model, the risk for NTDs increased by 2.78-fold (1.25-6.17) and 4.31-fold (1.93-9.62) for La, and 1.52-fold (0.70-3.31) and 4.73-fold (2.08-10.76) for Ce, in the second and third tertiles, respectively, compared to the lowest concentration tertile. When Bayesian kernel machine regression was used to examine the joint effect of exposure to all 10 REEs, the risk for NTDs increased with overall levels of these REEs and the association between La and NTD risk remained when other nine elements were taken into consideration simultaneously. Taken together, this study shows that the risk for NTDs increases with La concentrations when single REEs are considered and with concentrations of all 10 REEs when these REEs are considered as a co-exposure mixture.

8.
Environ Int ; 137: 105584, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32106049

RESUMO

Hair metal(loid)s are often measured as biomarkers to evaluate population internal exposure, however, hair samples could be easily contaminated by ambient particulate matter (PM) pollution. Here, we evaluated the potential external interference from ambient PM pollution on using hair metal(loid)s for population biomarker-based exposure assessment. The raw hair samples were strictly washed and placed under various indoor and outdoor scenarios for ~6 months at sites with high PM pollution. The contaminated hair was then washed using the same method. A total of 33 hair elements were quantified by inductively coupled plasma-mass spectrometry. The surface residual PM on hair after washing was observed by scanning electron microscopy. In addition, we chose a practical exposure scenario including 77 housewives in Shanxi Province, China for validation. The results for the hair exposure experiment revealed that external contamination of some elements that had relatively high concentrations in hair was generally mild in both indoor and outdoor exposure scenarios (i.e., Zn, Mg, Se, Fe, Sr, Ti, Mn, Sn, Ge, U, Co, Mo, and As). A relatively higher external contamination of other elements (e.g., Al, Cr, Pb, Cd, Li, and most rare earth elements (REEs)) was observed, especially for those elements with relatively low hair concentrations (e.g., Cd, and REEs) in the outdoor environment. This finding was due mainly to some small ambient PM not being fully removed by the current washing strategy when the hair sample was heavily contaminated. However, results from practical exposure scenario of the housewives showed that there were overall no significant differences of hair metal(loid)s between the housewives using coal and clean energy for cooking. We concluded that the external interference on hair internal metal(loid) analysis could be negligible when hair was efficiently washed, especially for population with relatively longer indoor activities. It is therefore promising to use hair analysis for their population exposure assessment.

9.
Clin Imaging ; 62: 57-62, 2020 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-32066034

RESUMO

OBJECTIVES: Cerebral artery fenestrations detected incidentally during computed tomographic angiography (CTA) or magnetic resonance angiography (MRA) are reported to be associated with aneurysmal dilatation, which may cause cerebrovascular diseases, arteriovenous malformations, or, rarely, ischemic symptoms. METHODS: We retrospectively analyzed CTA and MRA of patients with cerebral artery fenestration examined between January 2014 and December 2017. The location, shape, and other associated vascular diseases were described. RESULTS: Two hundred eleven cerebral artery fenestrations were found in 208 patients for a detection rate of 1.13% (208/18,360). Basilar artery fenestrations were most common, accounting for 50.2% (106/211). The fenestration was <5 mm in 115 patients (54.5%), 5-10 mm in 63 (29.9%), and ≥10 mm in 33 (15.6%). Forty-one patients had other vascular malformations, including 29 aneurysms. Except for one aneurysm, which was at the site of the fenestration, all other aneurysms were separate from the fenestrations. 26 patients had cerebral infarctions; among them, 11 had cerebral infarctions in the blood supply area of the arterial fenestration. CONCLUSIONS: Cerebral artery fenestration is an uncommon finding at cerebral imaging, but mostly affects the basilar artery. Cerebral artery fenestrations could be associated with cerebrovascular diseases and malformations, but the present study could not evaluate the cause-to-effect relationship.

10.
Environ Res ; 182: 109103, 2020 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-31918316

RESUMO

BACKGROUND: Orofacial clefts (OFCs) are common kind of congenital malformations. The teratogenicity of uranium (U) has been documented in animal study that maternal exposure to U can increase incidence of external malformations including cleft palate. However, there is limited evidence of the association of in utero exposure to U with OFCs risk in humans. OBJECTIVE: This study aimed to investigate the association between in utero exposure to U and the risk of OFCs and its subtypes. METHOD: All subjects were from a case-control study in Shanxi Province, northern China. Eighty-four OFCs cases and 142 healthy controls were included in this study. We used U concentration in umbilical cord as biomarkers to represent intrauterine exposure, which was detected by inductively coupled plasma mass spectrometry. Unconditional logistic regression was used to investigated the association between U level and the risk of OFCs and its subtypes. RESULTS: The median of U concentration in umbilical cord is 0.745 ng/g in case group and 0.455 ng/g in control group. When the U concentration was divided into two categories, high level of U exposure increased the risk of OFCs (OR: 2.08, 95% CI: 1.13-3.86) and its subtype cleft lip with cleft palate (CLP) (OR: 2.72, 95% CI: 1.21-6.14). When divided into three categories, high level of U elevated the risk for OFCs (OR: 2.40, 95% CI: 1.14-5.06) and CLP (OR: 3.04, 95% CI: 1.20-7.74). Meanwhile, a dose-response relationship between the U concentration and the risk of total OFCs (P for trend = 0.009) and CLP (P for trend = 0.007) was found. CONCLUSION: Our study found that in utero exposure to high level of U was associated with increased risk of OFCs and its subtype CLP.

11.
Sci Total Environ ; 712: 136542, 2020 Apr 10.
Artigo em Inglês | MEDLINE | ID: mdl-31945535

RESUMO

BACKGROUND: Disturbances in the homeostasis of essential trace elements (ETEs) may interfere with embryonic organogenesis. However, the effect of ETEs on the development of orofacial clefts (OFCs) remains unclear. OBJECTIVES: This study examined associations between concentrations of iron (Fe), zinc (Zn), selenium (Se), cuprum (Cu), cobalt (Co), and molybdenum (Mo) in maternal serum and risk for OFCs in offspring. METHODS: A total of 130 cases of OFCs and 260 nonmalformed controls were included in this study. Concentrations of Fe, Zn, Se, Cu, Co, and Mo in maternal serum were detected by inductively coupled plasma mass spectrometry. We examined associations between levels of the six ETEs in maternal serum and risk for OFCs for each element separately using multilevel mixed-effects logistic regression and for all elements collectively using Bayesian kernel machine regression (BKMR). RESULTS: Higher concentrations of Mo and Co in maternal serum were associated with a decreased risk for OFCs in a dose-dependent manner, with odds ratios and 95% confidence intervals of 0.37 (0.20-0.66) for the second tertile of Mo, 0.28 (0.15-0.54) for the third tertile of Mo, 0.54 (0.29-1.00) for the second tertile of Co, and 0.47 (0.25-0.87) for the third tertile of Co, with the lowest tertile as the referent. When all six ETEs were considered together, increased levels of ETEs were associated with a decreased risk for OFCs. In addition, Mo showed a protective effect against risk for OFCs when the other ETEs were fixed at their 25th, 50th, or 75th percentile, whereas the protective effect of Co turned to a null effect in the BKMR model. No association was observed between levels of Fe, Zn, Se, or Cu and risk for OFCs in either statistical model. CONCLUSION: Elevated concentrations of Mo in maternal serum were associated with a reduced risk for OFCs.


Assuntos
Fenda Labial , Fissura Palatina , Teorema de Bayes , Humanos , Selênio , Oligoelementos
12.
J Knee Surg ; 33(2): 200-205, 2020 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30650442

RESUMO

The effect of residual varus on survival rate and function in patients with varus knee osteoarthritis (OA) was considered an important issue for successful primary total knee arthroplasty (TKA). In this study, we compared the midterm clinical and functional outcomes in patients with different residual varus. A retrospective review of 175 patients (219 knees) with varus OA was > 3° for the hip-knee-ankle (HKA) who underwent primary TKA after exclusions and loss to follow-up from 237 patients (281 knees). The mean follow-up period was 5.2 ( ± 1.1) years. Patients were divided into four groups according to the first postoperative HKA angle from weight-bearing full-leg radiographs: "valgus" group (HKA angle > 0°, n = 44), "neutral" group (-3° ≤ HKA angle < 0°, n = 86), "mild varus" group (-6° ≤ HKA angle < -3°, n = 62), and "severe varus" group (HKA angle < -6°, n = 27). Survival analysis, Knee Society Score (KSS, including knee score and functional score), and Western Ontario and McMaster Universities Osteoarthritis Index (WOMAC) were compared among the four groups. No knee required revision surgery during follow-up. For the KSS knee score and functional score at the last follow-up, the neutral and mild varus groups were better compared with the valgus and severe varus groups (p < 0.05), and there were no significant differences between the neutral and mild varus groups (p > 0.05). WOMAC scores of the neutral and mild varus groups were also better compared with the valgus and severe varus groups (p < 0.05), and there were no significant differences between the neutral and mild varus groups at the last follow-up. The postoperative HKA angle was significantly changed in valgus group between first and at the last follow-up when compared with the other three groups (p < 0.05). Leaving an HKA angle at < 6° varus had the same excellent functional outcome as neutral mechanical alignment after TKA for varus-type OA in the 5-year follow-up, using mechanically aligned technique. Caution is advised when leaving valgus or leaving severe varus after TKA.

13.
Bioorg Chem ; 94: 103487, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31831161

RESUMO

Based on the structural characteristics of aztreonam (AZN) and its target PBP3, a series of new monobactam derivatives bearing various substituents on oxime residue were prepared and evaluated for their antibacterial activities against susceptible and resistant Gram-negative bacteria. Among them, compounds 8p and 8r displayed moderate potency with MIC values of 0.125-32 µg/mL against most tested Gram-negative strains, comparable to AZN. Meanwhile, the combination of 8p and 8r with avibactam as a ß-lactamases inhibitor, in a ratio of 1:16, showed a promising synergistic effect against both ESBLs- and NDM-1-producing K. pneumoniae, with significantly reduced MIC values up to 8-fold and >256-fold respectively. Furthermore, both of them demonstrated excellent safety profiles both in vitro and in vivo. The results provided powerful information for further structural optimization of monobactam antibiotics to fight ß-lactamase-producing resistant Gram-negative bacteria.

14.
Biosci Rep ; 40(1)2020 01 31.
Artigo em Inglês | MEDLINE | ID: mdl-31840737

RESUMO

The overall survival rate of patients with hepatocellular carcinoma (HCC) has remained unchanged over the last several decades. Therefore, novel drugs and therapies are required for HCC treatment. Isoliquiritigenin (ISL), a natural flavonoid predominantly isolated from the traditional Chinese medicine Glycyrrhizae Radix (Licorice), has a high anticancer potential and broad application value in various cancers. Here, we aimed to investigate the anticancer role of ISL in the HCC cell line Hep3B. Functional analysis revealed that ISL inhibited the proliferation of Hep3B cells by causing G1/S cell cycle arrest in vitro. Meanwhile, the inhibitory effect of ISL on proliferation was also observed in vivo. Further analysis revealed that ISL could suppress the migration and metastasis of Hep3B cells in vitro and in vivo. Mechanistic analysis revealed that ISL inhibited cyclin D1 and up-regulated the proteins P21, P27 that negatively regulate the cell cycle. Furthermore, ISL induced apoptosis while inhibiting cell cycle transition. In addition, phosphatidylinositol 3'-kinase/protein kinase B (PI3K/AKT) signal pathway was suppressed by ISL treatment, and the epithelial marker E-cadherin was up-regulated when the mesenchymal markers Vimentin and N-cadherin were down-regulated. In brief, our findings suggest that ISL could be a promising agent for preventing HCC tumorigenesis and metastasis.

15.
World J Clin Cases ; 7(23): 4119-4129, 2019 Dec 06.
Artigo em Inglês | MEDLINE | ID: mdl-31832417

RESUMO

BACKGROUND: Pancreatic mixed serous-neuroendocrine neoplasms (MSNNs) are mixed tumors containing two components with different pathologies, namely, pancreatic serous cystic neoplasm (PSCN) and pancreatic neuroendocrine tumor (PanNET). For MSNNs, diffuse PSCN involving the whole pancreas is extremely rare, with only eight previous case reports. CASE SUMMARY: A 45-year-old Chinese woman, with a free previous medical history and no obvious symptoms, was found to have a pancreatic neoplasm and admitted to our hospital for further diagnosis in March 2018. Abdominal palpation revealed a painless, mobile mass in the epigastrium, and no abnormalities were observed in an examination of the nervous system and ocular system. A computed tomography scan showed multiple cystic lesions involving the whole pancreas ranging in diameter from 0.4 to 2 cm and also revealed an enhanced mass, 2.2 cm in diameter, in the head of the pancreas. Moreover, multiple cysts were found in the kidneys bilaterally, and the right lobe of the liver contained a small cyst. A Whipple operation with total pancreatectomy and splenectomy was performed. A diagnosis of pancreatic MSNN was established, consisting of diffuse serous microcystic cystadenoma with a concomitant grade 2 PanNET. Of note, the patient had no personal or family history of Von Hippel-Lindau syndrome or other disease. CONCLUSION: We report the first case of MSNN with a diffuse PSCN component involving the entire pancreas in a Chinese woman. It is important to be aware of its relationship with VHL syndrome, and close clinical follow-up is recommended.

16.
Chin Med J (Engl) ; 132(23): 2827-2834, 2019 Dec 05.
Artigo em Inglês | MEDLINE | ID: mdl-31856054

RESUMO

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.


Assuntos
Meningite Criptocócica/líquido cefalorraquidiano , Meningite Criptocócica/genética , Biologia Computacional , Cryptococcus/patogenicidade , Testes Diagnósticos de Rotina , Feminino , Genótipo , Humanos , Masculino , Meningite Criptocócica/diagnóstico , Análise Multivariada
17.
J Matern Fetal Neonatal Med ; : 1-5, 2019 Dec 18.
Artigo em Inglês | MEDLINE | ID: mdl-31852307

RESUMO

Objective: To assess the relationship between preconception body mass index (BMI) and cervical length (CL).Methods: Data was collected from a prospective cohort study conducted in Beijing, China. A total of 4843 qualified women participated in this study, whose health-related information was recorded at the very beginning and their cervical length was measured with transvaginal ultrasound examination during 22-24 gestational weeks. Logistic regression was used to evaluate the relationship between preconception BMI and cervical length, after adjusting for potential confounders.Results: Of all the participants in the analysis, 580 (12.0%) women had a short cervical length (CL less than 30 mm). After adjusting for the age and parity status, the adjusted odds ratios of short CL for underweight: adjusted OR = 1.28 (95% CI: 1.02, 1.60); overweight: adjusted OR = 0.74 (95% CI: 0.55, 0.99); obesity: adjusted OR = 0.38 (95% CI: 0.17, 0.88) compared with normal weight. The mean CL in underweight, normal weight, overweight and obesity group demonstrated a significant linear increased trend (33.47, 34.16 and 34.96 mm, respectively) (p < .05), dependent of age and parity.Conclusions: This research revealed that low preconception BMI women were more likely to have a short CL.

18.
Chin Med J (Engl) ; 2019 Nov 22.
Artigo em Inglês | MEDLINE | ID: mdl-31764170

RESUMO

BACKGROUND: Cryptococcal meningitis is a severe infectious disease associated with high morbidity and mortality. Rapidity and accuracy of diagnosis contribute to better prognosis, but readily available tools, such as microscopy, culture, and antigens do not perform well all the time. Our study attempted to diagnose and genotype cryptococcus in the cerebrospinal fluid (CSF) samples from patients with cryptococcal meningitis using the approach of metataxonomics of Internal Transcribed Spacer (ITS) amplicons. METHODS: The CSF samples were collected from 11 clinically suspected cryptococcal meningitis patients and four non-infectious controls. Samples were recruited from the First Affiliated Hospital of Fujian Medical University Hospital, Fuzhou Fourth Hospital and the 476th Hospital of Chinese People's Liberation Army from December 2017 to December 2018. ITS1 ribosomal deoxyribonucleic acid (rDNA) genes of 15 whole samples were amplified by universal forward primer ITS1 (CTTGGTCATTTAGAGGAAGTAA) and reverse primer ITS2 (GCTGCGTTCTTCATCGATGC), sequenced by Illumina MiSeq Benchtop Sequencer. The results were confirmed by sanger sequencing of ITS1 region and partial CAP59 gene of microbial isolates from 11 meningitic samples. Pair-wise comparison between infectious group and control group was conducted through permutational multivariate analysis (PERMANOVA) in R software. RESULTS: The 30,000 to 340,000 high-quality clean reads were obtained from each of the positively stained or cultured CSF samples and 8 to 60 reads from each control. The samples from 11 infected patients yielded detectable cryptococcal-specific ITS1 DNA with top abundance (from 95.90% to 99.97%), followed by many other fungal groups (each <1.41%). ITS genotype was defined in 11 CSF samples, corresponding to ITS type 1, and confirmed by Sanger sequencing. A statistically significant difference (r = 0.65869, P = 0.0014) between infectious group and control group was observed. CONCLUSIONS: The metataxonomics of ITS amplicons facilitates the diagnosis and genotype of cryptococcus in CSF samples, which may provide a better diagnostic approach of cryptococcal infection.

19.
Aging (Albany NY) ; 11(22): 10284-10300, 2019 Nov 20.
Artigo em Inglês | MEDLINE | ID: mdl-31754081

RESUMO

In this study, erianin was found to reduce the viability of cancer cells, inhibit their proliferation and migration, induce G2/M phase arrest, enhance cancer cell apoptosis, promote an increase in levels of intracellular reactive oxygen species and a decrease in mitochondrial membrane potential, and regulate the expression levels of anti- and pro-apoptosis-related proteins in HepG2 and SMMC-7721 cells. Erianin inhibited tumor growth in HepG2- and SMMC-7721-xenograft tumor nude mouse models, reduced the expression levels of anti-apoptosis proteins and enhanced the expression levels of pro-apoptosis proteins in tumor tissues. Erianin inhibited tumor growth in immunosuppressed BALB/c mice bearing heterotopic tumors. Among 111 types of cytokines detected in proteome profiling of tumor tissues, erianin substantially influenced levels of 38 types of cytokines in HepG2-xenografted tumors and of 15 types of cytokines in SMMC-7721-xenografted tumors, most of which are related to immune functions. Erianin strongly affected the serum levels of cytokines, and regulated the activation of nuclear factor-kappa B (NF-κB), and the expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2) and its downstream proteins in spleen. The anti-liver cancer properties of erianin were found to be related mostly to its modulation of oxidative stress-mediated mitochondrial apoptosis and immune response.

20.
Pregnancy Hypertens ; 18: 132-136, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31610399

RESUMO

BACKGROUND: Recent studies suggested an association between fetal sex preponderance and hypertensive disorders during pregnancy, but the conclusions were inconsistent. Our objective was to investigate whether the occurrence of gestational hypertensive disorders would affect the possibility of delivering boys. METHODS: Data were obtained from the China-US Collaborative Project for Neural Tube Defects Prevention, a large population-based cohort study. We included participants who were registered in 2 southern Chinese provinces, and whose information of blood pressure and sex delivery were recorded in detailed. Blood pressure was measured during pregnancy by trained health care workers and other health-related information was recorded prospectively. We used log-binomial regression to evaluate the association between gestational hypertension or preeclampsia and the chance of male delivery. RESULTS: Among 205,605 singleton pregnancy women, the overall incidences of gestational hypertension and preeclampsia were 9.5% and 2.4%, respectively. The prevalence of male delivery was 51.1% and 50.2% in the groups of gestational hypertension and preeclampsia, while in the normotension group was 52.0%. After adjustment for the effects of the main potential confounders, women with gestational hypertension and preeclampsia both showed significantly decreased probability of giving birth to a boy. The adjusted risk ratios (RRs) were 0.98 (95% confidence interval (CI): 0.97-0.99) and 0.96 (95% CI: 0.94-0.99), respectively. CONCLUSIONS: Our results support a slight but significant association between gestational hypertension or preeclampsia and decreased likelihood of male delivery.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA