Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 374
Filtrar
1.
Microb Pathog ; : 103822, 2019 Oct 26.
Artigo em Inglês | MEDLINE | ID: mdl-31669501

RESUMO

The virus inactivation test is a critical skill in inactivated vaccine production. Active viruses produced viral mRNA in susceptible cells or the host can be used to infer whether a DNA virus is replicating by RT-PCR. But it is generally difficult to avoid genomic DNA contamination in the samples. However, the use of primers spanning an intron is an effective alternative for virus inactivation test. Therein, a nested RT-PCR was developed to detect active ISKNV in the inactivated vaccine. At first, the transcriptome analysis of CPB cell infected with ISKNV revealed several gaps in some viral transcripts compared to ISKNV genome. One intron in ORF003L with 80 bp (designated IN-3) was confirmed by PCR and sequencing analysis. Then, two primer sets (primer A and primer B) spanning the IN-3 intron were designed to detect ISKNV transcription. The nested RT-PCR conditions were optimized with 0.4 µM primer A and 0.2 µM primer B, and 68 °C and 55 °C for annealing temperature, respectively. The sensitivity results indicated that the nested RT-PCR could detect one copy of live ISKNV propagating in CPB cells for seven days. The nested RT-PCR method was more sensitive and accurate than the method of blind passages in cells and fish challenge experiments. Together, above results indicate that this assay is a time-saving, labor-extensive and cost-effective for inactivation test of ISKNV in killed vaccine production.

3.
Langmuir ; 35(40): 12898-12907, 2019 Oct 08.
Artigo em Inglês | MEDLINE | ID: mdl-31513424

RESUMO

The vacancy-enhanced contact friction of graphene is mainly attributed to the vacancy-enhanced out-of-plane deformation flexibility of the graphene and the climbing of the tip out of the vacancy trap (which actually acts as a step edge). However, this mechanism does not apply for explaining the enhanced friction caused by small-sized vacancies that are unable to accommodate the tip, such as single vacancy and double vacancies, which also commonly exist in the graphene. In the present study, by performing a set of classic molecular dynamics simulations, we demonstrated that the double-vacancy defect in graphene substantially enhanced the contact friction when the tip slides over it and the pinning effect of the reconstructed lattice of the double-vacancy defect with atoms at the bottom of the tip dominated such an influence. The underlying mechanism of such an atomic pinning effect and the influence of the normal load, sliding direction, and the sliding velocity were unveiled by analyzing the obtained friction evolution and the atomic configuration and interaction between the tip and the graphene. We believe that the findings presented in this study complete the state-of-art understanding of the nanoscale friction behaviors of vacancy-defected graphene, which is essential for the implementation of their potential control.

4.
Biomolecules ; 9(9)2019 Sep 02.
Artigo em Inglês | MEDLINE | ID: mdl-31480692

RESUMO

Glucose is a main carbon and energy source for virus proliferation and is usually involved in the glycolysis, pentose phosphate pathway (PPP), and tricarboxylic acid cycle (TCA cycle) pathways. In this study, we investigated the roles of glucose-related metabolic pathways during the replication of infectious spleen and kidney necrosis virus (ISKNV), which has caused serious economic losses in the cultured Chinese perch (Siniperca chuatsi) industry. We found that ISKNV infection enhanced the metabolic pathways of the PPP and the TCA cycle at the early stage of the ISKNV infection cycle and enhanced the glycolysis pathway at the late stage of the ISKNV infection cycle though the comprehensive analysis of transcriptomics, proteomics, and metabolomics. The advanced results proved that ISKNV replication induced upregulation of aerobic glycolysis at the late stage of ISKNV infection cycle and aerobic glycolysis were required for ISKNV multiplication. In addition, the PPP, providing nucleotide biosynthesis, was also required for ISKNV multiplication. However, the TCA cycle involving glucose was not important and necessary for ISKNV multiplication. The results reported here provide new insights into viral pathogenesis mechanism of metabolic shift, as well as antiviral treatment strategies.

5.
Medicine (Baltimore) ; 98(31): e16660, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31374039

RESUMO

INTRODUCTION: Primary hepatocellular carcinoma (HCC) is one of the most common malignancies, only 10% to 20% of HCC patients are surgically resectable as most of the patients are diagnosed at advanced stages at presentation. The efficiencies of transcatheter arterial chemoembolization (TACE), high-intensity focused ultrasound (HIFU), and three-dimensional conformal radiation therapy (3D-CRT) in patients with advanced HCC have been clinically confirmed. We here report a patient with HCC accompanied by venous tumor thrombus, who was treated with the combination of these 3 therapies. The patient survived for 16 months with good quality of life. PATIENT CONCERNS: The patient was a 72-year-old male with a primary multicentric HCC accompanied by tumor thrombus in the right hepatic vein. The patient had the symptoms of abdominal distention and liver pain. He refused sorafenib treatment because of personal reason. DIAGNOSIS: Primary multicentric HCC stage IIIB cT4N0M0, accompanied by tumor thrombus in the right hepatic vein; chronic viral hepatitis B; and hepatitis B virus-related decompensated liver cirrhosis. INTERVENTIONS: TACE + HIFU + 3D-CRT. OUTCOMES: The patient had an overall survival of 16 months with good quality of life. Compared with monotherapy, the combined therapy significantly prolonged patient survival time with improved clinical benefits. CONCLUSION: The combination of TACE, HIFU, and 3D-CRT is safe and effective in the treatment of advanced HCC, which provides a possible comprehensive treatment strategy for advanced HCC.


Assuntos
Carcinoma Hepatocelular/terapia , Quimioembolização Terapêutica/métodos , Tratamento por Ondas de Choque Extracorpóreas/métodos , Neoplasias Hepáticas/terapia , Radioterapia Conformacional/métodos , Idoso , Carcinoma Hepatocelular/complicações , Carcinoma Hepatocelular/patologia , Terapia Combinada , Humanos , Neoplasias Hepáticas/complicações , Neoplasias Hepáticas/patologia , Masculino , Estadiamento de Neoplasias , Trombose Venosa/etiologia
6.
Nat Commun ; 10(1): 3418, 2019 Jul 31.
Artigo em Inglês | MEDLINE | ID: mdl-31366935

RESUMO

Oil produced by castor (Ricinus communis) has broad industrial applications. However, knowledge on the genetic diversity, especially genetic alterations that occurred during domestication and subsequent traits selection, of this oil crop is limited. Here, our population genomics analyses show that the Chinese castors have developed a geographic pattern, classified into the southern-, the middle-, and the northern-China groups. We detect a number of candidate genomic loci that are associated with the selection signals during the geographical differentiation and domestication. Using genome-wide association analysis, we identify candidate genes associated with nine agronomically important traits. One of the candidate genes encoding a glycosyltransferase related to cellulose and lignin biosynthesis is associated with both capsule dehiscence and endocarp thickness. We hypothesize that the abundance of cellulose or lignin in endocarp is an important factor for capsule dehiscence. Our results provide foundation for castor breeding and genetic study.

7.
Rheumatol Int ; 2019 Aug 03.
Artigo em Inglês | MEDLINE | ID: mdl-31377830

RESUMO

Pancreatitis is uncommon in systemic lupus erythematosus (SLE) and is rarely reported in children, possibly being related to macrophage activation syndrome (MAS). The incidence of MAS in children with lupus pancreatitis is unknown, as is their prognosis. In this case-based review, we report a pediatric patient with SLE complicated with pancreatitis and MAS, and performed a literature review. We report an 11-year-old girl with SLE and MAS who developed pancreatitis on the second day of methylprednisolone pulse therapy (500 mg/day). We continued methylprednisolone pulse therapy, and performed three rounds of DNA-immunoadsorption and three rounds of hemoperfusion. A second course of methylprednisolone pulse therapy was initiated 9 days later. The patient received a monthly cyclophosphamide pulse therapy (10 mg/kg/day, 2 consecutive days every month) for 6 months, after which she was treated with mycophenolate mofetil 20 mg/kg/day. The condition of the patient gradually improved, her blood amylase and lipase decreased. She was in a stable condition during 13-month follow-up period. Review of the literature of pediatric patients with SLE and pancreatitis showed that there are 127 cases that have been reported in the past 30 years, 40 cases were excluded in our study because of inadequate information. Of the 87 patients included in our literature review, the mortality rate was 33.33%, and 52.86% of the patients with pancreatitis had MAS at the same time. Pancreatitis is uncommon in SLE, but must be suspected if a patient with SLE develops digestive symptoms. Patients with SLE with pancreatitis have a high incidence of MAS and high mortality rate; however, early recognition and effective treatment can relieve the disease symptoms.

8.
J Vis Exp ; (149)2019 Jul 22.
Artigo em Inglês | MEDLINE | ID: mdl-31380828

RESUMO

Here, based on a clinician's point-of-view, we propose a two-model lower body positive pressure (LBPP) protocol (walking and squatting models) in addition to a clinical, functional assessment methodology, including details for further encouragement of the development of non-drug surgical intervention strategies in knee osteoarthritis patients. However, we only present the effect of LBPP training in improvement of pain and knee function in one patient through three-dimensional gait analysis. The exact, long-term effects of this approach should be explored in future studies.

9.
Opt Lett ; 44(17): 4295-4298, 2019 Sep 01.
Artigo em Inglês | MEDLINE | ID: mdl-31465386

RESUMO

We demonstrate the first silicon carbide (SiC) double-microdisk resonator (DMR). The device has a compact footprint with a radius of 24 µm and operates in the ITU high frequency range (3-30 MHz). We develop a multi-layer nanofabrication recipe that yields high optical quality (Q∼105) for the SiC DMR. Because of its strong optomechanical interaction, we observe the thermal-Brownian motions of mechanical modes in a SiC DMR directly at room temperature for the first time, to the best of our knowledge. The observed mechanical modes include fundamental/second-order common modes and fundamental differential (D1) modes. The D1 modes have high mechanical qualities >3800 at around 18.4 MHz tested in vacuum. We further show that optomechanical interactions, including linear and nonlinear optomechanical spring effects, can be observed in a SiC DMR at sub-milliwatt optical power. The SiC DMR has great potential for low-power optomechanical sensing applications in harsh environments.

10.
Int J Biol Macromol ; 140: 1-9, 2019 Aug 13.
Artigo em Inglês | MEDLINE | ID: mdl-31419549

RESUMO

ß-CD grafted cellulose bead had been successfully prepared via dropping method, following by cross-linking reaction under mild conditions. The efficient grafting of ß-CD on the cellulose bead made it promising adsorbent toward BPA, which combined the inclusion complexation property of ß-CD and advantages of cellulose bead. The structure of the grafted cellulose bead was characterized by FTIR, XRD and 13C NMR, which confirmed the covalent bonding between cellulose bead and ß-CD. The SEM and BET analysis revealed that the grafting of ß-CD on the cellulose bead maintained the highly porous morphology of cellulose bead, meanwhile enhanced its specific surface area. Thus, the resulting modified cellulose bead presented much higher adsorption capacity toward BPA than pristine cellulose bead, since the presence of ß-CD facilitated the formation of inclusion complexes via host-guest interactions. It was found that the maximum BPA adsorption capacity of grafted cellulose bead was 30.77 mg/g. The adsorption process fitted well with the Langmuir isotherm model and the pseudo-second-order kinetic model. Further studies of ad/desorption experiments revealed that the ß-CD grafted cellulose bead could be regenerated easily in methanol. Based on these results, the adsorbents prepared here can be potentially used in the treatment of micropollutants in water.

11.
Appl Microbiol Biotechnol ; 103(19): 8203-8214, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31396678

RESUMO

Microbial bioremediation of heavy metal-contaminated soil is a potential technique to reduce heavy metals in crop plants. However, the dynamics and roles of the local microbiota in bioremediation of heavy metal-contaminated soil following microbial application are rarely reported. In this study, we used Pseudomonas chenduensis strain MBR for bioremediation of Cd-contaminated paddy soil and investigated its effects on the dynamics of the local soil bacterial community and Cd accumulation in rice. Cd accumulation in rice grains and roots were significantly reduced by the addition of the strain MBR. The addition of the strain MBR caused greater changes in bacterial communities in rhizosphere soil than in bulk soil. MBR enhanced the roles of microbial communities in transformation of Cd fractions, especially in rhizosphere soil. The strain MBR likely regulated abundant subcommunities more than rare subcommunities to improve Cd bioremediation, especially in rhizosphere soil. Consequently, the dynamics and functional roles of the local microbial communities differed significantly during bioremediation between abundant and rare subcommunities and between rhizosphere soil and bulk soil. This study provides new insight into the microbiota-related mechanisms underlying bioremediation.

12.
Microb Pathog ; 135: 103617, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31283962

RESUMO

The bluegill sunfish, Lepomis macrochirus, is an important aquacultural and recreational species in southern China because of its excellent taste, rapid growth rate, and good looks. At present, few pathogens are known to affect the bluegill sunfish. However, an iridovirus-like disease recently caused heavy losses to the bluegill sunfish aquaculture industry in Guangdong, China. We report that a virus, designated BSMIV-SD-20171020, was isolated from diseased bluegill sunfish in China. The isolate was efficiently propagated in a Chinese perch brain (CPB) cell line. The cytopathic effect was observed, the MCP gene PCR amplified, and the virus observed with electron microscopy. Its viral titer in CPB cells reached 104.13 TCID50 mL-1. The mortality rate was 100% when bluegill sunfish were challenged with BSMIV-SD-20171020 at a dose of 103.13 TCID50/fish. A histopathological examination revealed basophilic hypertrophied cells in the intestine, liver, and spleen. A nucleotide sequence alignment and phylogenetic analysis of the major capsid protein revealed that isolate BSMIV-SD-20171020 is the species Infectious spleen and kidney necrosis virus (ISKNV), in the genus Megalocytivirus.

13.
Fish Shellfish Immunol ; 92: 133-140, 2019 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-31173860

RESUMO

Infectious spleen and kidney necrosis virus (ISKNV) cause a high mortality disease which lead to significant economic loss on mandarin fish in China. There is no effective drug or vaccine against this fatal disease at present. Meanwhile, many drugs and vaccines had no effect in many cases account of several impenetrable barriers (cell, skin and gastrointestinal tract). Here we reported an immersion subunit vaccine system (SWCNTs-MCP) encoding MCP gene of ISKNV based on single-walled carbon nanotubes (SWCNTs). To evaluate its efficacy against ISKNV, we found a stronger and longer duration immune response (serum antibody production, enzyme activities and immune-related genes expression) can be induced in fish vaccinated with SWCNTs-MCP in comparison with those vaccinated with MCP alone. Importantly, SWCNTs can increase the immune protective effect of naked subunit vaccine by ca. 23.8%. Thereby, this study demonstrates that SWCNTs as a promising carrier for subunit vaccine might be used to vaccinate large-scale juvenile mandarin fish by bath administration approach.

14.
BMC Evol Biol ; 19(1): 119, 2019 06 11.
Artigo em Inglês | MEDLINE | ID: mdl-31185889

RESUMO

BACKGROUND: The evolution of male pregnancy is the most distinctive characteristic of syngnathids, and their specialized life history traits make syngnathid species excellent model species for many issues in biological evolution. However, the origin of syngnathids and the evolutionary divergence time of different syngnathid species remain poorly resolved. Comprehensive phylogenetic studies of the Syngnathidae will provide critical evidence to elucidate their origin, evolution, and dispersal patterns. RESULTS: We sequenced the mitochondrial genomes of eight syngnathid species in this study, and the estimated divergence times suggested that syngnathids diverged from other teleosts approximately 48.8 Mya during the Eocene period. Selection analysis showed that many mitochondrial genes of syngnathids exhibited significantly lower Ka/Ks values than those of other teleosts. The two most frequently used codons in syngnathid fishes were different from those in other teleosts, and a greater proportion of the mitochondrial simple sequence repeats (SSRs) were distributed in non-coding sequences in syngnathids compared with other teleosts. CONCLUSIONS: Our study indicated that syngnathid fishes experienced an adaptive radiation process during the early explosion of species. Syngnathid mitochondrial OXPHOS genes appear to exhibit depressed Ka/Ks ratios compared with those of other teleosts, and this may suggest that their mitogenomes have experienced strong selective constraints to eliminate deleterious mutations.


Assuntos
Adaptação Fisiológica/genética , Evolução Biológica , Peixes/genética , Genoma Mitocondrial , Smegmamorpha/genética , Animais , Códon/genética , Simulação por Computador , Feminino , Genes Mitocondriais , Variação Genética , Geografia , Masculino , Repetições de Microssatélites/genética , Nucleotídeos/genética , Filogenia , Seleção Genética , Especificidade da Espécie , Fatores de Tempo
15.
Sci China Life Sci ; 2019 Jun 26.
Artigo em Inglês | MEDLINE | ID: mdl-31250189

RESUMO

RtcB, a highly conserved RNA ligase, is found in all three domains of life, and demonstrated to be an essential tRNA splicing component in archaea and metazoans. However, the biological functions of RtcB in bacteria, where there is no splicing, remains to be clarified. We first performed bioinformatics analysis which revealed highly conserved structures and presumably conserved functions of RtcB in bacteria. However, its orthologs only occur in ∼ 0.5% of bacterial species across diverse phyla with significant signals of frequent horizontal transfer, highlighting its non-essential role in bacteria. Next, by constructing an rtcB-knockout strain, we find that the removal of antibiotic stress induces a significant impact on rtcB expression in wild-type strain, and furthermore the depletion of RtcB (ARtcB strain) delays the recovery process. Our transcriptomic analysis, comprising the 3'-end labeling of RNAs, highlights a significant increase in unmapped reads and cleaved rRNAs in the Δ RtcB strain, particularly during recovery. Our observations suggest that the conserved RNA ligase RtcB, repairs damaged rRNAs following stress, which potentially saves energy and accelerates recovery of its host. We propose that acquisition of RtcB by diverse bacterial taxa provides a competitive advantage under stressful conditions.

16.
Nanotechnology ; 30(38): 385602, 2019 Sep 20.
Artigo em Inglês | MEDLINE | ID: mdl-31216513

RESUMO

The mechanism of self-assembling process of inorganic nanoparticle (NPs) is still an open question due to the various and non-additive interactions between NPs. Kotov et al reported that the semiconductor NPs can be self-assembled by external activation such as irradiation. In this paper, the twisted CdTe nanoribbons were successfully assembled with circular polar light activation based on the chiral selective resonance absorption. The effect of NP size on the morphology of assemblies under circular polar light irradiation is discussed by introducing a new mechanism of photooxidation induced dipole moment which decreases with increasing sizes of the NPs because of the change of band offsets at the CdS/CdTe interface. Moreover, we find that the competition between the dipole-dipole interaction and electrostatic repulsion can be modulated by the size of the NPs and the concentration of dispersion, which are the key points to produce the chiral twisted nanoribbons.

18.
Med Oncol ; 36(6): 53, 2019 May 03.
Artigo em Inglês | MEDLINE | ID: mdl-31053950

RESUMO

The original version of this article contained an error in the shRNA sequence. The correct shRNA sequence should read as "TTCTCCGAACGTGTCACGTCTCGAGACGTGACACGTTCGGAGAATTTTT".

19.
Opt Express ; 27(8): 11252-11263, 2019 Apr 15.
Artigo em Inglês | MEDLINE | ID: mdl-31052971

RESUMO

The cold atom absolute gravimeters are intrinsically sensitive to its orientation due to the Coriolis effect, which should be understood clearly and compensated for field applications. The sensitivity on the orientation for a free-fall atom gravimeter is investigated in this paper. The apparatus is simplified and improved a lot such that fast adjustment and measurement could be carried out within 20 minutes. From the experimental results, it is found that the orientation angle has a dominant influence on the absolute gravity measurement, especially when the horizontal velocity of atoms is non-negligible. Besides, the magnitude and direction of average horizontal velocity of the detected atoms are obtained in this experiment. In particular, the direction of East-West has been measured by the atom gravimeter itself, such that gravity bias arising from Coriolis effect is estimated precisely.

20.
Medicine (Baltimore) ; 98(18): e15386, 2019 May.
Artigo em Inglês | MEDLINE | ID: mdl-31045790

RESUMO

INTRODUCTION: To date, the anti-gravity treadmill (AlterG), as a representative method of Lower body positive pressure (LBPP) treadmills, has been rarely reported for knee osteoarthritis (KOA) rehabilitation. The purpose of this case study was to setup the clinical protocol example for AlterG intervention on KOA and evaluate treatment effectiveness by 3D gait analysis combined with free EMG to explore the kinematic gait parameter changes. PATIENT CONCERNS: A 65-year-old female patient (BMI = 26, mild obesity) undergoing "more than 7 years of KOA." The activity of the right knee joint was obviously limited and she suffered from severe pain over the past month. DIAGNOSIS: Due to the patient's symptoms and radiographic findings, she was diagnosed with acute attack of KOA. INTERVENTIONS: The patient has performed clinical function evaluation and gait analysis combined at pretreatment, post-treatment, and 4 months follow-up assessment. AlterG training was performed 6 days/week for 2 weeks, with up to 30 min of training per session. The training protocol included two major parts, walking and squatting in AlterG. OUTCOMES: After 2 weeks of AlterG intervention, the 10-m walking test (10 MWT) and Timed-up-and-go (TUG) test improved significantly post-treatment, whereas the Visual Analog Scale (VAS) score decreased post-treatment. The Modified Barthel Index improved post-treatment and the patient restored basic community walk after treatment. The temporal parameter results showed that stride length (%height), mean velocity (%height), and cadence gradually increased before treatment, after treatment, and at 4-month follow-up. The right range of motion (ROM) of knee flexion-extension were gradually increased. Meanwhile, the synchronized EMG data showed that the RMS (root means square) values of the rectus femoris, semitendinosus, and biceps femoris at post-treatment were improved to different degrees than at pretreatment. CONCLUSION: We found that for this patient with KOA, AlterG relieved pain, and was also effective at improving spatio-temporal parameters, knee flexion/extension gait pattern, and corresponding muscle strength, thereby restoring certain community activities.


Assuntos
Artralgia/reabilitação , Terapia por Exercício/métodos , Marcha , Osteoartrite do Joelho/reabilitação , Idoso , Fenômenos Biomecânicos , Eletromiografia , Feminino , Humanos , Músculo Esquelético/fisiologia , Amplitude de Movimento Articular , Velocidade de Caminhada
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA