Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 506
Filtrar
1.
Methods Mol Biol ; 2451: 213-244, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35505021

RESUMO

Advance of nanomaterials and nanotechnology has offered new possibilities for photodynamic therapy (PDT). Large amount of different kinds of sensitizers and targeting moieties can now be loaded in nanometer's volume, which not only results in the improvement of the efficacy of PDT, but also enables the control of image-guided PDT with unprecedented precision and variation. This chapter shall overview the recently most studied inorganic nanomaterials for PDT.


Assuntos
Nanoestruturas , Fotoquimioterapia , Nanotecnologia , Fotoquimioterapia/métodos , Fármacos Fotossensibilizantes/uso terapêutico
2.
J Cancer ; 13(7): 2352-2361, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35517408

RESUMO

Lung cancer is acknowledged as a common cancer with high morbidity and mortality. MicroRNAs (miRNAs), kind of non-coding single-stranded RNA molecules, can be used in cancer clinical treatments. In this research, miR-199a-5p was seen lowly expressed in NSCLC sera samples. miR-199a-5p suppressed the cell proliferation, migration and arrested cell cycle in NSCLC cell lines. The results showed that SLC2A1 (glucose transporter 1, GLUT1) was a direct target of miR-199a-5p. Downregulation of SLC2A1 could not only inhibit cell proliferation, migration and cell cycle, but also promote cell apoptosis. The data suggests that miR-199a-5p can inhibit glucose metabolism in NSCLC by targeting SLC2A1.This study proves that miR-199a-5p / SLC2A1 can play an essential role in the development of NSCLC by targeting SLC2A1. It puts forward a new approach for clinical treatments of NSCLC.

3.
Stem Cell Res Ther ; 13(1): 198, 2022 May 12.
Artigo em Inglês | MEDLINE | ID: mdl-35550648

RESUMO

BACKGROUND: Mammalian lens regeneration holds great potential as a cataract therapy. However, the mechanism of mammalian lens regeneration is unclear, and the methods for optimization remain in question. METHODS: We developed an in vitro lens regeneration model using mouse capsular bag culture and improved the transparency of the regenerated lens using nicotinamide (NAM). We used D4476 and SSTC3 as a casein kinase 1A inhibitor and agonist, respectively. The expression of lens-specific markers was examined by real-time PCR, immunostaining, and western blotting. The structure of the in vitro regenerated lens was investigated using 3,3'-dihexyloxacarbocyanine iodide (DiOC6) and methylene blue staining, terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), and transmission electron microscopy. RESULTS: The in vitro lens regeneration model was developed to mimic the process of in vivo mammalian lens regeneration in a mouse capsular bag culture. In the early stage, the remanent lens epithelial cells proliferated across the posterior capsule and differentiated into lens fiber cells (LFCs). The regenerated lenses appeared opaque after 28 days; however, NAM treatment effectively maintained the transparency of the regenerated lens. We demonstrated that NAM maintained lens epithelial cell survival, promoted the differentiation and regular cellular arrangement of LFCs, and reduced lens-related cell apoptosis. Mechanistically, NAM enhanced the differentiation and transparency of regenerative lenses partly by inhibiting casein kinase 1A activity. CONCLUSION: This study provides a new in vitro model for regeneration study and demonstrates the potential of NAM in in vitro mammalian lens regeneration.

4.
Tree Physiol ; 2022 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-35532080

RESUMO

The apple rootstock Malus prunifolia (Willd.) Borkh. is widely used for apple production. Because polyploid plants are often more tolerant to abiotic stress than diploids, we wondered whether polyploidy induction in M. prunifolia might improve its stress tolerance, particularly to high salinity. We used a combination of colchicine and DMSO to induce chromosome doubling in M. prunifolia and identified the resulting polyploids by stomatal observations and flow cytometry. We found the best way to induce polyploidy in M. prunifolia was to use 2% DMSO and 0.05% colchicine for 2 days for leaves or 0.02% colchicine for stem segments. The results of hydroponic salt treatment showed that polyploid plants were more salt tolerant and had greater photosynthetic efficiency, thicker leaf epidermis and palisade tissues, and shorter but denser root systems than diploids. During salt stress, the polyploid leaves and roots accumulated less Na+, showed upregulated expression of three SOS pathway genes, and produced fewer ROS. The polyploid plants also had considerably higher ABA and JA levels than diploid plants under salt stress. Under normal growth conditions, GAs levels were much lower in polyploid leaves than in diploid leaves; however, after salt treatment, polyploid leaves showed upregulation of essential GAs synthesis genes. In summary, we developed a system for the induction of polyploidy in M. prunifolia and response to salt stress of the resulting polyploids, as reflected in leaf and root morphology, changes in Na+ accumulation, antioxidant capacity, and plant hormone levels.

5.
Artigo em Inglês | MEDLINE | ID: mdl-35388303

RESUMO

Methods: The chemical ingredients of ANW were retrieved from TCMSP, TCMID, and literature. We predicted the potential targets of active ingredients by PubChem, Swiss Target Prediction, and STITCH databases. The targets related to ischemic stroke were retrieved using GeneCards, DisGeNET, DrugBank, TTD, and GEO databases. Subsequently, Venn diagrams were used to identify common targets of active ingredients and ischemic stroke. Protein-protein interaction (PPI) network was structured with STRING platform and Cytoscape 3.8.2. Gene ontology (GO) enrichment and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses of key targets were performed in the Metascape database. Finally, molecular docking was conducted by AutoDock Tools and PyMOL software. Results: A total of 2391 targets were identified for 230 active ingredients of ANW, and 1386 of them overlapped with ischemic stroke targets. The key active ingredients were mainly quercetin, ß-estradiol, berberine, wogonin, and ß-sitosterol, and the key targets were also identified, including IL-6, AKT1, MAPK3, PIK3CA, and TNF. The biological process (BP) results indicated that ANW may have therapeutic effects through response oxidative stress, inflammatory response, cellular response to lipid, and response to nutrient levels. Furthermore, the ingredients of ANW were predicted to have therapeutic effects on ischemic stroke via the HIF-1 signaling pathway, FoxO signaling pathway, chemokine signaling pathway, fluid shear stress and atherosclerosis, and neurotrophin signaling pathway. The molecular docking results all showed that the core ingredients were strong binding activity with the core targets. Conclusion: In conclusion, the bioinformatics and pharmacological results reveal that counteracting oxidative stress, suppressing inflammation, inhibiting the development of AS, and even protecting neurological function are critical pathways for ANW in the treatment of ischemic stroke. These results may help to elucidate the mechanism of ANW on ischemic stroke for experimental studies and clinical applications.

6.
ACS Biomater Sci Eng ; 8(5): 1964-1974, 2022 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-35380797

RESUMO

RNA interference (RNAi) is a promising approach to the treatment of genetic diseases by the specific knockdown of target genes. Functional polymers are potential vehicles for the effective delivery of vulnerable small interfering RNA (siRNA), which is required for the broad application of RNAi-based therapeutics. The development of methods for the facile modulation of chemical structures of polymeric carriers and an elucidation of detailed delivery mechanisms remain important areas of research. In this paper, we synthesized a series of methacrylate-based polymers with controllable structures and narrow distributions by atom transfer radical polymerization using various combinations of cationic monomers (2-dimethylaminoethyl methacrylate, 2-diethylaminoethyl methacrylate, and 2-dibutylaminoethyl methacrylate) and hydrophobic monomers (2-butyl methacrylate (BMA), cyclohexyl methacrylate, and 2-ethylhexyl methacrylate). These polymers exhibited varying hydrophobicities, charge densities, and pKa values, enabling the discovery of effective carriers for siRNA by in vitro delivery assays. For the polymers with BMA segments, 50% of cationic segments were beneficial to the formation of siRNA nanoparticles (NPs) and the in vitro delivery of siRNA. The optimal ratio varied for different combinations of cationic and hydrophobic segments. In particular, 20k PMB 0.5, PME 0.5, and PEB 1.0 showed >75% luciferase knockdown. Efficacious delivery was dependent on high siRNA binding, the small size of NPs, and balanced hydrophobicity and charge density. Cellular uptake and endosomal escape experiments indicated that carboxybetaine modification of 20k PMB 0.5 did not remarkably affect the internalization of corresponding NPs after incubation for 6 h but significantly reduced the endosomal escape of NPs, which leads to the notable decrease in delivery efficacy of polymers. These results provide insights into the mechanism of polymer-based siRNA delivery and may inspire the development of novel polymeric carriers.


Assuntos
Metacrilatos , Nanopartículas , Cátions , Interações Hidrofóbicas e Hidrofílicas , Metacrilatos/química , Nanopartículas/química , Polímeros , RNA Interferente Pequeno/genética
7.
J Org Chem ; 87(9): 6347-6351, 2022 May 06.
Artigo em Inglês | MEDLINE | ID: mdl-35420817

RESUMO

A mild oxidative sequential tandem reaction was developed to rapidly generate 2-aryl-3-(2-aminoaryl) quinoxalines. This method exploited 2-substituted indoles as substrate to form quinoxalines in a one-pot reaction. The key to this tandem reaction was the formation of 3-iodoindoles, which underwent Kornblum-type oxidation with DMSO to generate active imine 2-substitued 3H-indol-3-ones. The active imines were captured in situ by 1,2-diaminobenzenes to construct diverse quinoxalines. The transformation can be accomplished at room temperature with excellent functional group tolerance.


Assuntos
Indóis , Quinoxalinas , Ciclização , Iminas , Oxirredução , Estresse Oxidativo
8.
Oxid Med Cell Longev ; 2022: 4791059, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35432725

RESUMO

Diabetes mellitus (DM) is a growing health problem. As a common complication of DM, diabetic foot ulcer (DFU) results in delayed wound healing and is a leading cause of nontraumatic amputation. miR-199a-5p, a short noncoding RNA, had abnormal expression in DFU wound tissues. The expression of miR-199a-5p was significantly increased in DFU wound tissues, skin tissues of diabetic rats, and high glucose-induced cells. Vascular endothelial growth factor A (VEGFA) and Rho-associated kinase 1 (ROCK1) are directly targets of miR-199a-5p. Inhibiting the expression of miR-199a-5p alleviated the inhibition of VEGFA and ROCK1, thereby rescued impaired proliferation and migration of HG-induced cells, and restored the normal function of the cells to some extent. In diabetic rats, inhibition of miR-199a-5p significantly increased the expression of VEGFA and ROCK1, significantly promoted wound healing, and rescued impaired wound healing. miR-199a-5p and its targets showed therapeutic effect on diabetic wounds.


Assuntos
Diabetes Mellitus Experimental , Pé Diabético , MicroRNAs , Animais , Proliferação de Células , Diabetes Mellitus Experimental/complicações , Pé Diabético/genética , MicroRNAs/genética , MicroRNAs/metabolismo , Ratos , Fator A de Crescimento do Endotélio Vascular/genética , Fator A de Crescimento do Endotélio Vascular/metabolismo , Cicatrização/genética , Quinases Associadas a rho/genética
9.
Plant Dis ; 2022 Apr 20.
Artigo em Inglês | MEDLINE | ID: mdl-35442054

RESUMO

A novel polerovirus maize yellow mosaic virus (MaYMV) has been discovered in Asia (Chen et al. 2016; Lim et al. 2018; Sun et al. 2019; Wang et al. 2016), East Africa (Guadie et al. 2018; Massawe et al. 2018) and South America (Gonçalves et al. 2017). MaMYV was first reported to infect maize (Zea mays L.) showing yellow mosaic symptoms on the leaves in Yunnan, Guizhou, and yellowing and dwarfing symptoms on the leaves in Anhui provinces of China in 2016 (Chen et al. 2016; Wang et al. 2016). An East African isolate of MaYMV has recently been shown to induce leaf reddening in several maize genotypes (Stewart et al. 2020). To our knowledge the leaf reddening symptoms in maize was not reported in China and MaYMV was not reported in Henan province, China. A survey of viral diseases on maize was carried out during the autumn of 2021 in Zhengzhou (Henan province), China. During the survey, the leaves showing reddening symptoms were observed on maize plants in all four fields investigated. Symptomatic leaves of 12 plants from four fields of Xingyang county, Zhengzhou (n=12) were collected and mixed for metatranscriptomics sequencing, and total RNA was extracted and subjected to an rRNA removal procedure using a Ribo-zero Magnetic kit according to the manufacturer's instructions (Epicentre, an Illumina® company). cDNA libraries were constructed using a TruSeq™ RNA sample prep kit (Illumina). Barcoded libraries were paired-end sequenced on an Illumina HiSeq X ten platform at Shanghai Biotechnology Co., Ltd. (Shanghai, China) according to the manufacturer's instructions (www.illumina.com). In total 67607392 clean reads were de novo assembled using CLC Genomics Workbench (version:6.0.4). 105796 contigs were obtained. The assembled contigs were queried by homology search tools (BLASTn and BLASTx) against public database(GenBank). One 5,457 nucleotide (nt) long contig with the most reads of 558826 was obtained and blast analysis showed it shared 99.3% nt sequence identity (99% coverage) with MaYMV Yunnan4 isolate (KU291100).. According to the sequencing data no other plant viruses except MaYMV were present in the sequencing data. To confirm the presence of this virus, twelve leaf samples showing reddening symptoms were detected by RT-PCR using specific primer pairs for CP full length open reading frame (F: ATGAATACGGGAGGTAGAAA, R: CTATTTCGGGTTTTGAACAT). Amplicons with expected size of 594 bp were gained in seven samples and three of them were cloned into pMD18T vector and sequenced. The three isolates (OM417795, OM417796, and OM417797) shared 99.16% to 99.83% nt sequence identity with MaYMV-Yunnan3 isolate (KU291100). Further P0 sequence analysis of the three samples (OM417798, OM417799, and OM417800) with primer pairs F: ATGGGGGGAGTGCCTAAAGC/R: TCATAACTGATGGAATTCCC showed they shared 99.5% to 99.62% nt sequence identity with MaYMV-Yunnan3 isolate.To our knowledge, this is the first report of the occurrence of MaYMV infecting maize in Henan, China. Besides, our finding firstly discovered reddening symptoms caused by MaYMV on maize in China which is different from the previous symptoms observed in the other three provinces of China possibly due to the different maize varieties grown in different areas. According to our investigation, maize showing reddening symptoms was common in the fields. Henan province is the main corn production area in China. Corn leaf aphid (Rhopalosiphum maidis), the insect vector of MaYMV, is an important pest of corn in Henan province, thereby the occurrence of MaYMV might cause potential threat to maize production in China.

10.
Anal Chem ; 94(16): 6271-6280, 2022 Apr 26.
Artigo em Inglês | MEDLINE | ID: mdl-35417142

RESUMO

Modulating the precise self-assembly of functional biomacromolecules is a critical challenge in biotechnology. Herein, functional biomacromolecule-assembled hierarchical hybrid nanoarchitectures in a spatially controlled fashion are synthesized, achieving the biorecognition behavior and signal amplification in the immunoassay simultaneously. Biomacromolecules with sequential assembly on the scaffold through the biomineralization process show significantly enhanced stability, bioactivity, and utilization efficiency, allowing tuning of their functions by modifying their size and composition. The hierarchically hybrid nanoarchitectures show great potential in construction of ultrasensitive immunoassay platforms, achieving a three order-of-magnitude increase in sensitivity. Notably, the well-designed HRP@Ab2 nanoarchitectures allow for optical immunoassays with a detection range from picogram mL-1 to microgram mL-1 on demand, providing great promise for quantitative analysis of both low-abundance and high-residue targets for biomedical applications.


Assuntos
Testes Imunológicos , Proteínas , Imunoensaio
11.
Micromachines (Basel) ; 13(4)2022 Apr 08.
Artigo em Inglês | MEDLINE | ID: mdl-35457887

RESUMO

Dielectrophoresis (DEP) enables continuous and label-free separation of (bio)microparticles with high sensitivity and selectivity, whereas the low throughput issue greatly confines its clinical application. Herein, we report a novel design of the DEP separator embedded with cylindrical interdigitated electrodes that incorporate hybrid floating electrode layout for (bio)microparticle separation at favorable throughput. To better predict microparticle trajectory in the scaled-up DEP platform, a theoretical model based on coupling of electrostatic, fluid and temperature fields is established, in which the effects of Joule heating-induced electrothermal and buoyancy flows on particles are considered. Size-based fractionation of polystyrene microspheres and dielectric properties-based isolation of MDA-MB-231 from blood cells are numerically realized, respectively, by the proposed separator with sample throughputs up to 2.6 mL/min. Notably, the induced flows can promote DEP discrimination of heterogeneous cells. This work provides a reference on tailoring design of enlarged DEP platforms for highly efficient separation of (bio)samples at high throughput.

12.
Nanomaterials (Basel) ; 12(8)2022 Apr 18.
Artigo em Inglês | MEDLINE | ID: mdl-35458093

RESUMO

With the continuous advancement in technology, electronic products used in augmented reality (AR) and virtual reality (VR) have gradually entered the public eye. As a result, the power supplies of these electronic devices have attracted more attention from scientists. Compared to traditional power sources, triboelectric nanogenerators (TENGs) are gradually being used for energy harvesting in self-powered sensing technology such as wearable flexible electronics, including AR and VR devices due to their small size, high conversion efficiency, and low energy consumption. As a result, TENGs are the most popular power supplies for AR and VR products. This article first summarizes the working mode and basic theory of TENGs, then reviews the TENG modules used in AR and VR devices, and finally summarizes the material selection and design methods used for TENG preparation. The friction layer of the TENG can be made of a variety of materials such as polymers, metals, and inorganic materials, and among these, polytetrafluoroethylene (PTFE) and polydimethylsiloxane (PDMS) are the most popular materials. To improve TENG performance, the friction layer material must be suitable. Therefore, for different application scenarios, the design methods of the TENG play an important role in its performance, and a reasonable selection of preparation materials and design methods can greatly improve the work efficiency of the TENG. Lastly, we summarize the current research status of nanogenerators, analyze and suggest future application fields, and summarize the main points of material selection.

13.
Bioengineered ; 13(4): 11281-11295, 2022 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-35484993

RESUMO

As a novel noncoding RNA cluster, miR-17-92 cluster include six members: miR-17, miR-18a, miR-19a, miR-19b-1, miR-20a, and miR-92a. Dysregulation of miR-17-92 has been proved to be connected with the advancement of a series of human diseases, but the roles of miR-17-92 cluster in non-small cell lung cancer (NSCLC) have not been absolutely elaborated. Herein, we determined that miR-17-92 cluster were upregulated significantly in NSCLC tissues, and the cell proliferation, migration and cycle progression of NSCLC were also facilitated under the function of miR-17-92 cluster. Sprouty 4 (SPRY4) was a direct target of miR-92a, and its overexpression restrained the exacerbation of NSCLC induced by miR-92a. Furthermore, the tumor xenograft assay showed that miR-92a facilitated tumor growth by inhibiting the expression of SPRY4 and mediating Epithelial-Mesenchymal Transition (EMT) in vivo. Finally, we looked into the synergistic effects of miR-92a and miR-18a on NSCLC, and found that antagomiR-18a treatment arrested the tumor growth rate of xenografted mice markedly.


Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , MicroRNAs , Animais , Carcinoma Pulmonar de Células não Pequenas/patologia , Linhagem Celular Tumoral , Proliferação de Células/genética , Humanos , Neoplasias Pulmonares/patologia , Camundongos , MicroRNAs/metabolismo
14.
Inorg Chem ; 61(11): 4705-4713, 2022 Mar 21.
Artigo em Inglês | MEDLINE | ID: mdl-35271263

RESUMO

MOFs@MOFs (metal-organic frameworks, MOFs) possess precise customized functionalities and predesigned structures that enable the implementation of structure and property regulation for specific functions in comparison to traditional single MOFs. However, the synthesis and fluorescence properties of multilayer MOFs@MOFs are still worth improving. Herein, a fluorescent raspberry-shaped MOF@MOF was constructed via optimized seed-mediated synthesis by tuning the reaction time, reaction mode, and reaction concentration, involving the initial synthesis of the UiO-66-NH2 core and then the coating of the UiO-67-bpy shell. The raspberry-shaped UiO-66@67-bpy showed stable fluorescence and desirable sensing selectivity for the Hg2+ ion under the interference of other ions; meanwhile, the raspberry-shaped UiO-66@67-bpy indicated amplified sensing performance than pure UiO-66-NH2, mechanically mixed UiO-66-NH2 + UiO-67-bpy, and UiO-66@UiO-67 counterpart due to the accumulation effect of outer UiO-67-bpy toward Hg2+. Density functional theory (DFT) calculations including adsorption energy calculations and electronic density difference analysis further showed that the enhanced fluorescence quenching was possibly attributed to the outer UiO-67-bpy enrichment promoting the charge transfer between Hg2+ and the ligands of fluorescent UiO-66@67-bpy. The synergistic effect of MOFs@MOFs unlocks more possibilities for the construction of enhanced sensors and other applications.

16.
Front Cell Neurosci ; 16: 841733, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35281296

RESUMO

Patients were found to experience more pain during their second eye cataract surgery compared with their first eye surgery. This study aimed to explore the inflammatory alterations along time in the fellow eye after the first eye surgery and to reveal the underlying mechanism. Eighty patients with bilateral cataracts were recruited and were divided into four groups based on the time of having the second eye surgery. The second eye aqueous humor samples were collected just before surgery and analyzed by mass spectrometry and PCR array. Cytokine activity was enriched in the aqueous humor of the contralateral eye with granulocyte colony-stimulating factor CSF3 significantly upregulated at both gene and protein levels. Rabbits with or without superior cervical ganglionectomy (SCGx) were subjected to lensectomy to mimic human situations. In both human and rabbit models, the fellow eye CSF3 peaked at 1 week post the first eye surgery. Consistently, more neutrophils were recruited to the contralateral eye aqueous humor. Corneal sensitivity and trigeminal electrophysiology were recorded to imply the pain severity in rats receiving capsulorrhexis with or without SCGx. A more intense pulse was detected in the contralateral trigeminal ganglion after the rat received one eye surgery. SCGx could effectively reduce the fellow corneal sensitivity and trigeminal nerve pain. These alterations were under direct regulation of the sympathetic nerves on the surgical eye side. Our results suggest that CSF3 and sympathetic activity could serve as potential analgesic targets during ocular surgeries.

17.
Biosens Bioelectron ; 206: 114132, 2022 Jun 15.
Artigo em Inglês | MEDLINE | ID: mdl-35245869

RESUMO

Fundamentally improving the sensing sensitivity of immunoassay remains a huge challenge, which limited further critical applications. Herein we designed a new immunoprobe by integrating biometric unit (antibody) and signal amplification element (enzyme) to form urease-antibody-CaHPO4 hybrid nanoflower (UAhNF) via the biomineralization process. The dual-functional UAhNF enhances the stability of urease in NaCl (10 mmol L-1) and high temperature (60 °C), and also maintains the ability of antibody recognition, fitting greatly well with the need for immunosensor. Using imidacloprid as a model target, the fixed coating antigens are competed with imidacloprid to capture primary antibodies, and the secondary antibody of UAhNF was linked to construct the competitive-type fluorogenic immunoassays. An in-situ etching process of copper nanoparticles initiated by urease is integrated with UAhNF-based immune response for further improving the detection sensitivity. The proposed immunosensor possessed a 50% inhibition concentration value of 0.72 ng mL-1, which is 30-fold lower than conventional enzyme-linked immunosorbent assay. This presented approach provided a versatile sensing tool by varying building blocks, making it practically functional for a variety of bioassay applications.


Assuntos
Técnicas Biossensoriais , Nanoestruturas , Anticorpos , Ensaio de Imunoadsorção Enzimática , Ouro , Imunoensaio , Nanoestruturas/química , Urease
18.
Anal Chem ; 94(11): 4850-4858, 2022 03 22.
Artigo em Inglês | MEDLINE | ID: mdl-35258921

RESUMO

A cost-effective and highly reproducible capillary-based surface-enhanced Raman scattering (SERS) platform for sensitive, portable detection and identification of fentanyl is presented. Through encapsulating gold trisoctahedra (Au TOH) in the capillary tube for the first time, the SERS platform was constructed by combining the superior SERS properties of Au TOH and the advantages of capillaries in SERS signal amplification, facile sample extraction, and portable trace analysis. The effects of the size and density of Au TOH on the SERS performance were investigated by experiments and simulations, which showed that the maximum SERS enhancement was obtained for Au TOH with the size of 75 nm when particle density reached 74.54 counts/µm2. The proposed SERS platform possesses good reproducibility with a relative standard deviation (RSD) of less than 5%. As a demonstration, the platform was applied to detect fentanyl spiked in aqueous solution and serum samples with a limit of detection (LOD) as low as 1.86 and 40.63 ng/mL, respectively. We also validated the feasibility of the designed platform for accurate identification of trace fentanyl adulterated in heroin at mass concentration down to 0.1% (10 ng in 10 µg total). Overall, this work advances more explorations on capillary-based SERS platform to benefit portable trace analysis.


Assuntos
Ouro , Nanopartículas Metálicas , Capilares , Fentanila , Reprodutibilidade dos Testes , Análise Espectral Raman
19.
Microbiol Spectr ; 10(2): e0259321, 2022 Apr 27.
Artigo em Inglês | MEDLINE | ID: mdl-35311590

RESUMO

Antimicrobial resistance is a global concern in chronic respiratory diseases, including chronic obstructive pulmonary disease (COPD). The collection of antibiotic resistance genes or resistome in human airways may underlie the resistance. COPD is heterogeneous, and understanding the airway resistome in relation to patient phenotype and endotype may inform precision antibiotic therapy. Here, we characterized the airway resistome for 94 COPD participants at stable disease. Among all demographic and clinical factors, patient inflammatory endotype was associated with the airway resistome. There were distinct resistome profiles between patients with neutrophilic or eosinophilic inflammation, two primary inflammatory endotypes in COPD. For neutrophil-predominant COPD, the resistome was dominated by multidrug resistance genes. For eosinophil-predominant COPD, the resistome was diverse, with an increased portion of patients showing a macrolide-high resistome. The differential antimicrobial resistance pattern was validated by sputum culture and in vitro antimicrobial susceptibility testing. Ralstonia and Pseudomonas were the top contributors to the neutrophil-associated resistome, whereas Campylobacter and Aggregatibacter contributed most to the eosinophil-associated resistome. Multiomic analyses revealed specific host pathways and inflammatory mediators associated with the resistome. The arachidonic acid metabolic pathway and matrix metallopeptidase 8 (MMP-8) exhibited the strongest associations with the neutrophil-associated resistome, whereas the eosinophil chemotaxis pathway and interleukin-13 (IL-13) showed the greatest associations with the eosinophil-associated resistome. These results highlight a previously unrecognized link between inflammation and the airway resistome and suggest the need for considering patient inflammatory subtype in decision-making about antibiotic use in COPD and broader chronic respiratory diseases. IMPORTANCE Antibiotics are commonly prescribed for both acute and long-term prophylactic treatment in chronic airway disorders, such as chronic obstructive pulmonary disease (COPD), and the rapid growth of antibiotic resistance is alarming globally. The airway harbors a diverse collection of microorganisms known as microbiota, which serve as a reservoir for antibiotic resistance genes or the resistome. A comprehensive understanding of the airway resistome in relation to patient clinical and biological factors may help inform decisions to select appropriate antibiotics for clinical therapies. By deep multiomic profiling and in vitro phenotypic testing, we showed that inflammatory endotype, the underlying pattern of airway inflammation, was most strongly associated with the airway resistome in COPD patients. There were distinct resistome profiles between neutrophil-predominant and eosinophil-predominant COPD that were associated with different bacterial species, host pathways, and inflammatory markers, highlighting the need of considering patient inflammatory status in COPD antibiotic management.


Assuntos
Asma , Doença Pulmonar Obstrutiva Crônica , Antibacterianos/farmacologia , Antibacterianos/uso terapêutico , Eosinófilos/metabolismo , Humanos , Inflamação/metabolismo , Doença Pulmonar Obstrutiva Crônica/tratamento farmacológico , Doença Pulmonar Obstrutiva Crônica/genética , Doença Pulmonar Obstrutiva Crônica/metabolismo
20.
Biosens Bioelectron ; 207: 114199, 2022 Jul 01.
Artigo em Inglês | MEDLINE | ID: mdl-35325721

RESUMO

A long-standing goal has been to create artificial enzymes with natural enzyme-like catalytic activity. Herein, a laccase-mimicking catalyst (GSH-Cu) is designed by simulating the copper active sites and spatial amino acid microenvironment of natural enzymes. In particular, the engineered GSH-Cu shows a catalytic function that conforms to Michaelis-Menten kinetics of natural laccase. The high catalytic activity of GSH-Cu can be easily inhibited by thiram through surface passivation to produce copper nanoparticles. We demonstrate that the developed GSH-Cu with high stability and recyclability can be used to fabricate effective colorimetric sensor for sensitive detection of thiram. The resulting absorption intensity can be employed to quantify thiram in the range of 2.5-250 ng mL-1, which meets the detection requirement in fruit. Bestowed with the feasibility analysis of colorimetric output, a portable platform is designed by integrating GSH-Cu based test paper with a conventional smartphone for conveniently on-site quantified thiram. The proposed strategy about engineering enzyme-mimicking catalysts with excellent catalytic performance will open avenues for boosting the sensing application.


Assuntos
Técnicas Biossensoriais , Colorimetria , Cobre/química , Lacase , Tiram
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...