Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 20
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Dig Dis Sci ; 2020 Jan 01.
Artigo em Inglês | MEDLINE | ID: mdl-31894488

RESUMO

BACKGROUND: Predictors besides symptoms of obstruction indicating small bowel stenosis are little known. AIMS: To detect predictors of small bowel stenosis in balloon-assisted enteroscopy. METHODS: Over a 6-year period, 461 patients had enteroscopy for suspected small intestinal disease. Details of clinical manifestations, medical history, demographic characteristics, findings of examinations, information on enteroscopy, and treatment were retrospectively collected based on medical records. Small bowel stenosis was defined as stricture that over-tube cannot go through in enteroscopy. Univariate and multivariate analyses were performed to identify predictors for small bowel stenosis. RESULTS: A total of 314 patients had definite diagnosis after enteroscopy, imaging modalities, and/or even surgical exploration. They were included in this study for analyses. Mean age for them was 48.2 years old (range 15-81 years). Small bowel stenosis was present in 59 patients (18.8%). Analyses showed that CT/MRI indicating stenosis was significantly associated with severe stenosis (p = 0.014) but insignificant related to general stenosis (p = 0.097). Predictive factors that accompanied stenosis were age ≥ 60 years (OR = 2.1, 95% CI 1.1-4.0), underweight (BMI ≤ 18.5) (OR = 3.4, 95% CI 1.4-8.4), symptoms of obstruction (OR = 3.6, 95% CI 1.8-7.4), and overt small bowel bleeding (OR = 0.5, 95% CI 0.2-0.9). CONCLUSIONS: Small bowel stenosis more tended to occur to patients with symptoms of obstruction, no overt small bowel bleeding, age ≥ 60 years, or underweight.

2.
Eur J Pediatr ; 2019 Dec 21.
Artigo em Inglês | MEDLINE | ID: mdl-31863304

RESUMO

For Peutz-Jeghers syndrome (PJS) patients, small bowel polyps develop and result in symptoms at an early age. Balloon-assisted enteroscopy (BAE) is verified as a safe and efficient choice to evaluate and remove small intestinal polyps in adult PJS. But the safety of BAE, especially BAE-facilitated polypectomy for young pediatrics, is little known. This prospective study focused on the effectiveness and safety of BAE-facilitated polypectomy in small bowel for young pediatric PJS. PJS patients (aged 0-14 years old) with BAE (including both single-balloon and double-balloon enteroscopies) were included from 1 September 2012 to 30 April 2018. The demographic data, medical history, and details of BAE were recorded. BAE-related complications and symptom relief after BAE were evaluated and compared between the PJS patients aged 5-10 years old (the younger pediatric group) and those aged 11-14 years old (the older pediatric group). A total of 41 pediatric PJS patients (5-14 years old) subjected to 82 BAEs were included. BAE-facilitated polypectomy was performed for 33 children (80.5%), and 242 polyps in small bowel were removed. For 10 (24.4%) patients, one or more giant polyps (maximum diameter larger than 5 cm) were removed. For eight patients, no polypectomy was done as no polyps were observed (six subjects) or not suitable for BAE-facilitated polypectomy (two subjects) because of high risk of perforation. The complication rates of BAE and BAE-facilitated polypectomy were 1.2% (1/82) and 1.8% (1/55), and the symptom relief rate was 70.8% (17/24). Compared with the older pediatric group, the younger pediatric group showed no increased BAE complication rate (0.0% vs. 5.0%, p = 0.488) and a comparable rate of symptom relief after BAE therapy (80.8% vs. 55.6%, p = 0.356).Conclusion: BAE-facilitated polypectomy in young pediatric PJS is safe and effective.What is known:• Small bowel evaluation and prophetic polypectomy are important for pediatric PJS patients to avoid polyp-related intussusception, obstruction, and bleeding.• BAE polypectomy was a recommended intervention for removing small bowel polyps in adult PJS patients.What is new:• BAE-facilitated small bowel polypectomy is safe and effective for young pediatric PJS, even for those aged less than 10 years old.

3.
Stem Cell Res Ther ; 10(1): 267, 2019 Aug 23.
Artigo em Inglês | MEDLINE | ID: mdl-31443680

RESUMO

BACKGROUND: To investigate the therapeutic effect of intercellular adhesion molecule (ICAM)-1-modified mesenchymal stem cells (MSCs) in a mouse model of inflammatory bowel disease (IBD) induced by dextran sulfate sodium. METHODS: Primary MSCs and ICAM-1-overexpressing MSCs (C3 cells) were generated in vitro. The IBD mouse model was induced with drinking water containing dextran sulfate sodium for 7 days. For stem cell therapy, mice were randomly assigned to six experimental groups: the control group, IBD group, primary MSC group, C3 group, C3-vector group, and C3-ICAM-1 group. Mice were given a single injection of 1 × 106 primary MSCs or gene-modified MSCs via the tail vein on day 3 of DDS administration. The general conditions of the mice in each group were observed. Additionally, the pathological changes in the colon were observed and scored. Primary MSCs and gene-modified MSCs were stained with the fluorescent dye CM-DIL before injection into the tail vein of mice. The distribution of infused cells in IBD mice was observed in frozen sections. Mechanistically, the polarization of Th1, Th2, Th17, and regulatory T cells (Tregs) in the spleen was determined by flow cytometry. Moreover, the mRNA expression levels of IBD-related immune factors in splenocytes were measured by quantitative PCR. RESULTS: A single injection of MSCs promoted general recovery and reduced pathological damage in IBD mice. Additionally, ICAM-1-overexpressing MSCs had stronger therapeutic effects than ICAM-1low MSCs. Furthermore, the in vivo distribution analysis results indicated that a higher number of ICAM-1-overexpressing MSCs homed to the colon and spleen of IBD mice. Moreover, the delivery of ICAM-1 overexpressing MSCs decreased the numbers of Th1 and Th17 cells but increased the number of Tregs in the spleen of IBD mice. The quantitative PCR analysis results revealed that an infusion of ICAM-1-overexpressing MSCs influenced the expression of spleen-derived immune factors by remarkably reducing the mRNA levels of IFN-γ and IL-17A and increasing the mRNA level of Foxp3. CONCLUSIONS: Our results demonstrate that ICAM-1-modified mesenchymal stem cells (MSCs) remarkably alleviate inflammatory damage in IBD mice by promoting MSC homing to the target and immune organs. The findings suggest that ICAM-1 is required to maintain the therapeutic effects of MSCs in IBD treatment and identified a novel role of ICAM-1 in inflammatory diseases.

4.
BMC Gastroenterol ; 19(1): 70, 2019 May 09.
Artigo em Inglês | MEDLINE | ID: mdl-31072341

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease, whose causative gene is STK11, mainly characterized by gastrointestinal polyposis and increased cancer risk. Clinical observation reveals intussusception in childhood are more frequent and severe than in adults, and it is difficult to prevent this knotty complication. CASE PRESENTATION: A boy without a positive family history grew oral MP after birth and developed abdominal pain and bloody stood at 7 years old. Endoscopy revealed multiple polyps within the colon and the ileum, and endoscopic polypectomy and regular surveillance protected him from severe complications and open surgeries. A heterozygous deletion in STK11, c.243delG, was detected in the proband but not in his parents. This mutation has not been documented in databases. CONCLUSIONS: We suspect a child of PJS may need a more thorough endoscopic examination including enteroscopy or capsule endoscopy to take care of small bowel when PJS related symptoms comes up.


Assuntos
Síndrome de Peutz-Jeghers/diagnóstico por imagem , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Criança , Endoscopia Gastrointestinal , Humanos , Masculino , Mutação , Síndrome de Peutz-Jeghers/cirurgia , Conduta Expectante
5.
Cancer Genet ; 230: 47-57, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30528796

RESUMO

BACKGROUND: The combination of direct sequencing and multiple ligation-dependent probe amplification (MLPA) has resulted in an 80% detection rate of serine/threonine kinase 11 (STK11) gene mutations in Peutz-Jeghers syndrome (PJS); however, this rate varies in different ethnicities. AIMS: To test the efficacy of the combination in Chinese patients with PJS. METHODS: PJS probands visiting our center during one year were enrolled. Sanger sequencing and MLPA were used to detect STK11 mutations. Associations between the occurrence of severe complications and risk factors were analyzed statistically. RESULTS: We identified 47 PJS probands. Among them, 34 received an STK11 mutation test, revealing 23 point mutations and 2 exonic deletions. Nine of the mutations were splicing errors, reflecting a significantly higher proportion (p < 0.05). Laparotomy history existed for 33 of the probands, and seven families had a history of cancer. Statistical analysis revealed no associations between the occurrence of severe complications or cancers and risk factors. CONCLUSION: The strategy achieved a high detection rate in Chinese people, validating its effectiveness. This cohort comprised a significantly higher proportion of splicing errors, reflecting the unique genetic characteristics Chinese people. No specific genotype-phenotype relationship was noted, while the wide usage of enteroscopy would benefit PJS surveillance.


Assuntos
Grupo com Ancestrais do Continente Asiático/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Processamento de RNA/genética , Adolescente , Adulto , Criança , Pré-Escolar , Análise Mutacional de DNA , Éxons/genética , Feminino , Estudos de Associação Genética , Humanos , Masculino , Pessoa de Meia-Idade , Síndrome de Peutz-Jeghers/complicações , Mutação Puntual , Deleção de Sequência , Adulto Jovem
6.
Dig Dis ; 37(2): 116-122, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-30282076

RESUMO

AIM: To analyze the epidemiological features of colorectal diverticulum (CRD) in China. METHODS: We retrospectively analyzed CRD patients in 8 tertiary hospitals located in 5 regions of China from 2000 to 2016. The detection rates, number and distribution, demographic information, concomitant disorders, and their associations were investigated. RESULTS: Of 3,446,118 cases, 7,964 (2.3%) were CRD with a mean age of 56 years (11-92 years). The detection rate increased yearly and with increasing age. Males had a higher detection rate than females (3.0 vs. 1.47%, p < 0.01) and 1.8-times higher increase rate. The detection rate increased with age; however, females of > 60 years had a 2.8-times increasing rate than males. CRD occurred most frequently in the right-side colon, followed by rectum. Multiple diverticula were common in males and increased with age, with a 3-times higher increase rate than single lesion. Single-segment CRD occurred more frequently in males than in females (80.1 vs. 76.4%, p < 0.01). Concurred colon polyps were seen in 51.05% cases. CONCLUSION: CRD detection rates increased annually and with age, particularly in senior females in China. Multiple diverticula were common in males and increased with age. CRD was predominant in the right-side colon. Polyps are the most common comorbidity associated with CRD.


Assuntos
Divertículo do Colo/epidemiologia , Reto/patologia , Caracteres Sexuais , Adulto , Fatores Etários , Idoso , China/epidemiologia , Comorbidade , Divertículo do Colo/diagnóstico , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Adulto Jovem
7.
BMC Med Genet ; 19(1): 141, 2018 08 09.
Artigo em Inglês | MEDLINE | ID: mdl-30092773

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in serine/threonine kinase 11 (STK11) gene. The increased cancer risk has been connected to P53 pathway. METHODS: PJS probands with STK11 mutation were included in the function analysis. P53 activity elevated by STK11 mutants was investigated using dual-luciferase reporter assay in vitro after constructing expression vectors of STK11 wild type and mutants generated by site-directed substitution. The association between the P53 activity and clinicopathological factors was analysis, especially the cancer history. RESULTS: Thirteen probands with STK11 mutations were involved, and within the mutations, c.G924A was novel. P53 activity elevation caused by 6 truncating mutations were significantly lower than that of STK11 wild type (P < 0.05). Family history of cancer was observed in 5 families. Within them, P53 activity was reduced and cancer occurred before 40 in 2 families, while it was not significantly changed and cancers happened after 45 in the other 3 families. CONCLUSIONS: The affected P53 activity caused by STK11 mutations in PJS patients is significantly associated with protein truncation, while cancer risk in PJS can be elevated through pathways rather than P53 pathway. P53 activity test is probably a useful supporting method to predict cancer risk in PJS, which could be helpful in clinical practice.


Assuntos
Mutação/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Transdução de Sinais/genética , Proteína Supressora de Tumor p53/genética , Adolescente , Adulto , Criança , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Fenótipo , Adulto Jovem
9.
BMC Surg ; 18(1): 24, 2018 Apr 23.
Artigo em Inglês | MEDLINE | ID: mdl-29685139

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is a Mendelian disease characterized by gastrointestinal hamartomas, mucocutaneous pigmentation (MP), and increased cancer risk. Serine/threonine kinase 11 (STK11) is the only validated causative gene in PJS. Clinical observation reveals MP and intussusception in childhood are more frequent and severe than in adults. CASE PRESENTATION: We report here a girl without a positive family history, who grew oral and fingertip MP at her age of 2 and got abdomen dull pain from 7 years old. Endoscopy revealed no obvious polyps in the stomach or the colon until 10 years old, when she received enteroscopy. Tens of polyps were resected during enteroscopy, and pathological examination confirmed them hamartomas. A heterozygous deletion in STK11, c.471_472delCT, was detected in the proband but not in her parents, which is not recorded in databases. CONCLUSION: The mutation we reported here is a novel one and a de-novo one, so our results enlarge the spectrum of STK11. We speculate close and regular endoscopy especially enteroscopy is necessary for complication prevention when the former endoscopy discovers no polyps temporarily in a child of suspect PJS.


Assuntos
Síndrome de Peutz-Jeghers/genética , Pólipos , Proteínas Serina-Treonina Quinases/genética , Grupo com Ancestrais do Continente Asiático , Criança , Feminino , Heterozigoto , Humanos , Intussuscepção/complicações , Mutação , Síndrome de Peutz-Jeghers/complicações
12.
Medicine (Baltimore) ; 96(49): e8591, 2017 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-29245219

RESUMO

RATIONALE: Peutz-Jeghers syndrome (PJS) is a Mendelian autosomal dominant disease caused by mutations in the tumor suppressor gene, serine/threonine kinase 11 (STK11). The features of this syndrome include gastrointestinal (GI) hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. Early onset of disease is often characterized by mucocutaneous pigmentation and intussusception due to GI polyps in childhood. PATIENT CONCERNS: A girl with a positive family history grew oral pigmentation at 1 and got intussusception by small bowel hamartomas at 5. DIAGNOSES: She was diagnosed with PJS based on oral pigmentation and a positive family history of PJS. INTERVENTIONS: Enteroscopy was employed to treat the GI polyps. Sanger sequencing was used to investigate STK11 mutation in this family. OUTCOMES: A large jejunal polyp together with other smaller ones was resected, and the girl recovered uneventfully. We discovered a heterozygous substitution in STK11, c.A527G in exon 4, in the girl and her father who was also a PJS patient, and the amine acid change was an aspartic acid-glycine substitution in codon 176. This mutation was not found in other healthy family members and 50 unrelated non-PJS controls, and it is not recorded in databases, which prove it a novel mutation. Evolutionary conservation analysis of amino acid residues showed this aspartic acid is a conserved one between species, and protein structure prediction by SWISS-MODEL indicated an obvious change in local structure. In addition, PolyPhen-2 score for this mutation is 1, which indicates it probably damaging. LESSONS: PJS can cause severe complication like intussusception in young children, and early screening for small bowel may be beneficial for these patients. The mutation of STK11 found in this girl is a novel one, which enlarges the spectrum of STK11. Our analysis supported it a causative one in PJS.


Assuntos
Mutação em Linhagem Germinativa , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Grupo com Ancestrais do Continente Asiático , Pré-Escolar , Feminino , Humanos
13.
BMC Med Genet ; 18(1): 130, 2017 11 15.
Artigo em Inglês | MEDLINE | ID: mdl-29141581

RESUMO

BACKGROUND: Peutz-Jeghers syndrome (PJS) is caused by mutations in the tumor suppressor gene, STK11, and is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing cancer. CASE PRESENTATION: We reported an isolated PJS patient who died of colon cancer, whose blood sample was collected together with all the available family members'. The entire coding region of the STK11 gene was amplified by PCR and analyzed by Sanger sequencing, through which, a novel mutation, c.962_963delCC in exon 8 was identified in this patient. This mutation causes a frameshift mutation and a premature termination at codon 358. Protein structure prediction by Swiss-Model indicated a dramatic change and partial loss of the C-terminal domain. We did not observe this mutation in both parents of the proband. Therefore, it is considered a novel de-novo mutation. Furthermore, the mutation was not found in 50 unrelated healthy people. CONCLUSIONS: The novel mutation we reported here had not been recorded in databases or literature, and the patient who possessed it suffered from PJS and colon cancer. So our results enlarge the spectrum of STK11 variants in PJS patients. This mutation is most likely responsible for development of the PJS phenotype, especially the cancer occurrence.


Assuntos
Grupo com Ancestrais do Continente Asiático/genética , Neoplasias/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Sequência de Aminoácidos , China , Éxons , Mutação da Fase de Leitura , Mutação em Linhagem Germinativa , Humanos , Masculino , Pessoa de Meia-Idade , Neoplasias/diagnóstico , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Conformação Proteica , Fatores de Risco , Análise de Sequência de DNA
14.
Dig Dis Sci ; 62(11): 3014-3020, 2017 11.
Artigo em Inglês | MEDLINE | ID: mdl-28986664

RESUMO

BACKGROUND AND AIMS: Peutz-Jeghers syndrome (PJS) is an autosomal-dominant genetic disease caused by mutations in the tumor suppressor gene, STK11, which is characterized by gastrointestinal hamartomas, melanin spots on the lips and the extremities, and an increased risk of developing both gastrointestinal and extraintestinal malignancies. METHODS AND RESULTS: We treated a PJS patient without a positive family history, who possessed typical clinical manifestations including polyp canceration. In order to explore the genotype of this patient, blood samples were collected from all the available family members. The whole coding region and the flanking regions of the STK11 gene were amplified by polymerase chain reaction and analyzed by Sanger sequencing. Molecular analysis of the STK11 gene here revealed a 23-nucleotide deletion (c.426-448delCGTGCCGGAGAAGCGTTTCCCAG) in exon 3, resulting in a change of 13 codons and a truncating protein (p.S142SfsX13). This mutation was not found in normal individuals in this family including her parents or in 100 control individuals. Protein structure prediction indicated a dramatic loss of the kinase domain and complete loss of the C-terminal regulatory domain. CONCLUSIONS: The results presented here enlarge the spectrum of STK11 mutation both disease-causing and malignancy-causing.


Assuntos
Biomarcadores Tumorais/genética , Síndrome de Peutz-Jeghers/genética , Proteínas Serina-Treonina Quinases/genética , Deleção de Sequência , Adulto , Grupo com Ancestrais do Continente Asiático/genética , Sequência de Bases , Biomarcadores Tumorais/química , Biomarcadores Tumorais/metabolismo , China , Análise Mutacional de DNA , Éxons , Feminino , Predisposição Genética para Doença , Hereditariedade , Heterozigoto , Humanos , Modelos Moleculares , Linhagem , Síndrome de Peutz-Jeghers/diagnóstico , Síndrome de Peutz-Jeghers/enzimologia , Síndrome de Peutz-Jeghers/etnologia , Fenótipo , Conformação Proteica , Proteínas Serina-Treonina Quinases/química , Proteínas Serina-Treonina Quinases/metabolismo , Relação Estrutura-Atividade
15.
J Huazhong Univ Sci Technolog Med Sci ; 37(3): 357-361, 2017 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-28585148

RESUMO

Small intestinal obstruction is a common complication of primary gastrointestinal cancer or metastatic cancers. Patients with this condition are often poor candidates for surgical bypasses, and placement of self-expanding metal stent (SEMS) can be technically challenging. In this study, we examined the feasibility of combined application of single-balloon enteroscope (SBE) and colonoscope for SEMS placement in patients with malignant small intestinal obstruction. Thirty-four patients were enrolled in this study, among which 22 patients received SEMS placement by using SBE and colonoscope, while the other 12 patients received conservative medical treatment. The patients were followed up for one year. Stent placement was technically feasible in 95.5% (21/22). Clinical improvement was achieved in 86.4% (19/22). For the 19 clinical success cases, the average time of benefits from a gastric outlet obstruction scoring system (GOOSS) increase ≥1 was 111.9±89.5 days. For the 12 patients receiving conservative medical treatment, no significant improvement in GOOSS score was observed. Moreover, a significant increase of Short-Form-36 health survey score was observed in the 19 patients at time of 30 days after stent placement. By Kaplan-Meier analysis, a significant survival improvement was observed in patients with successful SEMS placement, compared with patients receiving conservative medical treatment. Taken together, combined use of SBE and colonoscope makes endoscopic stent placement feasible in patients with malignant small intestinal obstruction, and patients can benefit from it in terms of prolonged survival and improved quality of life.


Assuntos
Colonoscopia/métodos , Obstrução da Saída Gástrica/cirurgia , Neoplasias Gastrointestinais/cirurgia , Obstrução Intestinal/cirurgia , Stents Metálicos Autoexpansíveis , Enteroscopia de Balão Único/métodos , Idoso , Colonoscopia/instrumentação , Feminino , Obstrução da Saída Gástrica/mortalidade , Obstrução da Saída Gástrica/patologia , Obstrução da Saída Gástrica/terapia , Neoplasias Gastrointestinais/mortalidade , Neoplasias Gastrointestinais/patologia , Neoplasias Gastrointestinais/terapia , Humanos , Obstrução Intestinal/mortalidade , Obstrução Intestinal/patologia , Obstrução Intestinal/terapia , Intestino Delgado/patologia , Intestino Delgado/cirurgia , Masculino , Pessoa de Meia-Idade , Cuidados Paliativos/métodos , Qualidade de Vida/psicologia , Enteroscopia de Balão Único/instrumentação , Análise de Sobrevida
16.
Tumour Biol ; 39(6): 1010428317705131, 2017 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-28653895

RESUMO

Peutz-Jeghers syndrome is a rare autosomal dominant inherited disorder characterized by mucocutaneous pigmentation and hamartomatous gastrointestinal polyposis. A growing body of evidence has shown that Peutz-Jeghers syndrome could cause an increased risk of various cancers, yet the range of cancer risk estimates was wide among different studies. In this retrospective cohort study, 336 patients with Peutz-Jeghers syndrome in China were enrolled. The clinical characteristics, cancer spectrum, relative cancer risks, and cumulative cancer risks were analyzed. In total, 52 patients were diagnosed of cancer in the follow-up period, at a median age of 41 years (range: 21-67). The relative risk for cancer in Peutz-Jeghers syndrome patients was 63.858 (confidence interval: 47.514-85.823), and the cumulative cancer risk at the age of 60 years was 55%. Colorectal cancer was the most common cancer for Peutz-Jeghers syndrome patients (relative risk: 237.918, confidence interval: 154.417-366.572) and the cumulative cancer risk at the age of 60 years was 28%. There was a statistically significant difference in the cumulative cancer risk between patients with family history and those without family history, as well as between patients living in rural area and those living in urban areas ( p < 0.05), while no significant effects of gender and intussusception history on the cumulative cancer risk was found ( p > 0.05). Hopefully, our study may contribute to the management of this rare disorder and establishment of related surveillance projects, especially in China.


Assuntos
Neoplasias Colorretais/epidemiologia , Neoplasias Colorretais/patologia , Síndrome de Peutz-Jeghers/epidemiologia , Síndrome de Peutz-Jeghers/patologia , Adulto , Idoso , China , Neoplasias Colorretais/complicações , Bases de Dados Genéticas , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Síndrome de Peutz-Jeghers/complicações , Estudos Retrospectivos , Fatores de Risco
17.
Zhongguo Shi Yan Xue Ye Xue Za Zhi ; 24(2): 584-9, 2016 Apr.
Artigo em Chinês | MEDLINE | ID: mdl-27151034

RESUMO

OBJECTIVE: To investigate the modulatory effect of the MSC derived from low attaching culture systems (suspending MSC) on T lymphocytes and the related mechanisms. METHODS: The suspending MSC were generated from mouse compact bones by using low attaching plates and adherent cell culture flasks, respectively. The morphology of suspending MSC was observed under the inverted microscope and the cells were induced to differentiate into osteoblasts and adipocytes. Further, the surface antigen profile of MSC was analyzed with flow cytometry. In addition, the culture medium (CM) of suspending MSC and adherent MSC was collected and added into the activated T cell cultures before detection of the proliferation by CFSE assay. Moreover, the modulaory effects of the CM on the T cell-derived cytokines were detected by quantitative PCR. Also, the mRNA expression of cytokines of MSC was detected. RESULTS: The suspending MSC grew in floating cell spheres and differentiated into osteoblasts and adipocytes in the induction medium. Furthermore, the suspending MSC shared the typical immuno-phenotype with their adherent counterparts. In addition, the results of CFSE assay demonstrated that suspending MSC derived CM suppressed ConA induced T cell proliferation. The results of quantitative PCR revealed that suspending MSC expressed transforming factor ß1 and interleukin-6 at a higher level and suppressed the T cell expressing interferon γ and interleukine-17A. CONCLUSION: The suspending MSC exerted an unique modulatoy effect on T cells, which is quite different to adherent MSC.


Assuntos
Meios de Cultivo Condicionados , Células-Tronco Mesenquimais/citologia , Linfócitos T/citologia , Adipócitos/citologia , Animais , Adesão Celular , Técnicas de Cultura de Células , Diferenciação Celular , Proliferação de Células , Citometria de Fluxo , Imunofenotipagem , Interleucina-6/metabolismo , Ativação Linfocitária , Camundongos , Osteoblastos/citologia , Linfócitos T/metabolismo , Fator de Crescimento Transformador beta1/metabolismo
18.
Sci Rep ; 6: 21381, 2016 Feb 15.
Artigo em Inglês | MEDLINE | ID: mdl-26877248

RESUMO

This study aimed to investigate the occurrence of and determine the risk factors for steatorrhea in chronic pancreatitis (CP). It was based on analysis of both retrospectively and prospectively acquired database for CP patients admitted to our center from January 2000 to December 2013. Demographic data, course of disease, medical history, and follow-up evaluations of patients were documented in detail. Cumulative rate of steatorrhea was calculated by using the Kaplan-Meier method. For risk factor analysis, multivariate analysis by Cox proportional hazards regression model was performed. A total of 2,153 CP patients were included with a mean follow-up duration of 9.3 years. Approximately 14% (291/2,153) of CP patients presented with steatorrhea at diagnosis of CP. Cumulative rates of steatorrhea at 1, 5, 10, and 20 years after diagnosis of CP were 4.27% (95% CI: 3.42%-5.34%), 12.53% (95% CI: 10.74%-14.59%), 20.44% (95% CI: 17.37%-23.98%) and 30.82% (95% CI: 20.20%-45.21%), respectively. Male gender (HR = 1.771, p = 0.004), diabetes (HR = 1.923, p < .001), alcohol abuse (HR = 1.503, p = 0.025) and pancreaticoduodenectomy (HR = 2.901, p < 0.001) were independent risk factors for steatorrhea while CP in adolescents (HR = 0.433, p = 0.009) was a protective factor. In conclusion, male gender, adult, diabetes, alcohol abuse and pancreaticoduodenectomy lead to increased risk of steatorrhea in CP patients.


Assuntos
Complicações do Diabetes/epidemiologia , Diabetes Mellitus/epidemiologia , Pancreatite Crônica/epidemiologia , Esteatorreia/epidemiologia , Adolescente , Adulto , Fatores Etários , Idoso , Alcoolismo/complicações , Alcoolismo/patologia , Estudos de Coortes , Complicações do Diabetes/patologia , Diabetes Mellitus/patologia , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Pancreatite Crônica/complicações , Pancreatite Crônica/patologia , Modelos de Riscos Proporcionais , Estudos Retrospectivos , Fatores de Risco , Esteatorreia/etiologia , Esteatorreia/patologia
19.
Gastrointest Endosc ; 84(1): 69-78, 2016 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-26542375

RESUMO

BACKGROUND AND AIMS: We aimed to investigate outcomes of pancreatic extracorporeal shock wave lithotripsy (P-ESWL) for the removal of large pancreatic stones coexisting with pancreatic pseudocysts (PPCs) in chronic pancreatitis (CP). METHODS: This is a prospective study performed in CP patients with at least 1 stone (≥5 mm). Patients were divided into the PPC group (stones coexisting with PPCs) or the control group (stones alone). Patients were initially subjected to successive P-ESWL treatments, followed by ERCP. Primary outcomes were P-ESWL adverse events, and secondary outcomes were stone clearance, long-term pain relief, improved quality-of-life scores, and PPC regression. RESULTS: A total of 849 patients (59 in the PPC group and 790 in the control group) was subjected to P-ESWL between March 2011 and October 2013. Occurrences of P-ESWL adverse events were similar between the PPC group and the control group (11.86% vs 12.41%, P = .940). After the treatment of initial P-ESWL combined with ERCP, the complete, partial, and nonclearance of stones occurred in 67.24%, 20.69%, and 12.07%, respectively, of patients in PPC group, with no significant difference from the control group (complete, partial, and nonclearance: 83.17%, 10.40%, and 11.39%, respectively; P = .106). Fifty-five of 59 patients (93.22%) with PPCs were followed for a median period of 21.9 months (range, 12.0-45.1). PPCs disappeared in 56.36% (31/55) and 76.36% (42/55) of patients after 3 months and 1 year of follow-up visits, respectively. Moreover, complete and partial pain relief were achieved in 63.64% (35/55) and 25.45% (14/55) of patients, respectively. The scores for quality of life (P < .001), physical health (P < .001), and weight loss (P < .001) improved. CONCLUSIONS: In our multispecialty tertiary center, initial P-ESWL followed by ERCP was safe in patients with coexisting pancreatic stones and PPCs and effective for stone clearance, main pancreatic duct drainage, and pain relief.


Assuntos
Cálculos/terapia , Colangiopancreatografia Retrógrada Endoscópica/métodos , Pseudocisto Pancreático/cirurgia , Pancreatite Crônica/complicações , Adolescente , Adulto , Cálculos/diagnóstico por imagem , Cálculos/etiologia , Estudos de Casos e Controles , Endossonografia , Feminino , Hemorragia/epidemiologia , Humanos , Litotripsia , Imagem por Ressonância Magnética , Masculino , Pessoa de Meia-Idade , Pancreatopatias/diagnóstico por imagem , Pancreatopatias/etiologia , Pancreatopatias/terapia , Pseudocisto Pancreático/diagnóstico por imagem , Pseudocisto Pancreático/etiologia , Pancreatite/epidemiologia , Complicações Pós-Operatórias/epidemiologia , Estudos Prospectivos , Infecção da Ferida Cirúrgica/epidemiologia , Tomografia Computadorizada por Raios X , Resultado do Tratamento , Adulto Jovem
20.
Chin J Dig Dis ; 5(1): 17-21, 2004.
Artigo em Inglês | MEDLINE | ID: mdl-15612667

RESUMO

OBJECTIVE: Nitric oxide (NO) is a major inhibitory neurotransmitter, and its deficiency plays an important role in the pathogenesis of motility disorders of the gastrointestinal tract. The present study was designed to generate a recombinant adenovirus containing the tetracycline (Tet)-regulated endothelial nitric oxide synthase (eNOS) gene and to detect the controllable expression of the gene in esophageal smooth muscle cells (ESMC). METHODS: The construction of the recombinant adenovirus was completed in three steps: (1) a Tet-responsible expression cassette was made by cloning the full-length cDNA encoding eNOS into a pTRE-Shuttle Vector, which can be regulated by tetracycline or its analogs, such as doxycycline (Dox); (2) the expression cassette was transferred to Adeno-X viral DNA to form a recombinant adenoviral plasmid (pAd-eNOS) by means of an in vitro ligation reaction; and (3) the Ad-eNOS was packaged into infectious adenoviral particles (Adeno-X-TRE-eNOS) by transfecting human embryonic kidney (HEK) 293 cells. Cultured ESMC were coinfected by Adeno-X-TRE-eNOS and regulation virus (Adeno-X Tet-off virus), and the Dox-regulated eNOS expression was detected by RT-PCR and western blot. RESULTS: The recombinant adenovirus (Adeno-X-TRE-eNOS) was generated successfully by an in vitro ligation reaction. The expression of the eNOS gene in the coinfected ESMC was confirmed by RT-PCR and western blot. Furthermore, the transcription could be precisely regulated in a dose-dependent manner in a series of concentrations of Dox, and it was completely turned off when the concentration reached 0.01 microg/mL. CONCLUSIONS: A Tet- (or Dox-) regulated recombinant adenovirus carrying eNOS was successfully generated and controllable expression of eNOS in ESMC was achieved, which provides some material for conducting further gene therapy studies with eNOS.


Assuntos
Adenoviridae/genética , Esôfago/enzimologia , Vetores Genéticos , Óxido Nítrico Sintase/genética , Animais , Gatos , Células Cultivadas , Expressão Gênica , Técnicas de Transferência de Genes , Humanos , Músculo Liso/enzimologia , Óxido Nítrico Sintase Tipo III , Plasmídeos , Transfecção
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA