Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 47
Filtrar
1.
Oncol Rep ; 47(5)2022 May.
Artigo em Inglês | MEDLINE | ID: mdl-35266009

RESUMO

Head and neck cancers are diverse and complex diseases characterised by unregulated growth of tumour cells in various parts of the head and neck region, such as in the buccal mucosa, floor of the mouth, tongue, oropharynx, hypopharynx, oesophagus, nasopharynx and salivary glands. Partial or total glossectomy, radiation or chemotherapy greatly affect patient quality of life. However, even following treatment, patients may relapse. Nicotine­derived nitrosamines and alcohol are the major etiological factors underlying this deadly disease. These compounds induce DNA damage that may lead to mutation in crucial genes, such as p53 and p21, which are important to regulate cell proliferation, thus leading to cancer. CD9 is a tetraspanin, which are a group of transmembrane proteins that have a role in cell motility and adhesion. The present review aimed to explore the role of CD9 in head and neck cancer. Epidermal growth factor receptor activity and cell proliferation are regulated by the CD9­integrin/CD9­transforming growth factor interaction. Hence, CD9 can play a dual role in various types of cancer.


Assuntos
Neoplasias de Cabeça e Pescoço , Qualidade de Vida , Neoplasias de Cabeça e Pescoço/genética , Humanos , Recidiva Local de Neoplasia , Tetraspanina 29/genética , Tetraspaninas
2.
Indian J Clin Biochem ; 37(1): 60-68, 2022 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-35125694

RESUMO

Preeclampsia (PE) remains the major cause for maternal and foetal mortality and morbidity all over the world. Preeclampsia is associated with maternal, placental aggravated inflammatory response and generalized endothelial damage. AnnexinA1 (AnxA1) is glucocorticoid regulated protein regulates a wide range of cellular and molecular steps of the inflammatory response and is implicated in resolution of inflammation. Galectin-3 (Gal-3), ß-galcotoside-binding lectin participates in many functions, both intra- and extracellularly. Recently it has been shown that galectin-3 modulates the inflammation. Role of AnxA1 and Galectin-3 is poorly studied in context with human reproductive disease like Preeclampsia. Therefore, the present study examined the expression of AnxA1 and Gal-3 which are involved in modulation of inflammation and their association in the placental bed of pregnancy with and without PE. The study group consisted of placental bed biopsy tissues obtained from pregnancies with PE (n = 30) and without (n = 30) PE. The expression of AnxA1 and Gal-3 in the placental bed tissues was evaluated quantitatively using Immunohisto-chemistry (IHC), western blot and mRNA expression analysis by quantitative RT-PCR. Our IHC, western blot and RT PCR analyses showed the increase in the expression of AnxA1 and Gal-3 in PE group compared with the normotensive control group (P < 0.001). The increased expression of AnxA1 and Gal-3 in placental bed may be associated with a systemic inflammatory response in PE, suggesting role of AnxA1 and Gal-3 in PE pathogenesis.

3.
J Biomol Struct Dyn ; 40(6): 2701-2714, 2022 04.
Artigo em Inglês | MEDLINE | ID: mdl-33146070

RESUMO

SARS-CoV-2 has become a pandemic causing a serious global health concern. The absence of effective drugs for treatment of the disease has caused its rapid spread on a global scale. Similarly to the SARS-CoV, the SARS-CoV-2 is also involved in a complex interplay with the host cells. This infection is characterized by a diffused alveolar damage consistent with the Acute Respiratory Disease Syndrome (ARDS). To explore the complex mechanisms of the disease at the system level, we used a network medicine tools approach. The protein-protein interactions (PPIs) between the SARS-CoV and the associated human cell proteins are crucial for the viral pathogenesis. Since the cellular entry of SARS-CoV-2 is accomplished by binding of the spike glycoprotein binding domain (RBD) to the human angiotensin-converting enzyme 2 (hACE2), a molecule that can bind to the spike RDB-hACE2 interface could block the virus entry. Here, we performed a virtual screening of 55 compounds to identify potential molecules that can bind to the spike glycoprotein and spike-ACE2 complex interface. It was found that the compound ethyl 1-{3-[(2,4-dichlorobenzyl) carbamoyl]-1-ethyl-6-fluoro-4-oxo-1,4-dihydro-7-quinolinyl}-4-piperidine carboxylate (the S54 ligand) and ethyl 1-{3-[(2,4-dichlorobenzyl) carbamoyl]-1-ethyl-6-fluoro-4-oxo-1,4-dihydro-7-quinolinyl}-4 piperazine carboxylate (the S55 ligand) forms hydrophobic interactions with Tyr41A, Tyr505B and Tyr553B, Leu29A, Phe495B, respectively of the spike glycoprotein, the hotspot residues in the spike glycoprotein RBD-hACE2 binding interface. Furthermore, molecular dynamics simulations and free energy calculations using the MM-GBSA method showed that the S54 ligand is a stronger binder than a known SARS-CoV spike inhibitor SSAA09E3 (N-(9,10-dioxo-9, 10-dihydroanthracen-2-yl) benzamide).Communicated by Ramaswamy H. Sarma.


Assuntos
Enzima de Conversão de Angiotensina 2 , Antivirais/química , SARS-CoV-2 , Glicoproteína da Espícula de Coronavírus , Enzima de Conversão de Angiotensina 2/química , COVID-19 , Humanos , Simulação de Acoplamento Molecular , Ligação Proteica , SARS-CoV-2/efeitos dos fármacos , Glicoproteína da Espícula de Coronavírus/química
4.
Front Genet ; 13: 866504, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35495126

RESUMO

Present research discovered novel miRNA-SSRs for seed type trait from 761 potential precursor miRNA sequences of pomegranate. SSR mining and BLASTx of the unique sequences identified 69 non-coding pre-miRNA sequences, which were then searched for BLASTn homology against Dabenzi genome. Sixty three true pri-miRNA contigs encoding 213 pre-miRNAs were predicted. Analysis of the resulting sequences enabled discovery of SSRs within pri-miRNA (227) and pre-miRNA sequences (79). A total of 132 miRNA-SSRs were developed for seed type trait from 63 true pri-miRNAs, of which 46 were specific to pre-miRNAs. Through ePCR, 123 primers were validated and mapped on eight Tunisia chromosomes. Further, 80 SSRs producing specific amplicons were ePCR-confirmed on multiple genomes i.e. Dabenzi, Taishanhong, AG2017 and Tunisia, yielding a set of 63 polymorphic SSRs (polymorphism information content ≥0.5). Of these, 32 miRNA-SSRs revealed higher polymorphism level (89.29%) when assayed on six pomegranate genotypes. Furthermore, target prediction and network analysis suggested a possible association of miRNA-SSRs i.e. miRNA_SH_SSR69, miRNA_SH_SSR36, miRNA_SH_SSR103, miRNA_SH_SSR35 and miRNA_SH_SSR53 with seed type trait. These miRNA-SSRs would serve as important genomic resource for rapid and targeted improvement of seed type trait of pomegranate.

5.
Int J Mol Sci ; 22(20)2021 Oct 13.
Artigo em Inglês | MEDLINE | ID: mdl-34681689

RESUMO

Severe acute respiratory syndrome-coronavirus 2 (SARS-CoV-2) has infected >235 million people and killed over 4.8 million individuals worldwide. Although vaccines have been developed for prophylactic management, there are no clinically proven antivirals to treat the viral infection. Continuous efforts are being made all over the world to develop effective drugs but these are being delayed by periodic outbreak of mutated SARS-CoV-2 and a lack of knowledge of molecular mechanisms underlying viral pathogenesis and post-infection complications. In this regard, the involvement of Annexin A2 (AnxA2), a lipid-raft related phospholipid-binding protein, in SARS-CoV-2 attachment, internalization, and replication has been discussed. In addition to the evidence from published literature, we have performed in silico docking of viral spike glycoprotein and RNA-dependent RNA polymerase with human AnxA2 to find the molecular interactions. Overall, this review provides the molecular insights into a potential role of AnxA2 in the SARS-CoV-2 pathogenesis and post-infection complications, especially thrombosis, cytokine storm, and insulin resistance.


Assuntos
Anexina A2/metabolismo , COVID-19/patologia , Anexina A2/química , COVID-19/virologia , Síndrome da Liberação de Citocina/metabolismo , Síndrome da Liberação de Citocina/patologia , Humanos , Simulação de Acoplamento Molecular , RNA Polimerase Dependente de RNA/química , RNA Polimerase Dependente de RNA/metabolismo , SARS-CoV-2/isolamento & purificação , SARS-CoV-2/metabolismo , Glicoproteína da Espícula de Coronavírus/química , Glicoproteína da Espícula de Coronavírus/metabolismo , Trombose/metabolismo , Trombose/patologia , Internalização do Vírus
6.
Front Genet ; 12: 704075, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34394192

RESUMO

Here we report on comprehensive chloroplast (cp) genome analysis of 16 pomegranate (Punica granatum L.) genotypes representing commercial cultivars, ornamental and wild types, through large-scale sequencing and assembling using next-generation sequencing (NGS) technology. Comparative genome analysis revealed that the size of cp genomes varied from 158,593 bp (in wild, "1201" and "1181") to 158,662 bp (cultivar, "Gul-e-Shah Red") among the genotypes, with characteristic quadripartite structures separated by a pair of inverted repeats (IRs). The higher conservation for the total number of coding and non-coding genes (rRNA and tRNA) and their sizes, and IRs (IR-A and IR-B) were observed across all the cp genomes. Interestingly, high variations were observed in sizes of large single copy (LSC, 88,976 to 89,044 bp) and small single copy (SSC, 18,682 to 18,684 bp) regions. Although, the structural organization of newly assembled cp genomes were comparable to that of previously reported cp genomes of pomegranate ("Helow," "Tunisia," and "Bhagawa"), the striking differences were observed with the Lagerstroemia lines, viz., Lagerstroemia intermedia (NC_0346620) and Lagerstroemia speciosa (NC_031414), which clearly confirmed previous findings. Furthermore, phylogenetic analysis also revealed that members outside the genus Punica were clubbed into a separate clade. The contraction and expansion analysis revealed that the structural variations in IRs, LSC, and SSC have significantly accounted for the evolution of cp genomes of Punica and L. intermedia over the periods. Microsatellite survey across cp genomes resulted in the identification of a total of 233 to 234 SSRs, with majority of them being mono- (A/T or C/G, 164-165 numbers), followed by di- (AT/AT or AG/CT, 54), tri- (6), tetra- (8), and pentanucleotides (1). Furthermore, the comparative structural variant analyses across cp genomes resulted in the identification of many varietal specific SNP/indel markers. In summary, our study has offered a successful development of large-scale cp genomics resources to leverage future genetic, taxonomical, and phylogenetic studies in pomegranate.

7.
Indian J Surg Oncol ; 12(2): 421-427, 2021 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-34295089

RESUMO

Metastatic breast cancer is not a curable disease, but women with metastatic disease are living longer. Although the relative survival has improved in recent years still patients who present with metastatic disease have a less than 30% 5-year survival. Historically, removal of the primary breast tumor has been offered to these patients only for palliation. However, there have been recent reports that removal of the primary tumor may improve survival. These are mostly retrospective studies limited by selection bias. Prospective and randomized trials have not shown a clear survival advantage. Although the definitive role of removal of the primary tumor in metastatic breast cancer is not settled, it is critical to understand the complexities of this debate in order to make further gains in breast cancer survivorship.

8.
F1000Res ; 10: 273, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34046165

RESUMO

Coronavirus disease 2019 (CoVID-19) caused by Severe Acute Respiratory Syndrome Coronavirus 2 has affected more than 100 million lives. Severe CoVID-19 infection may lead to acute respiratory distress syndrome and death of the patient, and is associated with hyperinflammation and cytokine storm. The broad spectrum immunosuppressant corticosteroid, dexamethasone, is being used to manage the cytokine storm and hyperinflammation in CoVID-19 patients. However, the extensive use of corticosteroids leads to serious adverse events and disruption of the gut-lung axis. Various micronutrients and probiotic supplementations are known to aid in the reduction of hyperinflammation and restoration of gut microbiota. The attenuation of the deleterious immune response and hyperinflammation could be mediated by short chain fatty acids produced by the gut microbiota. Butyric acid, the most extensively studied short chain fatty acid, is known for its anti-inflammatory properties. Additionally, butyric acid has been shown to ameliorate hyperinflammation and reduce oxidative stress in various pathologies, including respiratory viral infections. In this review, the potential anti-inflammatory effects of butyric acid that aid in cytokine storm depletion, and its usefulness in effective management of critical illness related to CoVID-19 have been discussed.


Assuntos
Butiratos , COVID-19 , Butiratos/uso terapêutico , COVID-19/tratamento farmacológico , Dexametasona , Humanos , SARS-CoV-2
9.
Artigo em Inglês | MEDLINE | ID: mdl-33878253

RESUMO

OBJECTIVES: Preeclampsia (PE) remains the major cause for maternal and foetal mortality and morbidity. Invasion of endovascular trophoblast and remodelling of spiral artery are crucial actions of normal placental development. Non-fulfilment of these processes plays a leading role in the development of preeclampsia. Vascular endothelial growth factor (VEGF) is produced by extravillous trophoblastic tissue and decidual cell population is a well-known angiogenic growth which plays a fundamental role in placental pathogenesis of PE. Annexin A2 (ANXA2) is a profibrinolytic protein receptor required for plasminolysis, which is an important step in the formation of new blood vessel along with VEGF. Role of ANXA2 is poorly studied in context with human reproductive disease like preeclampsia. The purpose of the present study is to examine the expression and association of VEGF and ANXA2 in the term placentas of pregnancies with and without PE. METHODS: The study group comprised of placental tissues procured from gestations with PE (n=30) and without (n=20) PE. The expression of VEGF and ANXA2 in the placental villous tissue was evaluated quantitatively by means of IHC, western blotting and reverse transcriptase-polymerase chain reaction (RT-PCR). RESULTS: Our IHC, western blotting and RT-PCR analysis illustrated the significant decrease in the expression of VEGF and ANXA2 in PE group compared with the normotensive control group (p<0.005). We observed statistically significant positive correlation among the expression of ANXA2 and VEGF in placentas of normotensive control group (p<0.0001). CONCLUSIONS: The diminished expression of VEGF and ANXA2 in placenta may be associated with the defective angiogenesis and which may possibly play a vital role in PE pathogenesis.

10.
Front Plant Sci ; 12: 645055, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-33796127

RESUMO

The simple sequence repeat (SSR) survey of 'Tunisia' genome (296.85 Mb) identified a total of 365,279 perfect SSRs spanning eight chromosomes, with a mean marker density of 1,230.6 SSRs/Mb. We found a positive trend in chromosome length and the SSR abundance as marker density enhanced with a shorter chromosome length. The highest number of SSRs (60,708) was mined from chromosome 1 (55.56 Mb), whereas the highest marker density (1,294.62 SSRs/Mb) was recorded for the shortest chromosome 8 (27.99 Mb). Furthermore, we categorized all SSR motifs into three major classes based on their tract lengths. Across the eight chromosomes, the class III had maximum number of SSR motifs (301,684, 82.59%), followed by the class II (31,056, 8.50%) and the class I (5,003, 1.37%). Examination of the distribution of SSR motif types within a chromosome suggested the abundance of hexanucleotide repeats in each chromosome followed by dinucleotides, and these results are consistent with 'Tunisia' genome features as a whole. Concerning major repeat types, AT/AG was the most frequent (14.16%), followed by AAAAAT/AAAAAG (7.89%), A/C (7.54%), AAT/AAG (5.23%), AAAT/AAAG (4.37%), and AAAAT/AAAAG (1.2%) types. We designed and validated a total of 3,839 class I SSRs in the 'Tunisia' genome through electronic polymerase chain reaction (ePCR) and found 1,165 (30.34%) SSRs producing a single amplicon. Then, we selected 906 highly variable SSRs (> 40 nt) from the ePCR-verified class I SSRs and in silico validated across multiple draft genomes of pomegranate, which provided us a subset of 265 highly polymorphic SSRs. Of these, 235 primers were validated on six pomegranate genotypes through wet-lab experiment. We found 221 (94%) polymorphic SSRs on six genotypes, and 187 of these SSRs had ≥ 0.5 PIC values. The utility of the developed SSRs was demonstrated by analyzing genetic diversity of 30 pomegranate genotypes using 16 HvSSRs spanning eight pomegranate chromosomes. In summary, we developed a comprehensive set of highly polymorphic genome-wide SSRs. These chromosome-specific SSRs will serve as a powerful genomic tool to leverage future genetic studies, germplasm management, and genomics-assisted breeding in pomegranate.

11.
Plant Dis ; 2021 Mar 24.
Artigo em Inglês | MEDLINE | ID: mdl-33761772

RESUMO

Wild species or crop wild relatives (CWRs) provide a unique opportunity to introduce novel traits and expand the genetic base of the cultivated pigeonpea (Bohra et al. 2010, 2020). Among the wild relatives of pigeonpea, Cajanus scarabaeoides is cross-compatible with cultivated pigeonpea (C. cajan). To identify the resistant sources for use in the pigeonpea breeding, the present study was conducted using 79 wild pigeonpea accessions at ICAR-Indian Institute of Pulses Research, Kanpur, India during 2016-17 and 2017-18 (Figures 1 a and b). The pigeonpea accessions belonged to three different genera Cajanus, Rhynchosia and Flemingia. During field scouting, seedlings were observed with foliar chlorosis and wilting (Fig. 2a). Infected stem tissue exhibited brown to black discoloration, followed by gradual plant drying, and ultimately plant death (Fig. 2b). Infected plants were collected from the field and pathological examination was performed in the laboratory conditions. Wilted plant parts were surface-disinfected with 1% sodium hypochlorite for two minutes and 5.0 mm size pieces of stem tissue were transferred to petri-dishes containing 90ml of Fusarium Specific Medium (FSM) (Nash and Snyder 1962) and incubated at 27oC. After 48 hrs of incubation, white to orange aerial mycelial growth was observed (Fig. 2c). The fungus was transferred to fresh FSM and purified by the single-spore technique (Choi et al. 1999). Macroconidia had four to six septa, slightly curved at the apex ranged from 20.0 to 25.0 × 3.0 to 5.5 µm (Fig. 2d). Microconidia were absent. The isolated fungus was putatively identified as belonging to the F. equiseti species complex based on colony morphology and macroconidia characteristics and size (Booth, 1977; Leslie and Summerell 2004). The pathogenicity test was conducted on 15-day old healthy seedlings of wild pigeonpea using 'root dip inoculation' and 'soil inoculation' technique (Haware and Nene 1994). Plant roots were immersed in a conidial suspension (6×106 conidia/ml water as determined by a hemocytometer) for 3-4 minutes (Marley and Hillocks 1996), while the roots of control plant were immersed in sterilized distilled water. A single spore culture of F. equiseti was grown on PDA-containing perti-dishes. Two actively grown mycelia discs (5 mm dia) from the periphery of 7-day old pure culture of F. equiseti were separately inoculated in 500 ml conical flasks containing 100g pigeonpea meal medium. The flasks were incubated at 28±2°C for 10 days. A fungus-soil mixture was prepared by mixing 200 g of inoculums with 2kg of autoclaved sand: soil mixture (3:7). Earthen pots having 15-cm diameter were sterilized by formalin (0.1%). These pots were then filled with fungus-soil mixture. Seeds sterilized with mercuric chloride (1%) were sown in each pot. Seeds sown in uninoculated pots served as control. Five seeds were sown in each pot with three replications. Disease symptoms developed 10 days after inoculation of wild pigeonpea plants in greenhouse. Symptoms were identical to those observed in the field. No symptoms were observed in control. Re-isolating the F. equiseti pathogen from the inoculated wild pigeonpea seedlings corroborated Koch's postulates. Reference cultures of three isolates of F. equiseti were deposited in Indian Type of Culture Collection (ITCC), Division of Plant Pathology, ICAR-Indian Agricultural Research Institute (IARI), New Delhi with the accession numbers ITCC8413, ITCC8414 and ITCC8415. Fungal genomic DNA was extracted through modified CTAB method (Murray and Thompson 1980). The ITS regions 1 and 2, including 5.8S ribosomal DNA (rDNA) region, and part of translation elongation factor 1-α (TEF) were amplified by using the ITS6F (GAAGGTGAAGTCGTAACAGG) and ITS4R (TCCTCCGCTTATTGATATGC) and tef (F: ATGGGTAAGGAAGACAAGAC; R: GGAAGTACCAGTGAATCATGTT) primers. BLASTn analysis of the sequences generated showed a 98.78% homology with F. equiseti. The sequences were deposited at GenBank (Accession numbers of ITS region: MF351849, MF351850, MF351851, and Tef region: MK259963, MK264345, MK264346). Phylogenetic analysis of the ITS and Tef region sequences revealed that all Fusarium isolates belong to the F. equiseti species complex and other available sequences of Fusarium spp. (Fig. 3). Occurrence of F. equiseti on various plant species is reported worldwide by several researchers (Liang et al. 2011; Ramachandra and Bhatt 2012; Prasad et al. 2017). To the best of our knowledge and based on the literature, this is the first report of wilt disease on wild pigeonpea in India, caused by F. equiseti (Corda) Sacc.

12.
Saudi J Biol Sci ; 27(12): 3514-3528, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-33304163

RESUMO

Pomegranate (Punica granatum L.) is an important fruit crop, rich in fiber, vitamins, antioxidants, minerals and source of different biologically active compounds. The bacterial blight caused by Xanthomonas axonopodispv. punicae is a serious threat to the crop leading to 60-80% yield loss under epiphytotic conditions. In this work, we have generated comparative transcriptome profile to mark the gene expression signatures during resistance and susceptible interactions. We analyzed leaf and fruits samples of moderately resistant genotype (IC 524207) and susceptible variety (Bhagawa) of pomegranate at three progressive infection stages upon inoculation with the pathogen. RNA-Seq with the Illumina HiSeq 2500 platform revealed 1,88,337 non-redundant (nr) transcript sequences from raw sequencing data, for a total of 34,626 unigenes with size >2 kb. Moreover, 85.3% unigenes were annotated in at least one of the seven databases examined. Comparative analysis of gene-expression signatures in resistant and susceptible varieties showed that the genes known to be involved in defense mechanism in plants were up-regulated in resistant variety. Gene Ontology (GO) analysis successfully annotated 90,485 pomegranate unigenes, of which 68,464 were assigned to biological, 78,107 unigenes molecular function and 44,414 to cellular components. Significantly enriched GO terms in DEGs were related to oxidations reduction biological process, protein binding and oxidoreductase activity. This transcriptome data on pomegranate could help in understanding resistance and susceptibility nature of cultivars and further detailed fine mapping and functional validation of identified candidate gene would provide scope for resistance breeding programme in pomegranate.

13.
J Cancer Res Ther ; 16(4): 938-940, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32930147

RESUMO

We report the very rare case of recurrent unilateral pleural effusion in a 53-year-old male. Computed tomography (CT) scan and magnetic resonance imaging revealed a left-sided paravertebral mass at D3 level. Multiple biopsy and CT scan lead us to the diagnosis of "Angiomatous Malformation." The lesion was excised surgically which on final histopathological report termed hemangioma.


Assuntos
Hemangioma/patologia , Derrame Pleural Maligno/patologia , Hemangioma/diagnóstico por imagem , Hemangioma/cirurgia , Humanos , Imageamento por Ressonância Magnética/métodos , Masculino , Pessoa de Meia-Idade , Derrame Pleural Maligno/diagnóstico por imagem , Derrame Pleural Maligno/cirurgia , Prognóstico , Tomografia Computadorizada por Raios X/métodos
14.
Physiol Mol Biol Plants ; 26(6): 1249-1261, 2020 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-32549687

RESUMO

The present study investigates the genetic diversity and population structure among 42 diverse pomegranate genotypes using a set of twenty one class I hypervariable SSR markers (> 24 bp), which were reported earlier from the analysis of cv. Dabenzi genome. The study material comprised 16 indigenous and 13 exotic cultivars, and 13 wild accessions. A total of 66 alleles (Na) were detected with an average of 3.14 alleles per marker. The average values of polymorphic information content (PIC), observed heterozygosity (Ho) and Shannon's gene diversity index (I) were 0.44, 0.21 and 0.95, respectively suggesting moderate genetic diversity. The pairwise genetic distance ranged from 0.07 to 0.80 with a mean value of 0.53. Population structure analysis divided all the genotypes into four subpopulations (SP1, SP2, SP3 and SP4). Interestingly, the results of phylogenetic and principal component analyses coincided with the results of structure analysis and the grouping of genotypes followed the geographical origins. AMOVA revealed that 25% of the variation was attributed to differences among populations, whereas 75% within the subpopulations with significant F ST value 0.25 (p < 0.001), indicating a high level of genetic differentiations or low level of gene flow. Based on the F ST values, pomegranate genotypes belonging to SP4 (indigenous cultivars) followed by SP1 (exotic lines) exhibited higher gene diversity and genetic differentiations within and among populations. These genetic relationships based on SSR markers could be harnessed in future genetic improvement of pomegranate through informed hybridization programs.

15.
Physiol Mol Biol Plants ; 26(4): 683-696, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32255932

RESUMO

A total of 17,439 mature miRNAs (~ 21 nt) earlier generated through RNA seq in the pomegranate were used for in silico analysis. After complexity reduction, a total of 1922 representative mature miRNAs were selected and used as query sequences against pomegranate genome to retrieve 2540 homologous contigs with flanking regions (~ 800). By using pre-miRNA prediction web server, a total of 1028 true contigs harbouring pri-miRNAs encoding 1162 pre-miRNAs were identified. Survey of these sequences for SSRs yielded a total of 1358 and 238 SSRs specific to pri-miRNA and pre-miRNAs, respectively. Of these, primer pairs were designed for 897 pri-miRNA and 168 pre-miRNA SSRs. In pri-miRNA sequences, hexa-nucleotides repeats were found to be most abundant (44.18%) followed by mono- (18.41%) and di-nucleotide (17.01%), which is also observed in pre-miRNA sequences. Further, a set of 51 randomly selected pre-miRNA-SSRs was examined for marker polymorphism. The experimental validation of these markers on eight pomegranate genotypes demonstrated 92.15% polymorphism. Utility of these functional markers was confirmed via examination of genetic diversity of 18 pomegranate genotypes using 15 miRNA-SSRs. Further, potential application of miRNA-SSRs for discovery of trait specific candidate genes was showed by validating 51 mature miRNA against publically available 2047 EST sequences of pomegranate by target and network analysis. In summary, the current study offers novel functional molecular markers for pomegranate genetic improvement.

16.
Org Biomol Chem ; 18(5): 988-998, 2020 02 07.
Artigo em Inglês | MEDLINE | ID: mdl-31942895

RESUMO

An efficient one-pot two-step sequential reaction for the synthesis of biologically active 3-hydroxyisoindolin-1-one derivatives from 2-iodobenzamide derivatives and various substituted benzyl cyanides in the presence of CuCl and cesium carbonate in DMSO is reported. Furthermore, 3-hydroxyisoindolinone derivatives possessing bromo substituents were obtained from 2-iodobenzamide and 2-bromobenzyl cyanide substrates in two steps. Benzyl cyanide has been successfully used for the first time as a benzoyl synthon for the synthesis of 3-hydroxyisoindolin-1-ones. Interestingly, the mechanism of formation of 3-hydroxyisoindolin-1-ones is a novel pathway that involves carbon degradation followed by ring contraction.

17.
Indian J Otolaryngol Head Neck Surg ; 71(Suppl 3): 2121-2126, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31763306

RESUMO

Respiratory epithelial adenomatoid hamartoma (REAH) is a distinct non-neoplastic entity originating from anterior olfactory cleft in the nasal cavity, often going unnoticed. Clinically, REAH presents as unilateral or bilateral nasal polyps. Our aim is to expand the understanding of bilateral REAH associated with nasal polyposis with respect to clinical, radiological and histopathological features for better clinical outcomes. Our analysis includes patients presenting as bilateral nasal polyps, whose CT-PNS showed opacity in olfactory clefts. During endoscopic sinus surgery, the lesions in the olfactory cleft (medial-to-middle turbinate) were identified and the specimens from olfactory cleft and ethmoid sinus cavity were subjected separately to histopathological analysis. Six patients (average age 50 years, 83% male) of bilateral REAH with nasal obstruction of > 3 years were analysed. On nasal endoscopy, the polypoid masses in the olfactory cleft and in the ethmoids did not show any gross differences. However, polypoidal masses from the olfactory cleft bled more during biopsy and excision. Histopathological study of these masses revealed the closely arranged round to oval glands (with few dilated glands) lined by ciliated columnar epithelium in mildly edematous stroma, confirming the presence of REAH. REAH is an often overlooked lesion in the nasal cavity, arising from olfactory cleft. The presence of nasal polyposis obscures this lesion, resulting in under diagnosis. The prompt identification with high index of suspicion by the otorhinolaryngologists helps in accurate histopathological diagnosis thereby improving clinical outcomes.

18.
Fish Shellfish Immunol ; 94: 746-751, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31546040

RESUMO

The present study evaluated the biofilm (BF) of Vibrio anguillarum for oral vaccination of Asian seabass, Lates calcarifer. An 80-day experiment was carried out in circular fiber-reinforced plastic (FRP) tanks using free cell (FC) and BF of Vibrio anguillarum with triplicate in each. Heat-inactivated FC and BF cells at 107, 1010 and 1013 CFU/g fish/d were fed to fish for 20 days, agglutination antibody titer estimated at each 10 days interval up to 60-day post vaccination. As compared to FC and control there was a significant increase in agglutinating antibody titer in the biofilm vaccinated fishes. Among the 3 doses, BF at 1010 cfu/g fish/d was considered the ideal dose for vaccination. Relative percentage survival (RPS) was higher in biofilm vaccinated fish (85.4%) compared to that with free cells (27.0%). The study demonstrated the better performance of V. anguillarum biofilm oral vaccine compared that with free cell vaccine in L. calcarifer. The study further supports better performance of biofilm vaccine model with one more bacterial pathogen in a high carnivore fish.


Assuntos
Vacinas Bacterianas/farmacologia , Bass , Biofilmes , Doenças dos Peixes/prevenção & controle , Vacinação/veterinária , Vibrioses/veterinária , Vibrio/fisiologia , Administração Oral , Animais , Vacinas Bacterianas/administração & dosagem , Temperatura Alta , Vacinas de Produtos Inativados/administração & dosagem , Vacinas de Produtos Inativados/farmacologia , Vibrio/imunologia , Vibrioses/prevenção & controle
19.
Mol Med Rep ; 20(5): 4688-4694, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31545477

RESUMO

Limbal stem cell deficiency (LSCD) is one of the leading causes of corneal damage. Injury or inflammation in the cornea causes LSCD, which may be unilateral or bilateral depending upon the cause. Limbal epithelial cell implants successfully improve vision in patients with chemical injury­induced LSCD. Transplantation of cultured epithelial stem cells has become a treatment of choice for numerous patients with LSCD. Bilateral LSCD is frequently observed in the general population, where no residual stem cells are available for ex vivo culture. Allografts are associated with a high risk of rejection, neoplasia, and disease transmission. In this respect, allogenic cell populations from other regions in the patient may substitute for allogenic material. In the present study, dental pulp stem cells were cultured in limbal stem cell media and these cells were characterized against limbal stem cells, revealing the significance of using dental pulp stem cell treatment in bilateral LSCD. The morphology and culture pattern of both limbal and dental pulp stem cells grown in limbal stem­specific media were similar. Polymerase chain reaction analysis revealed that stem cell markers were highly expressed in limbal stem cells compared to in dental pulp stem cells, regardless of the medium and scaffold in which they were grown. Although dental pulp stem cell molecular expression is quite low at the transcript level, the functional protein level according to immunocytochemistry and western blot analyses demonstrated that stem cells and corneal differentiation molecule levels were quite high, indicating their potential as limbal stem cells in the respective microenvironment.


Assuntos
Doenças da Córnea/patologia , Lesões da Córnea/patologia , Polpa Dentária/citologia , Transplante de Células-Tronco , Células-Tronco/citologia , Células-Tronco/metabolismo , Biomarcadores , Células Cultivadas , Doenças da Córnea/metabolismo , Doenças da Córnea/terapia , Lesões da Córnea/metabolismo , Lesões da Córnea/terapia , Imunofluorescência , Expressão Gênica , Humanos , Transplante de Células-Tronco/métodos
20.
Physiol Mol Biol Plants ; 24(6): 1245-1259, 2018 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-30425438

RESUMO

Pigeonpea productivity is greatly constrained by poor plant ideotype of existing Indian cultivars. Enhancing pigeonpea yield demands a renewed focus on restructuring the ideal plant type by using more efficient approaches like genomic tools. Therefore, the present study aims to identify and validate a set of QTLs/gene(s) presumably associated with various plant ideotype traits in pigeonpea. A total of 133 pigeonpea germplasms were evaluated along with four checks in the augmented design for various ideotype traits i.e. initiation of flowering (IF), days to 50% flowering (DFF), days to maturity (DM), plant height (PH), primary branches (PB), seeds per pod (SP) and pod length (PL). We observed significant genetic diversity in the germplasm lines for these traits. The genetic control of IF, DFF, DM and PH renders these traits suitable for detection of marker trait associations. By using residual maximum likelihood algorithm, we obtained appropriate variance-covariance structures for modeling heterogeneity, correlation of genetic effects and non-genetic residual effects. The estimates of genetic correlations indicated a strong association among earliness traits. The best linear unbiased prediction values were calculated for individual traits, and association analysis was performed in a panel of 95 diverse genotypes with 19 genic SSRs. Out of five QTL-flanking SSRs used here for validation, only ASSR295 could show significant association with FDR and Bonferroni corrections, and accounted for 15.4% IF, 14.2% DFF and 16.2% DM of phenotypic variance (PV). Remaining SSR markers (ASSR1486, ASSR206 and ASSR408) could not qualify false discovery rate (FDR) and Bonferroni criteria, hence declared as false positives. Additionally, we identified two highly significant SSR markers, ASSR8 and ASSR390 on LG 1 and LG 2, respectively. The SSR marker ASSR8 explained up to 22 and 11% PV for earliness traits and PB respectively, whereas ASSR390 controlled up to 17% PV for earliness traits. The validation and identification of new QTLs in pigeonpea across diverse genetic backgrounds brightens the prospects for marker-assisted selection to improve yield gains in pigeonpea.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...