Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 29
Filtrar
Filtros adicionais











País/Região como assunto
Intervalo de ano
1.
Anim Biotechnol ; : 1-8, 2019 Jun 28.
Artigo em Inglês | MEDLINE | ID: mdl-31253059

RESUMO

Pleomorphic adenoma gene 1 (PLAG1) encodes a developmentally regulated zinc finger protein, locating in growth-related QTNs. The mRNA expression of this gene was investigated in different tissues and from two different developmental periods, whilst to explore the functions of PLAG1 in growth traits of cattle. The results showed that PLAG1 was expressed in all examined tissues. However, PLAG1 expression levels in all examined tissues were significantly different between the 5-month fetus and 36-month adult cattle. Our juvenile results indicated PLAG1 is primarily expressed in embryonic tissues of Chinese cattle. Furthermore, two variations were identified. Association analysis revealed that the two variations were associated with growth traits (p < 0.05 or p < 0.01). These new findings provide a comprehensive overview of the critical roles of PLAG1 in growth traits modulation and can be highlighted as candidate molecular markers in cattle breeding.

2.
Immunobiology ; 223(11): 599-607, 2018 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-30025710

RESUMO

Based on the goat genome database, we have annotated the genomic organization of the goat immunoglobulin heavy chain variable region. The goat IgH locus is present on seven genome scaffolds, and contains ten VH, three DH and six JH segments. After the exclusion of three shorter segments, the VH genes were divided into two gene families based on sequence similarity. By analyzing the IgH cDNA sequences, we further identified that VH2 (54.2%), DH1 (61.7%) and JH1 (60.5%) segments were most frequently utilized in the expression of the immunoglobulin variable region, and that point mutations introduced by somatic hypermutation were the major mutation present in these expressed variable region. Compared with human and horses, DH-DH fusion occurred at a higher frequency in goat V(D)J recombination. These results provided variable insights into goat immunoglobulin heavy chain variable region genome loci and repertoire diversity.

3.
Prion ; 12(3-4): 185-196, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29695200

RESUMO

Studies of the ovine prion-related protein (testis-specific) gene (PRNT), including studies of genetic diversity, have highlighted its potential relationship to scrapie infection and economically important ovine traits. PRNT was previously reported to be highly polymorphic in Portuguese sheep. To characterize genetic polymorphisms in this gene in Asian sheep, a direct sequencing method was used to detect polymorphic loci in PRNT in 285 individual sheep from four Chinese and one Mongolian breeds. Seven SNP variants in PRNT were identified, including three novel variants (g.93G>A, g.162G>T, and g.190A>G) and four previously reported variants (g.17 C>T, g.112G>C, g.129C>T, and g.144A>G). In the five breeds that we analyzed, the mutation frequencies of g.190A>G in Lanzhou Fat-tail sheep (LFTS) and g.129C>T in the other four varieties were high (F>0.5). Moreover, thirteen different haplotypes that had a comparable distribution in the tested breeds were also identified; 'C-G-G-C-A-G-A' occurred at the highest frequency in the five sheep breeds. Additionally, we previously explored the significance of relationships between polymorphisms in PRNP or PRND and ovine growth performance. Here, we also performed correlation analysis in all tested loci. These loci polymorphisms were significantly associated with ten different growth traits (P<0.05), except for g.93G>A. Meanwhile, in contrast to a previous study, there was no significant association between the seven SNP loci analyzed and our previously reported sheep PRND or PRNP insertion/deletion mutations. Our findings may provide new insights into polymorphic variation in ovine PRNT, which may contribute to genetic improvements in economic traits that are important for sheep breeding.

4.
Prion ; 12(1): 42-53, 2018 01 02.
Artigo em Inglês | MEDLINE | ID: mdl-29394137

RESUMO

Prion protein (PRNP) gene is well known for affecting mammal transmissible spongiform encephalopathies (TSE), and is also reported to regulate phenotypic traits (e.g. growth traits) in healthy ruminants. To identify the insertion/deletion (indel) variations of the PRNP gene and evaluate their effects on growth traits, 768 healthy individuals from five sheep breeds located in China and Mongolia were identified and analyzed. Herein, four novel indel polymorphisms, namely, Intron-1-insertion-7bp (I1-7bp), Intron-2-insertion-15bp (I2-15bp), Intron-2-insertion-19bp (I2-19bp), and 3' UTR-insertion-7bp (3' UTR-7bp), were found in the sheep PRNP gene. In five analyzed breeds, the minor allelic frequencies (MAF) of the above indels were in the range of 0.008 to 0.986 (I1-7bp), 0.113 to 0.336 (I2-15bp), 0.281 to 0.510 (I2-19bp), and 0.040 to 0.238 (3' UTR-7bp). Additionally, there were 15 haplotypes and the haplotype 'II2-15bp-D3'UTR-7bp-DI2-19bp-DI1-7bp' had the highest frequency, which varied from 0.464 to 0.629 in five breeds. Moreover, association analysis revealed that all novel indel polymorphisms were significantly associated with 13 different growth traits (P < 0.05). Particularly, the influences of I2-15bp on chest width (P = 0.001) in Small Tail Han sheep (ewe), 3' UTR-7bp on chest circumference (P = 0.003) in Hu sheep, and I2-19bp on tail length (P = 0.001) in Tong sheep, were highly significant (P < 0.01). These findings may be a further step toward the detection of indel-based typing within and across sheep breeds, and of promising target loci for accelerating the progress of marker-assisted selection in sheep breeding.

5.
Mol Reprod Dev ; 85(3): 227-235, 2018 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-29388718

RESUMO

Neonatal respiratory distress is a major mortality factor in cloned animals, but the pathogenesis of this disease is rarely investigated. In this study, four neonatal cloned cattle, born after full-term gestation, exhibited symptoms of neonatal respiratory distress syndrome (NRDS), which included symptoms of hyaline membrane disease as well as disordered surfactant homeostasis in their collapsed lungs. No differences in DNA methylation or histone modifications correlated with the suppressed SPB and SPC transcription observed in the cloned cattle group (p > 0.05), whereas TTF-1 occupancy at SPB and SPC promoter regions in cloned cattle was significantly reduced to 24% and 20% that of normal lungs, respectively (SPB, p < 0.05; SPC, p < 0.01). Decreased TTF1 expression, dysregulation of SPB and SPC transcription by TTF-1, and disordered proteolytic processing of Surfactant protein B precursor together potentially contribute to the disruption of surfactant homeostasis and NRDS in bovine clones. Elucidation of the associated mechanisms should facilitate the development of novel preventive or therapeutic strategies to reduce the mortality rate of cloned animals and to improve the efficiency of SCNT technology.

6.
Anim Biotechnol ; 29(4): 276-282, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29200321

RESUMO

In China, Tong sheep (TS) and Lanzhou fat-tailed sheep (LFTS) are two closely relative endanger breeds for low meat production and low fecundity, finding some marker-assisted selected (MAS) is our first priority for improving their growth traits. For this purpose, Hu sheep (HS) and small-tailed Han sheep (STHS) were compared with two endangered breeds (TS and LFTS). Paired-liked homeodomain transcription factor 2 (PITX2) gene was the important member of PITX family, which could adjust animal growth through hypothalamic-pituitary-adrenal axis. During the past years, insertion/deletion (indel) has become increasingly popular in application as MAS. In this study, two novel indel loci were identified, and five significant differences, including chest width, hip width, chest depth, chest circumference, and body height, were found between different breeds. Interestingly, there was no DD genotype and smaller number of ID genotye. All the ID genotypes were significantly greater than II genotype, which was to say the allele of "D" was dominant variation and its frequency was lower, which demonstrated that it has huge space for selection. Briefly, the two indel were potential and useful DNA markers for selecting excellent individuals in relation to growth traits in sheep.

7.
Mol Reprod Dev ; 84(8): 668-674, 2017 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-28513901

RESUMO

Respiratory distress is a major cause of mortality in cloned neonatal animals, but its pathogenesis remains poorly understood. Here, we used necropsy and histology procedures to evaluate the lungs of cloned neonatal bovines dying of respiratory distress, finding incomplete lung dilation, alveolar collapse, and thickened alveolar walls. Comparison of the transcriptomes between collapsed lungs of cloned bovines and their normal counterparts revealed 1373 differentially expressed genes in collapsed lungs (p < 0.05, fold change >1.5 or <1.5-1 ), many of which were associated with surfactant biosynthesis, secretion, transport, recycling, and degradation. ERK/MAPK and Notch signaling pathways were among the canonical pathways relevant to surfactant homeostasis. Expression of the genes encoding Surfactant protein B (SPB) and Surfactant protein C (SPC)-which control surfactant lipid packing, spreading, and stability-were significantly lower in collapsed lungs of cloned neonates at the transcript (p < 0.01) and protein levels (p < 0.05) relative to that in normal lungs. Thus, our results provide an initial view into the changes in gene expression in cloned newborns with lung collapse and respiratory distress, and present a valuable resource for developing novel preventive or therapeutic strategies to reduce the mortality rate of cloned animals and to improve the efficiency of somatic cell nuclear transfer technology.


Assuntos
Perfilação da Expressão Gênica/métodos , Atelectasia Pulmonar/metabolismo , Síndrome do Desconforto Respiratório do Recém-Nascido/metabolismo , Transcriptoma/genética , Animais , Animais Recém-Nascidos , Bovinos , Clonagem de Organismos , Feminino , Homeostase/genética , Imuno-Histoquímica , Pulmão/química , Pulmão/metabolismo , Análise de Sequência com Séries de Oligonucleotídeos , Proteínas/análise , Proteínas/genética , Proteínas/metabolismo , Surfactantes Pulmonares/análise , Surfactantes Pulmonares/metabolismo , Reação em Cadeia da Polimerase em Tempo Real
8.
Prion ; 11(2): 143-150, 2017 03 04.
Artigo em Inglês | MEDLINE | ID: mdl-28362554

RESUMO

Prion-related protein doppel gene (PRND), as an essential member of the mammalian prion gene family, is associated with the scrapie susceptibility as well as phenotype traits, so the genetic variation of the PRND has been highly concerned recently, including the single nucleiotide polymorphism (SNP) and insertion/deletion (indel). Therefore, the objective of present study was to examine the possible indel variants by mathematical expectation (ME) detection method as well as explore its associations with phenotype traits. A novel 20-bp indel was verified in 623 tested individuals representing 4 diversity sheep breeds. The results showed that 3 genotypes were detected and the minor allelic frequency were 0.008 (Lanzhou Fat-Tail sheep, LFTS), 0.084 (Small Tail Han sheep, STHS), 0.021(Tong sheep, TS) and 0.083 (Hu sheep, HS), respectively. Comparing with the traditional method of detecting samples one by one, the reaction times with ME method was decreased by 36.22% (STHS), 37.00% (HS), 68.67% (TS) and 83.33% (LFTS), respectively. Besides, this locus was significantly associated to cannon circumference index (P = 0.012) and trunk index (P = 0.037) in the Hu sheep breed. Notably, it was not concordance with the present result of DNA sequencing (GCTGTCCCTGCAGGGCTTCT) and dbSNPase of NCBI (NC_443194: g.46184887- 46184906delCTGCTGTCCCTGCAGGGCTT). Consequently, it was the first time to detect the new 20-bp indel of sheep PRND gene by ME strategy, which might provide a valuable theoretical basis for marker-assisted selection in sheep genetics and breeding.


Assuntos
Mutação INDEL , Príons/genética , Ovinos/genética , Animais , Sequência de Bases , Cruzamento , Frequência do Gene , Técnicas de Genotipagem/métodos , Ovinos/crescimento & desenvolvimento
9.
Mol Biol Evol ; 2017 Dec 19.
Artigo em Inglês | MEDLINE | ID: mdl-29294071

RESUMO

The bovine genetic resources in China are diverse, but their value and potential are yet to be discovered. To determine the genetic diversity and population structure of Chinese cattle, we analysed the whole genomes of 46 cattle from six phenotypically and geographically representative Chinese cattle breeds, together with 18 Red Angus cattle (RAN) genomes, 11 Japanese black cattle (JBC) genomes and taurine and indicine genomes available from previous studies. Our results showed that Chinese cattle originated from hybridization between Bos taurus and Bos indicus. Moreover, we found that the level of genetic variation in Chinese cattle depends upon the degree of indicine content. We also discovered many potential selective sweep regions associated with domestication related to breed-specific characteristics, with selective sweep regions including genes associated with coat colour (ERCC2, MC1R, ZBTB17 and MAP2K1), dairy traits (NCAPG, MAPK7, FST, ITFG1, SETMAR, PAG1, CSN3 and RPL37A), and meat production/quality traits (such as BBS2, R3HDM1, IGFBP2, IGFBP5, MYH9, MYH4 and MC5R). These findings substantially expand the catalogue of genetic variants in cattle and reveal new insights into the evolutionary history and domestication traits of Chinese cattle.

10.
Dev Comp Immunol ; 65: 340-351, 2016 12.
Artigo em Inglês | MEDLINE | ID: mdl-27497872

RESUMO

The ileal Peyers patches (IPP) of newborn germfree (GF) piglets were isolated into blind loops and the piglets colonized with a defined probiotic microflora. After 5 weeks, IgA levels in the intestinal lavage (IL) of loop piglets remained at GF levels and IgM comprised ∼70% while in controls, IgA levels were elevated 5-fold and comprised ∼70% of total Igs. Loop piglets also had reduced serum IgA levels suggesting the source of serum IgA had been interrupted. The isotype profile for loop contents was intermediate between that in the IL of GF and probiotic controls. Surprisingly, colonization alone did not result in repertoire diversification in the IPP. Rather, colonization promoted pronounced proliferation of fully switched IgA(+)IgM(-) B cells in the IPP that supply early, non-diversified "natural" SIgA antibodies to the gut lumen and a primary IgA response in serum.


Assuntos
Linfócitos B/fisiologia , Íleo/imunologia , Imunoglobulina A Secretora/genética , Nódulos Linfáticos Agregados/imunologia , Suínos/imunologia , Animais , Animais Recém-Nascidos , Diversidade de Anticorpos , Diferenciação Celular , Proliferação de Células , Células Cultivadas , Microbioma Gastrointestinal/imunologia , Vida Livre de Germes , Switching de Imunoglobulina , Imunoglobulina M/genética , Memória Imunológica , Ativação Linfocitária , Probióticos/administração & dosagem
11.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 33(4): 564-8, 2016 Aug.
Artigo em Chinês | MEDLINE | ID: mdl-27455022

RESUMO

Pulmonary surfactant (PS) is synthesized and secreted by alveolar epithelial type II (AEII) cells, which is a complex compound formed by proteins and lipids. Surfactant participates in a range of physiological processes such as reducing the surface tension, keeping the balance of alveolar fluid, maintaining normal alveolar morphology and conducting host defense. Genetic disorders of the surfactant homeostasis genes may result in lack of surfactant or cytotoxicity, and lead to multiple lung diseases in neonates, children and adults, including neonatal respiratory distress syndrome, interstitial pneumonia, pulmonary alveolar proteinosis, and pulmonary fibrosis. This paper has provided a review for the functions and processes of pulmonary surfactant metabolism, as well as the connection between disorders of surfactant homeostasis genes and lung diseases.


Assuntos
Homeostase , Pneumopatias/genética , Surfactantes Pulmonares/metabolismo , Transportadores de Cassetes de Ligação de ATP/genética , Proteínas de Ligação a DNA/genética , Humanos , Proteína C Associada a Surfactante Pulmonar/genética , Fatores de Transcrição
12.
Anim Reprod Sci ; 147(3-4): 112-8, 2014 Jun 30.
Artigo em Inglês | MEDLINE | ID: mdl-24814905

RESUMO

Although alginate was reported to play an important role as free radical scavengers in vitro and could be used as sources of natural antioxidants, there was no study about the cryoprotective effects of alginate on boar spermatozoa freezing. The objective of this research was to evaluate the effects of different concentrations of alginate added to the freezing extenders on boar spermatozoa motility, plasma membrane integrity, acrosomal integrity, mitochondrial activities, lipid peroxidation and antioxidative enzymes activities (SOD and GSH-Px) after thawing. Alginate was added to the TCG extender to yield six different final concentrations: 0, 0.2, 0.4, 0.6, 0.8, and 1.0mg/mL. The semen extender supplemented with various doses of alginate increased (P<0.05) total motility. The spermatozoa plasma membrane integrity and mitochondrial activity were improved at four different concentrations: 0.4, 0.6, 0.8, 1.0mg/mL. The addition of alginate also provided significantly positive effect on post-thaw boar spermatozoa acrosomal integrity at concentrations of 0.6, 0.8, 1.0mg/mL, compared with that of the control (P<0.05). The freezing extenders with the presence of alginate led to higher SOD and GSH-Px activities and lower MDA levels, in comparison to the control (P<0.05). In summary, alginate exhibited a dose-related response on frozen-thawed boar spermatozoa motility, functional integrity and antioxidative capacity at appropriate concentrations. Therefore alginate could be employed as an effective cryoprotectant in boar spermatozoa cryopreservation.


Assuntos
Alginatos/farmacologia , Antioxidantes/metabolismo , Peroxidação de Lipídeos/efeitos dos fármacos , Espermatozoides/efeitos dos fármacos , Suínos , Animais , Criopreservação , Crioprotetores/farmacologia , Congelamento , Ácido Glucurônico/farmacologia , Glutationa Peroxidase/metabolismo , Ácidos Hexurônicos/farmacologia , Masculino , Análise do Sêmen , Preservação do Sêmen/veterinária , Espermatozoides/enzimologia , Espermatozoides/metabolismo , Superóxido Dismutase/metabolismo
13.
J Dairy Sci ; 96(11): 6965-72, 2013.
Artigo em Inglês | MEDLINE | ID: mdl-23992977

RESUMO

Rhodiola sachalinensis saccharide (RSS) was extracted from the rhizome of Herba Rhodiolae and was expected as a novel cryoprotectant. The aim of this study was to test the effects of RSS on motility of bull sperm and the activities of superoxide dismutase (SOD), lactate dehydrogenase (LDH), and glutamic oxaloacetic transaminase (GOT) in bull sperm during cryopreservation. Rhodiola sachalinensis saccharide was added at the concentrations of 0.02, 0.04, 0.06, 0.08, and 0.10 mg/mL to the extenders, which were used to store bovine semen. It was found that the RSS-added extends resulted in a higher percentage of cryopreserved sperm motility, mitochondrial activity, and membrane and acrosome integrity than those of RSS-free extenders. The SOD, LDH, and GOT activities were all decreased during the process of freezing and thawing. The extenders supplemented with RSS improved the SOD, LDH, and GOT activities after cryopreservation compared with the RSS-free groups. In conclusion, RSS conferred great cryoprotective capacity to the basic extender for bull spermatozoa during the process of freezing-thawing, and the optimal concentration of RSS for the extender was 0.06 mg/mL.


Assuntos
Bovinos/fisiologia , Crioprotetores/farmacologia , Polissacarídeos/farmacologia , Rhodiola/química , Preservação do Sêmen/veterinária , Espermatozoides/fisiologia , Acrossomo/efeitos dos fármacos , Animais , Aspartato Aminotransferases/metabolismo , Criopreservação/métodos , Criopreservação/veterinária , Congelamento , L-Lactato Desidrogenase/metabolismo , Masculino , Mitocôndrias/metabolismo , Preservação do Sêmen/métodos , Motilidade Espermática/efeitos dos fármacos , Espermatozoides/efeitos dos fármacos , Superóxido Dismutase/metabolismo
14.
Anim Reprod Sci ; 139(1-4): 95-100, 2013 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-23639581

RESUMO

The aim of the present study was to evaluate the cryoprotective effect of Laminaria japonic polysaccharide (LJP) on boar sperm. Semen samples were collected from seven mature Yorkshire boars once a week by the gloved hand technique and frozen-thawed in the extender with LJP added. Extender with LJP added at concentrations of 0.25, 0.5, 1.0, 1.5 and 2.0mg/mL to the extender and its effects on the quality of frozen-thawed boar sperm were assessed. Results showed: (i) sperm motility and plasma membrane integrity were greater in the extender containing 0.5 and 1.0mg/mL LJP, as compared to other groups (P<0.05); (ii) extender added 1.0mg/mL LJP showed the greatest plasma membrane and acrosomal integrity percentages in comparison with other groups (P<0.05); (iii) mitochondrial activity was significantly higher at the concentration of 0.5 and 1.0mg/mL LJP than those of other groups (P<0.05); (iv) in terms of biochemical assessments, 0.5 and 1.0mg/mL LJP improved SOD (superoxide dismutase) and CAT (catalase) concentrations, compared to other groups (P<0.05). However, no significant difference was found in GSH-Px (glutathione peroxidase) concentration when supplemented with LJP. Interestingly, LJP exhibited a dose-related response and the lesser concentration represented greater protective effects. It is also important to note that 1.0mg/mL LJP provides for an enhanced cryoprotective effect in boar semen.


Assuntos
Criopreservação/veterinária , Polissacarídeos/farmacologia , Preservação do Sêmen/veterinária , Espermatozoides/efeitos dos fármacos , Espermatozoides/fisiologia , Suínos/fisiologia , Animais , Catalase/metabolismo , Criopreservação/métodos , Glutationa Peroxidase/metabolismo , Laminaria/química , Masculino , Análise do Sêmen/veterinária , Preservação do Sêmen/métodos , Espermatozoides/enzimologia , Superóxido Dismutase/metabolismo
15.
Mol Immunol ; 55(3-4): 329-36, 2013 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-23618164

RESUMO

Kappa transcripts from fetal piglets were compared to the recently reported kappa genome. Although five IGKV gene families are present in the genome, only IGKV1 and IGKV2 family genes are transcribed; the latter comprises >95% of the repertoire, in which two genes account for ~80%. We provisionally identified a new sequence allele of IGKV2-10 and two new IGKV genes that were not present in the genome of a single Duroc sow. One of these (IGKV2-1) accounted for 39% of the total pre-immune repertoire. The discovery of new IGKV genes and alleles in only 90 transcripts from mixed breeds, suggests considerable polymorphism and polygeny in the kappa locus of swine. Similar to lambda rearrangements, CDR3 length and diversity is restricted. The somatic mutation frequency is low and accumulates in especially CDR1. This transcriptional analysis of the pre-immune kappa repertoire completes a comparative study of all three Ig loci which has allowed the potential and actual combinatorial repertoire to be determined. Calculations show that combinatorial diversity in all three loci contribute comparatively little to the swine pre-immune antibody repertoire. Compared to humans that can potentially generate a million binding site variants, only 16-48 variant comprise 70% of the swine repertoire and 224 account for 95-100%. The frequency of somatic mutation does not differ among rearrangements from all three loci and the CDR3 diversity index shows that swine overwhelmingly generate their pre-immune repertoire by junctional diversity in heavy chain rearrangements.


Assuntos
Diversidade de Anticorpos/genética , Genes de Cadeia Pesada de Imunoglobulina , Genes de Cadeia Leve de Imunoglobulina , Cadeias kappa de Imunoglobulina/genética , Sus scrofa , Sequência de Aminoácidos , Animais , Animais Recém-Nascidos , Feminino , Feto/imunologia , Rearranjo Gênico de Cadeia Leve de Linfócito B , Humanos , Região Variável de Imunoglobulina/biossíntese , Região Variável de Imunoglobulina/genética , Cadeias kappa de Imunoglobulina/biossíntese , Dados de Sequência Molecular , Gravidez
16.
Immunology ; 138(2): 134-44, 2013 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-23320646

RESUMO

Infection of germ-free isolator piglets with swine influenza (S-FLU) that generates dsRNA during replication causes elevation of immunoglobulins in serum and bronchoalveolar lavage, a very weak response to trinitrophenyl conjugates but an immune response to S-FLU. The increased immunoglobulin levels result mainly from the polyclonal activation of B cells during the infection, but model antigen exposure may contribute. The 10-fold increase in local and serum IgG accompanies a 10-fold decrease in the transcription of IgG3 in the tracheal-bronchial lymph nodes and in the ileal Peyer's patches. Infection results in class switch recombination to downstream Cγ genes, which diversify their repertoire; both features are diagnostic of adaptive immunity. Meanwhile the repertoires of IgM and IgG3 remain undiversified suggesting that they encode innate, natural antibodies. Whereas IgG3 may play an initial protective role, antibodies encoded by downstream Cγ genes with diversified repertoires are predicted to be most important in long-term protection against S-FLU.


Assuntos
Imunidade Adaptativa , Anticorpos Antivirais/imunologia , Imunoglobulina G/imunologia , Vírus da Influenza A Subtipo H1N1/imunologia , Infecções por Orthomyxoviridae/imunologia , Doenças dos Suínos/imunologia , Animais , Animais Recém-Nascidos , Anticorpos Antivirais/sangue , Anticorpos Antivirais/genética , Linhagem Celular , Cães , Feto , Switching de Imunoglobulina/genética , Switching de Imunoglobulina/imunologia , Imunoglobulina G/sangue , Imunoglobulina G/genética , Imunoglobulina M/genética , Imunoglobulina M/imunologia , Infecções por Orthomyxoviridae/sangue , Infecções por Orthomyxoviridae/genética , Nódulos Linfáticos Agregados/imunologia , Hipermutação Somática de Imunoglobulina/genética , Hipermutação Somática de Imunoglobulina/imunologia , Suínos , Doenças dos Suínos/sangue , Doenças dos Suínos/genética
17.
Vaccine ; 31(1): 141-8, 2012 Dec 17.
Artigo em Inglês | MEDLINE | ID: mdl-23142304

RESUMO

Porcine circovirus type 2 (PCV2) is an important pathogen in the porcine respiratory disease complex (PRDC) and its persistence may be due to dysregulation of systemic immunity. We examined this contention using isolator piglets. We present data on Ig levels in serum and bronchio-alveolar lavage (BAL), on antibody response to PCV2 and to TNP conjugates used as model antigens in 48 PCV2-infected isolator piglets. We compared these to data from TNP-immunized isolator piglets colonized with a probiotic flora, those infected with swine influenza (S-FLU) and those infected with porcine respiratory and reproductive syndrome virus (PRRSV). We found that PCV2 infection does not cause generalized hypergammaglobulinemia that characterizes PRRSV infections, but causes an unexplained increase in serum IgA. All animals had serum IgG to the ORF2 gene product of PCR2, but neither IgA nor IgG anti-ORF2 responses in BAL. PCV2 infection is a poor adjuvant since only natural anti-TNP antibodies were found. Unexpectedly, immunization appeared to result in lower Ig levels and lower anti-ORF2 responses. There was extreme variation in serum Ig levels in response to infection that could in part be traced to genetic and gender differences. These data suggest that non-replicating vaccines are unlikely to result in a significant primary antibody response but may prime the system for a secondary antibody and cytotoxic response following actual infection. In any case, developers may have to contend with significant genetic differences in the response of piglets to PCV2.


Assuntos
Anticorpos/imunologia , Circovirus/patogenicidade , Proteínas Virais/imunologia , Animais , Animais Recém-Nascidos , Anticorpos/sangue , Infecções por Circoviridae/imunologia , Circovirus/imunologia , Feminino , Imunoglobulina A/sangue , Imunoglobulina G/sangue , Masculino , Gravidez , Suínos
18.
Immunology ; 137(2): 149-59, 2012 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-22724577

RESUMO

VDJ and VJ rearrangements, expression of RAG-1, Tdt and VpreB, and the presence of signal joint circles (SJC) were used to identify sites of B-cell lymphogenesis. VDJ, VλJλ but not VκJκ rearrangements or SJC were recovered from yolk sac (YS) at 20 days of gestation (DG) along with strong expression of VpreB and RAG-1 but weak Tdt expression. VλJλ rearrangements but not VκJκ rearrangements were recovered from fetal liver at 30-50 DG. SJC were pronounced in bone marrow at 95 DG where VκJκ rearrangements were first recovered. The VλJλ rearrangements recovered at 20-50 DG used some of the same Vλ and Jλ segments seen in older fetuses and adult animals. Hence the textbook paradigm for the order of light-chain rearrangement does not apply to swine. Consistent with weak Tdt expression in early sites of lymphogenesis, N-region additions in VDJ rearrangements were more frequent at 95 DG. Junctional diversity in VλJλ rearrangement was limited at all stages of development. There was little evidence for B-cell lymphogenesis in the ileal Peyer's patches. The widespread recovery of VpreB transcripts in whole, non-lymphoid tissue was unexpected as was its recovery from bone marrow and peripheral blood monocytes. Based on recovery of SJC, B-cell lymphogenesis continues for at least 5 weeks postpartum.


Assuntos
Linfócitos B/imunologia , Rearranjo Gênico de Cadeia Pesada de Linfócito B , Linfopoese , Sequência de Aminoácidos , Animais , Animais Recém-Nascidos , Formação de Anticorpos , Especificidade de Anticorpos , Linfócitos B/citologia , Feminino , Feto , Regulação da Expressão Gênica no Desenvolvimento , Dados de Sequência Molecular , Especificidade de Órgãos , Alinhamento de Sequência , Suínos , Transcrição Genética
19.
Mol Cell Biol ; 32(6): 1124-38, 2012 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-22252323

RESUMO

VPS4B, an AAA ATPase (ATPase associated with various cellular activities), participates in vesicular trafficking and autophagosome maturation in mammalian cells. In solid tumors, hypoxia is a common feature and an indicator of poor treatment outcome. Our studies demonstrate that exogenous or endogenous (assessed with anchorage-independent three-dimensional multicellular spheroid culture) hypoxia induces VPS4B downregulation by the ubiquitin-proteasome system. Inhibition of VPS4B function by short hairpin VPS4B (sh-VPS4B) or expression of dominant negative VPS4B(E235Q) promotes anchorage-independent breast cancer cell growth and resistance to gefitinib, U0126, and genotoxicity. Biochemically, hyperactivation of epidermal growth factor receptor (EGFR), a receptor tyrosine kinase essential for cell proliferation and survival, accompanied by increased EGFR accumulation and altered intracellular compartmentalization, is observed in cells with compromised VPS4B. Furthermore, enhanced FOS/JUN induction and AP-1 promoter activation are noted in EGF-treated cells with VPS4B knockdown. However, VPS4B depletion does not affect EGFRvIII stability or its associated signaling. An inverse correlation between VPS4B expression and EGFR abundance is observed in breast tumors, and high-grade or recurrent breast carcinomas exhibit lower VPS4B expression. Together, our findings highlight a potentially critical role of VPS4B downregulation or chronic-hypoxia-induced VPS4B degradation in promoting tumor progression, unveiling a nongenomic mechanism for EGFR overproduction in human breast cancer.


Assuntos
Adenosina Trifosfatases/metabolismo , Complexos Endossomais de Distribuição Requeridos para Transporte/metabolismo , Receptores ErbB/metabolismo , Transdução de Sinais , ATPases Associadas a Diversas Atividades Celulares , Adenosina Trifosfatases/genética , Animais , Neoplasias da Mama/genética , Neoplasias da Mama/metabolismo , Hipóxia Celular , Linhagem Celular , Linhagem Celular Tumoral , Regulação para Baixo , Complexos Endossomais de Distribuição Requeridos para Transporte/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Fosforilação , RNA Mensageiro/genética , Ratos , Esferoides Celulares
20.
J Immunol ; 187(10): 5141-9, 2011 Nov 15.
Artigo em Inglês | MEDLINE | ID: mdl-22013126

RESUMO

The continuous ileal Peyer's patches (IPP) of sheep are regarded as a type of mammalian bursal equivalent where B cells diversify their repertoire in an Ag-independent fashion. Anatomically and developmentally similar IPP occur in swine. Resection of ∼90% of the IPP in piglets at birth did not alter Ig levels in serum and secretions or retard diversification of the Ab repertoire when animals were maintained in isolators and colonized with a defined gut flora. Resection or sham surgery elevated IgG and IgA in serum and in lavage fluid from the gut, lung, and in saliva. No changes in the frequency of IgG-, IgA-, and IgM-containing cells in the spleen and peripheral lymph node were observed. Using an index that quantifies diversification of the VDJ repertoire, no differences were seen in three secondary lymphoid tissues between piglets lacking IPP and colonized controls, whereas both groups displayed >10-fold greater diversification than did late-term fetal piglets or piglets maintained germ-free. Somatic hypermutation was very low in fetal IPP and the IPP of germ-free piglets but increased 3- to 5-fold after colonization. D-J signal joint circles were not recovered in IPP, and V-DJ signal joint circles were 5-fold lower than in bone marrow and similar to those in thymus and spleen. We conclude that the porcine IPP are not a site of B cell lymphogenesis, do not undergo Ag-independent repertoire diversification, and are not primary lymphoid tissue since they are not required for maintenance of Ig levels in serum and secretions.


Assuntos
Subpopulações de Linfócitos B/citologia , Subpopulações de Linfócitos B/imunologia , Feto/imunologia , Íleo/imunologia , Isoanticorpos/biossíntese , Isoantígenos/imunologia , Linfopoese/imunologia , Nódulos Linfáticos Agregados/imunologia , Animais , Animais Recém-Nascidos , Subpopulações de Linfócitos B/microbiologia , Infecções Bacterianas/diagnóstico , Infecções Bacterianas/imunologia , Infecções Bacterianas/patologia , Linhagem da Célula/imunologia , Feminino , Feto/citologia , Feto/cirurgia , Rearranjo Gênico do Linfócito B/imunologia , Íleo/citologia , Íleo/cirurgia , Nódulos Linfáticos Agregados/citologia , Nódulos Linfáticos Agregados/cirurgia , Gravidez , Transdução de Sinais/imunologia , Suínos
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA