Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 51
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Osteoporos Int ; 31(1): 165-173, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31642976

RESUMO

This study evaluated bone features of PHPT using HR-pQCT. The results showed both cortical and trabecular bones were significantly impaired in PHPT patients. Male and female PHPT patients suffered similar damages in bone. HR-pQCT indices were not observed to differ in MEN1 and sporadic PHPT patients. INTRODUCTION: High-resolution peripheral quantitative CT is a novel imaging technique used to separately assess trabecular and cortical bone status of the radius and tibia in vivo. Using HR-pQCT, we aimed to evaluate bone features of primary hyperparathyroidism patients in a Chinese population and reveal similarities and differences in bone features in multiple endocrine neoplasia type 1-related PHPT and sporadic PHPT patients in the Chinese population. METHODS: A case-control study was designed. In 58 PHPT patients and 58 sex- and age-matched healthy controls, the distal radius and tibia were scanned using HR-pQCT. Areal bone mineral density (aBMD) was also determined in PHPT patients using dual-energy X-ray absorptiometry (DXA). RESULTS: In comparison with controls, PHPT patients were observed to exhibit reduced volumetric BMD at the cortical and trabecular compartments, thinner cortices, and more widely spaced trabeculae. Significant differences were still observed when comparing data of female and male patients with age-matched controls separately. MHPT patients (n = 11) were found to have lower aBMD Z-scores in the lumbar spine, trochanteric region, and total hip compared with sporadic PHPT patients (n = 47), while no differences were observed in HR-pQCT indices between the two groups. In multiple linear regression models, no significant correlations were identified between PTH and HR-pQCT indices. However, height was found to positively correlate with HR-pQCT-derived trabecular indices at both the radius and tibia. CONCLUSIONS: PHPT affects geometry, volumetric density, and microstructure in both the cortical and trabecular bones in both male and female Chinese patients. MHPT patients were observed to have reduced aBMD as determined by DXA in the lumbar spine and hip in comparison with sporadic PHPT patients. However, HR-pQCT indices were not observed to differ.

2.
Osteoporos Int ; 31(1): 153-164, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31646353

RESUMO

This study aimed to investigate the bone impairment in finger joints in PHO patients by HR-pQCT. Results showed distinguished differences in bone architecture and biomechanics parameters at DIPs between PHO patients and healthy controls using HR-pQCT assessment. Besides, serum PGE2, hsCRP and ESR levels were found negatively correlated with total vBMD. INTRODUCTION: This study aimed to investigate the bone impairment in finger joints in primary hypertrophic osteoarthropathy (PHO) patients firstly by high-resolution peripheral quantitative computed tomography (HR-pQCT). METHODS: Fifteen PHO patients and 15 healthy controls were enrolled in this study. Bone erosions in hands at distal interphalangeal joints (DIPs) in both PHO patients and controls were evaluated by X-ray. Bone geometry, vBMD, microstructure parameters, and size of individual bone erosion were also measured at the 3rd DIP by HR-pQCT as well. Blood biochemistry levels between the two groups were also compared. RESULTS: Compared to X-ray, HR-pQCT assessment were more sensitive for detection of bone erosions, with 14 PHO patients by HR-pQCT versus ten PHO patients by X-ray judged at the 3rd DIP. The average depth, width, and volume of erosions size in PHO patients were 1.38 ± 0.80 mm, 0.79 ± 0.27 mm, and 1.71 ± 0.52 mm3, respectively. The bone cross-areas including total area (+ 25.3%, p ≤ 0.05), trabecular area (+ 56.2%, p ≤ 0.05), and cortical perimeter (+ 10.7%, p ≤ 0.05) at the defined region of interest of 3rd DIP was significantly larger than controls. Total vBMD was 11.9% lower in PHO patients compared with the controls (p ≤ 0.05). Biochemical test results showed the increased levels of inflammatory cytokines, bone resorption markers, and joint degeneration markers in PHO patients. Serum prostaglandin PGE2, high-sensitive C-reactive protein (hsCRP) and erythrocyte sedimentation rate (ESR) levels were found negatively correlated with total vBMD. CONCLUSIONS: This study demonstrated higher sensitivity of the HR-pQCT measurement at DIPs by showing the differences in architecture and biomechanics parameters at DIPs between the PHO patients and healthy controls, which would be of interest clinically to investigate bone deterioration in PHO patients.

3.
Zhonghua Nei Ke Za Zhi ; 59(1): 23-28, 2020 Jan 01.
Artigo em Chinês | MEDLINE | ID: mdl-31887832

RESUMO

Objective: To investigate the association of GNA11 gene polymorphisms with the risk of adult-onset non-surgical hypoparathyroidism (Ns-HypoPT). Methods: Genotyping of GNA11 single nucleotide polymorphisms (SNPs) (rs28685098, rs4806907, rs11084997 and rs78003011) was carried out in 203 patients and 209 healthy participants by sequenom MassArray iPLEX System. These SNPs are located in promoter and 3'untranslated region (3'UTR) of GNA11 gene, respectively. Results: Allele and genotype frequencies of rs11084997 in patients were significantly different from those of controls (genotype GG:60.5% vs. 49.8%, GC: 35.5% vs. 41.6%, CC: 4.0% vs. 8.6%, P=0.038; G allele 78.3% vs. 70.6%, C allele 21.7% vs. 29.4%, P=0.012), and the C allele of rs11084997 carriers had a lower risk to develops Ns-HypoPT in additive and dominant genetic models [OR=0.382 (0.160-0.915), 0.647 (0.437-0.957)]. CC-Haplotype formed by the minor alleles of rs4806907 and rs11084997 was associated with a decreased risk of Ns-HypoPT in additive, dominant and recessive genetic model [OR=0.317 (0.126-0.801), 0.640 (0.430-0.952), 0.367 (0.148-0.912)]. Conclusion: The minor allele C of rs11084997 in GNA11 gene promoter was associated with decreased risk of Ns-HypoPT in Chinese population.


Assuntos
Subunidades alfa de Proteínas de Ligação ao GTP/genética , Predisposição Genética para Doença , Hipoparatireoidismo/genética , Adulto , Alelos , Grupo com Ancestrais do Continente Asiático , Estudos de Casos e Controles , China , Subunidades alfa de Proteínas de Ligação ao GTP/metabolismo , Frequência do Gene , Genótipo , Humanos , Hipoparatireoidismo/diagnóstico , Polimorfismo de Nucleotídeo Único
4.
Osteoporos Int ; 2019 Nov 21.
Artigo em Inglês | MEDLINE | ID: mdl-31754756

RESUMO

This study built a micro-simulation Markov model to determine the treatment threshold of osteoporosis in postmenopausal women in Mainland China. Treatment with zoledronate is cost-effective when FRAX-based (Fracture risk assessment tool) fracture probability is over 7%. INTRODUCTION: The purpose of this study is to estimate FRAX-based fracture probabilities in Mainland China using real-world data, at which intervention could be cost-effective. METHODS: We developed a micro-simulation Markov model to capture osteoporosis states and relevant morbidities including hip fracture, vertebral fracture, and wrist fracture. Baseline characteristics including incidences of osteoporosis and distribution of risk factors were derived from the Peking Vertebral Fracture study, the largest prospective cohort study of postmenopausal women in Mainland China. We projected incidences of fractures and deaths by age groups under two treatment scenarios: 1) no treatment, and 2) zoledronate. We also projected total quality-adjusted life-years (QALY) and total costs including fracture management and osteoporosis drugs for cost-effectiveness analysis. Cost-effective intervention thresholds were calculated based on the Chinese FRAX model. RESULTS: Treatment with zoledronate was cost-effective when the 10-year probability of major osteoporotic fracture based on FRAX was above 7%. The FRAX threshold increased by age from 51 to 65 years old, and decreased in elder age groups, ranging from 4% to 9%. CONCLUSIONS: Using real-world data, our model indicated that widespread use of zoledronate was of both clinical and economic benefit among Chinese postmenopausal women. Using a FRAX-based intervention threshold of 7% with zoledronate should permit cost-effective access to therapy to patients and contribute to reducing the disease burden of osteoporosis in Mainland China.

5.
J Endocrinol Invest ; 42(10): 1245-1252, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31004291

RESUMO

PURPOSE: Primary hypertrophic osteoarthropathy (PHO) is an inherited disease characterized by digital clubbing, periostosis and pachydermia with defects in the degradation of prostaglandin E2 (PGE2). Mutations in SLCO2A1 gene-encoding prostaglandin transporter (PGT) resulted in PHO, autosomal recessive 2 (PHOAR2). The spectrum of mutations and variable clinical complications of PHOAR2 has been delineated. In this study, we investigated a Chinese PHO family with a manifestation of Bartter-like hypokalemia. METHODS: Clinical manifestations were collected and genetic analyses were performed in the PHO family. RESULTS: The 33-year-old male proband had severe hypokalemia due to potassium loss from the kidney, while his brother had mild hypokalemia. After being treated with etoricoxib, the serum potassium level of the patient increased rapidly to the normal range which corresponded with the reduction in his serum PGE2 and PE2 metabolite (PGEM) levels. A novel SLCO2A1 compound heterozygous mutation of p.I284V and p.C459R was identified in two PHO patients in this family. CONCLUSIONS: The present findings supported that the Bartter-like hypokalemia is a new complication of PHOAR2 caused by the high level of PGE2. Etoricoxib was demonstrated to be effective for the renal hypokalemia in PHO patients.

6.
Osteoporos Int ; 30(2): 461-468, 2019 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30569229

RESUMO

In this large-sample study, we demonstrated that osteogenesis imperfecta (OI) significantly impaired the quality of life (QoL) in children. Moderate/severe OI patients had worse QoL scores than patients with mild OI. Furthermore, the QoL for OI patients was correlated with the presence of pathogenic gene mutations. INTRODUCTION: Osteogenesis imperfecta (OI) is a hereditary disease characterized by multiple fragility fractures and progressive skeletal deformities. No detailed investigations about the quality of life (QoL) have been carried out in a large sample of patients with OI. We evaluated the QoL and its influencing factors in a large and well-characterized OI cohort. METHODS: We used a validated questionnaire of PedsQL 4.0 to evaluate the health-related quality of life (HRQoL) of children and adolescents with OI. We compared HRQoL among patients with OI types I, III, and IV. The relationship between HRQoL and pathogenic mutations in candidate OI genes was investigated. We also evaluated the influencing factors of HRQoL in OI patients. RESULTS: A total of 138 children with OI and 138 healthy controls were enrolled in this study. The HRQoL scores of OI patients were 64.4 ± 30.0, 71.9 ± 22.2, 75.7 ± 24.8, 63.7 ± 24.5, and 68.9 ± 22.0 in physical, emotional, social, school functioning, and total score, respectively, which were significantly lower than those of healthy children (86.5 ± 12.7, 83.3 ± 16.0, 92.1 ± 11.8, 87.5 ± 11.8, and 87.3 ± 10.7, all p < 0.01). Moderate and severe OI (type III/IV) patients had poorer HRQoL scores than patients with mild OI (type I). Gene mutations inducing qualitative defects in type I collagen led to worse HRQoL scores than those with quantitative defects in type I collagen, except in emotional functioning. The total HRQoL score was positively correlated with family income, lumbar, and femoral bone mineral density (BMD) Z-scores and negatively correlated with disease severity and fracture frequency. CONCLUSION: HRQoL was significantly impaired in OI patients, and patients with more severe OI had poorer HRQoL scores. For the first time, we found that children with qualitative defects in type I collagen had poorer HRQoL scores than those with quantitative defects in type I collagen.


Assuntos
Osteogênese Imperfeita/reabilitação , Qualidade de Vida , Adolescente , Densidade Óssea/genética , Estudos de Casos e Controles , Criança , Pré-Escolar , Colágeno Tipo I/genética , Estudos Transversais , Feminino , Genótipo , Humanos , Masculino , Mutação , Osteogênese Imperfeita/genética , Osteogênese Imperfeita/fisiopatologia , Osteogênese Imperfeita/psicologia , Fraturas por Osteoporose/genética , Fraturas por Osteoporose/fisiopatologia , Fraturas por Osteoporose/psicologia , Fraturas por Osteoporose/reabilitação , Fenótipo , Psicometria , Índice de Gravidade de Doença , Fatores Socioeconômicos
7.
Osteoporos Int ; 30(2): 481-489, 2019 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-30382318

RESUMO

Pseudovitamin D-deficiency rickets is a rare disease which is caused by CYP27B1. In this study, we identified 9 mutations in 7 PDDR patients. In addition, we observed the response to long-term treatment of calcitriol in 15 Chinese patients with PDDR, which showed that the biochemical abnormalities had been corrected satisfactorily after 1-year treatment. INTRODUCTION: Pseudovitamin D-deficiency rickets is a rare autosomal recessive disorder resulting from a defect in 25-hydroxyvitamin D 1α-hydroxylase, which is encoded by CYP27B1. The purpose of this study was to identify the CYP27B1 mutations and investigate the response to long-term treatment of calcitriol in Chinese patients with PDDR. METHODS: We investigated CYP27B1 mutations in seven individuals from six separate families. To investigate the response to long-term (13 years) treatment with calcitriol in PDDR patients, we additionally collected clinical data of eight families from our previous report and analyzed their biochemical parameter and radiographic changes during the treatment. RESULTS: Nine different mutations were identified: two novel missense mutations (G194R, R259L), three novel and one reported deletion mutations (c1442delA, c1504delA, c311-321del, and c. 48-60del), two novel nonsense mutations (c.85G>T, c.580G>T), and a reported insertion mutation (c1325-1332insCCCACCC). The statistical analysis revealed that parathyroid hormone (PTH) and ALP significantly decreased after 6-month and 1-year treatment with calcitriol respectively. Urine calcium was measured in all the patients without kidney stones being documented. After 6-year treatment, the radiographic abnormalities had also been improved. Two patients who had reached their final height are both with short stature (height Z-score below - 2.0). CONCLUSIONS: We identified seven novel mutations of CYP27B1 gene in seven Chinese PDDR families. Our findings revealed after 1-year treatment of active vitamin D3, PTH and ALP significantly decreased. The correction of the biochemical abnormalities had not improved the final height satisfactorily.


Assuntos
25-Hidroxivitamina D3 1-alfa-Hidroxilase/genética , Hormônios e Agentes Reguladores de Cálcio/uso terapêutico , Colecalciferol/uso terapêutico , Raquitismo Hipofosfatêmico Familiar/tratamento farmacológico , Raquitismo Hipofosfatêmico Familiar/genética , Mutação , Adolescente , Fosfatase Alcalina/sangue , Estatura/efeitos dos fármacos , Hormônios e Agentes Reguladores de Cálcio/administração & dosagem , Hormônios e Agentes Reguladores de Cálcio/farmacologia , Criança , Pré-Escolar , Colecalciferol/administração & dosagem , Colecalciferol/farmacologia , Análise Mutacional de DNA/métodos , Esquema de Medicação , Raquitismo Hipofosfatêmico Familiar/sangue , Raquitismo Hipofosfatêmico Familiar/diagnóstico por imagem , Feminino , Humanos , Masculino , Hormônio Paratireóideo/sangue , Linhagem , Radiografia , Resultado do Tratamento , Adulto Jovem
8.
Zhonghua Yi Xue Za Zhi ; 98(18): 1408-1413, 2018 May 15.
Artigo em Chinês | MEDLINE | ID: mdl-29804403

RESUMO

Objective: To explore the association between α-actinin-3 (ACTN3) polymorphism and muscle strength in postmenopausal women. Methods: Five hundred and ninety-eight postmenopausal women with an average of (62.9±7.0) years old in Dongcheng District of Beijing were included. The ACTN3 polymorphism including rs540874, rs618838 and rs2229456 were genotyped by Sequenom Mass Array to explore their associations with muscle strength. One hundred and sixty-three of them were trained with regular Tai chi movement while 271 were administered with elemental calcium 600 mg/d combined with Vitamin D 800 U/d or calcitriol 0.25 µg/d for 2 years. Association between changes of muscle strength and ACTN3 polymorphism were analyzed. Results: The rs540874 genotypes were found to be significantly associated with chair stand test[GG (9.02±3.85) s vs GA (9.27±4.14) s vs AA (9.68±5.00) s, P=0.015]. Right grip strength in women with G allele were likely to be higher compared with A allele, but it was not statistically significant (P=0.056). Multiple linear regression showed that the chair stand test of AA genotype was statistically longer than that of GG and GA genotype (ß=2.639, 95% CI: 1.632-4.646, P=0.010). The associations between rs618838, rs2229456 genotypes and muscle strength of both lower and upper limbs were not significant (all P>0.05). In addition, muscle strength of lower limbs of patients with rs540874 genotyped with G allele, rs618838 genotyped with C allele and rs2229456 genotyped with A allele increased significantly after enhanced exercise and vitamin D supplementation (all P<0.05). Conclusions: The rs540874 polymorphism of ACTN3 gene was associated with the muscle function of lower limb in postmenopausal women. The improvement of muscle strength after intervention were possibly correlated with rs540874, rs618838 and rs2229456 polymorphisms.


Assuntos
Polimorfismo Genético , Actinina , Idoso , Pequim , Feminino , Genótipo , Humanos , Pessoa de Meia-Idade , Força Muscular , Músculo Esquelético , Pós-Menopausa
9.
Osteoporos Int ; 29(6): 1389-1396, 2018 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-29520608

RESUMO

We identified novel compound heterozygous mutations in SERPINH1 in a Chinese boy suffering from recurrent fractures, femoral deformities, and growth retardation, which resulted in extremely rare autosomal recessive OI type X. Long-term treatment of BPs was effective in increasing BMD Z-score, reducing fracture incidence and reshaping vertebrae compression. INTRODUCTION: Osteogenesis imperfecta (OI) is a heritable bone disorder characterized by low bone mineral density, recurrent fractures, and progressive bone deformities. Mutation in serpin peptidase inhibitor clade H, member 1 (SERPINH1), which encodes heat shock protein 47 (HSP47), leads to rare autosomal recessive OI type X. We aimed to detect the phenotype and the pathogenic mutation of OI type X in a boy from a non-consanguineous Chinese family. METHODS: We investigated the pathogenic mutations and analyzed their relationship with the phenotype in the patient using next-generation sequencing (NGS) and Sanger sequencing. Moreover, the efficacy of long-term bisphosphonate treatment in this patient was evaluated. RESULTS: The patient suffered from multiple fractures, low bone mass, and bone deformities in the femur, without dentinogenesis imperfecta or hearing loss. Compound heterozygous variants were found in SERPINH1 as follows: c.149 T>G in exon 2 and c.1214G>A in exon 5. His parents were heterozygous carriers of each of these mutations, respectively. Bisphosphonates could be helpful in increasing BMD Z-score, reducing bone fracture risk and reshaping the compressed vertebral bodies of this patient. CONCLUSION: We reported novel compound heterozygous mutations in SERPINH1 in a Chinese OI patient for the first time, which expanded the spectrum of phenotype and genotype of extremely rare OI type X.


Assuntos
Proteínas de Choque Térmico HSP47/genética , Mutação , Osteogênese Imperfeita/genética , Conservadores da Densidade Óssea/uso terapêutico , Pré-Escolar , Difosfonatos/uso terapêutico , Seguimentos , Heterozigoto , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Osteogênese Imperfeita/complicações , Osteogênese Imperfeita/diagnóstico por imagem , Osteogênese Imperfeita/tratamento farmacológico , Fraturas por Osteoporose/etiologia , Fraturas por Osteoporose/genética , Fraturas por Osteoporose/prevenção & controle , Fenótipo , Radiografia
10.
Zhonghua Yi Xue Za Zhi ; 98(8): 581-586, 2018 Feb 27.
Artigo em Chinês | MEDLINE | ID: mdl-29534385

RESUMO

Objective: To investigate the glucose and lipid metabolic disorders in patients with myasthenia gravis (MG) without glucocorticoid therapy, and the relationships between insulin, insulin resistance, muscle strength, serum levels of osteocalcin, 25-hydroxy vitamin D (25OHD) and glucose and lipid metabolism. Methods: A total of 102 MG patients [(40±11) years old, 43 males and 59 females] without glucocorticoid treatment were enrolled in this cross-sectional study. Height, weight and the handgrip of dominant hands were measured. Serum levels of fasting blood glucose (FBG), 2-hour postprandial blood glucose (2 h PBG), glycosylated hemoglobin (HbA1c), fasting insulin (FINS), 2-hour postprandial insulin (2 h PINS), total cholesterol (TC), triglyceride (TG), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and osteocalcin, 25OHD were detected. Insulin resistance was assessed using homeostasis model assessment of insulin resistance (HOMA-IR). Results: The proportion of impaired fasting glucose or impaired glucose tolerance, type 2 diabetes, dyslipidemia, hyperinsulinemia in male and female were 30.0%, 10.0%, 50.0%, 33.3% and 17.5%, 3.5%, 27.7%, 7.1%, respectively. Serum osteocalcin levels in male and female were 2.8 (1.7, 4.4) µg/L and 2.3 (1.3, 3.9) µg/L, respectively. And 25OHD levels in male and female were (93.5±34.9) nmol/L and (81.0±30.5) nmol/L, respectively. Handgrip of male and female was (37.0±9.4) kg and (20.5±6.3) kg. After adjusted for age, FINS (r=0.619, P<0.001), 2 h PINS (r=0.640, P<0.001), HOMA-IR (r=0.534, P<0.001) were positively correlated with 2 h PBG, and the handgrip was negatively correlated with TC (r=-0.486, P=0.026), LDL-C (r=-0.485, P=0.026) in male. FINS (r=0.352, P=0.008; r=0.300, P=0.026; r=0.646, P<0.001) and 2 h PINS (r=0.278, P=0.040; r=0.518, P<0.001; r=0.382, P=0.006) and HOMA-IR (r=0.695, P<0.001; r=0.583, P<0.001; r=0.818, P<0.001) were positively correlated with FBG, 2 h PBG, HbA1c, and the handgrip were negatively correlated with FBG (r=-0.424, P=0.016), 2 h PINS (r=-0.345, P=0.034) and positively correlated with HDL-C (r=0.389, P=0.037) in female. There was no association between osteocalcin, 25OHD and glucose and lipid metabolism. Multivariate linear regression analysis also found that there were significant relationships between handgrip, insulin, insulin resistance levels and glucose and lipid metabolic disorders. Conclusion: There was a high proportion of glucose and lipid metabolic disorders in MG patients without glucocorticoid treatment, and the mechanism may be related to insulin resistance induced by muscle weakness.


Assuntos
Miastenia Gravis , Adulto , Glicemia , Estudos Transversais , Diabetes Mellitus Tipo 2 , Feminino , Glucose , Força da Mão , Humanos , Insulina , Resistência à Insulina , Masculino , Pessoa de Meia-Idade
11.
Osteoporos Int ; 29(1): 261, 2018 01.
Artigo em Inglês | MEDLINE | ID: mdl-29098346

RESUMO

In Table 2:Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

12.
Zhonghua Yi Xue Za Zhi ; 97(36): 2833-2838, 2017 Sep 26.
Artigo em Chinês | MEDLINE | ID: mdl-29050147

RESUMO

Objective: To explore the association of vitamin D receptor (VDR) gene polymorphisms with idiopathic hypoparathyroidism (IHP). Methods: Two hundred and three patients with IHP and 209 healthy age- and sex-matched subjects were recruited at Peking Union Medical College Hospital between December 1987 and December 2015 as case group and control group, respectively. The VDR gene polymorphisms including rs739837, rs3847987 and rs2228570 were analyzed by Sequenom Mass Array. The frequency of different genotypes and alleles was detected, then their association with pathogenesis of IHP was analyzed. The clinical characteristics, biochemical indicators were collected to explore the genotype-phenotype relationship. The role of reactions to vitamin D treatment were compared between patients with different genotypes. Results: There was no significant difference in the genotypes and allele frequency distribution of SNPs between the two groups (all P>0.05). However, in the initially-treated patients, the genotypes of rs739837 were related to serum calcium level (r=0.186, P=0.026). And patients with GG genotype of rs2228750 had higher level of urine calcium than GA and AA (277.7 mg vs 141.1 mg, P=0.024) after treating with oral vitamin D(3) and calcium. Conclusions: Functional SNPs of VDR gene including rs739837, rs3847987 and rs2228570 might be irrelevant to the pathogenesis of IHP. But the genotypes of rs739837 were related to serum calcium level, and rs2228570 may have an effect on the different responses to vitamin D and its analogues in IHP patients.


Assuntos
Hipoparatireoidismo , Polimorfismo de Nucleotídeo Único , Receptores de Calcitriol/genética , Estudos de Casos e Controles , Frequência do Gene , Predisposição Genética para Doença , Genótipo , Humanos , Hipoparatireoidismo/genética , Fenótipo , Vitamina D
13.
Osteoporos Int ; 28(10): 2985-2995, 2017 10.
Artigo em Inglês | MEDLINE | ID: mdl-28725987

RESUMO

The achievement of more accurate diagnosis would greatly benefit the management of patients with osteogenesis imperfecta (OI). In this study, we present the largest OI sample in China as screened by next generation sequencing. In particular, we successfully identified 81 variants, which included 45 novel variants. We further did a genotype-phenotype analysis, which helps make a better understanding of OI. INTRODUCTION: This study aims to reveal the gene mutation spectrum and the genotype-phenotype relationship among Chinese OI patients by next generation sequencing (NGS). METHODS: We developed a NGS-based panel for targeted sequencing of all exons of 14 genes related to OI, and performed diagnostic gene sequencing for a cohort of 103 Chinese OI patients from 101 unrelated families. Mutations identified by NGS were further confirmed by Sanger sequencing and co-segregation analysis. RESULTS: Of the 103 patients from 101 unrelated OI families, we identified 79 mutations, including 43 novel mutations (11 frameshift, 17 missense, 5 nonsense, 9 splice site, and 1 chromosome translocation) in 90 patients (87.4%). Mutations in genes encoding type I collagen, COL1A1 (n = 37), and COL1A2 (n = 29) accounts for 73.3% of all molecularly diagnosed patients, followed by IFITM5 (n = 9, 10%), SERPINF1 (n = 4, 4.4%), WNT1 (n = 4, 4.4%), FKBP10 (n = 3, 3.3%), TMEM38B (n = 3, 3.3%), and PLOD2 (n = 1, 1.1%). This corresponds to 75 autosomal dominant inherited (AD) OI patients and 15 autosomal recessive (AR) inherited patients. Compared with AD inherited OI patients, AR inherited patients had lower bone mineral density (BMD) at spine (P = 0.05) and less frequent blue sclera (P = 0.001). Patients with type I collagen qualitative defects had lower femoral neck BMD Z-score (P = 0.034) and were shorter compared with patients with type I collagen quantitative defects (P = 0.022). CONCLUSION: We revealed the gene mutation spectrum in Chinese OI patients, and novel mutations identified here expanded the mutation catalog and genotype and phenotype relationships among OI patients.


Assuntos
Mutação , Osteogênese Imperfeita/genética , Adolescente , Adulto , Estatura/fisiologia , Densidade Óssea/fisiologia , Criança , Pré-Escolar , China , Biologia Computacional/métodos , Feminino , Colo do Fêmur/fisiopatologia , Estudos de Associação Genética/métodos , Predisposição Genética para Doença , Genótipo , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Lactente , Recém-Nascido , Masculino , Osteogênese Imperfeita/fisiopatologia , Fenótipo , Adulto Jovem
14.
Osteoporos Int ; 28(9): 2691-2700, 2017 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-28620780

RESUMO

We identified a novel large fragment deletion from intron 9 to 3'UTR in PLS3 (E10-E16del) in one Chinese boy with X-linked early-onset osteoporosis and vertebral fractures, which expanded the pathogenic spectrum of X-linked early-onset osteoporosis. Treatment with zoledronic acid was beneficial for increasing BMD and reshaping the vertebral bodies of this patient. INTRODUCTION: X-linked early-onset osteoporosis is a rare disease, which is characterized by low bone mineral density (BMD), vertebral compression fractures (VCFs), and/or long bone fractures. We aimed to detect the phenotype and the underlying pathogenic mutation of X-linked early-onset osteoporosis in a boy from a nonconsanguineous Chinese family. METHODS: We investigated the pathogenic mutation of the patient with X-linked early-onset osteoporosis by targeted next-generation sequencing and confirmed it by Sanger sequencing. We also observed the effects of zoledronic acid on fracture frequency and BMD of the patient. RESULTS: Low BMD and multiple VCFs were the main phenotypes of X-linked early-onset osteoporosis. We identified a total of 12,229 bp deletion in PLS3, involving intron 9 to the 3'UTR (E10-E16 del). This large fragment deletion might be mediated by Alu repeats and microhomology of 26 bp at each breakpoint junction. Zoledronic acid treatment could significantly increase the Z-score of BMD and reshape the compressed vertebral bodies. CONCLUSION: We identified a large fragment deletion mutation in PLS3 for the first time and elucidated the possible mechanism of the deletion, which led to X-linked early-onset osteoporosis and multiple vertebral fractures. Our findings would enrich the etiology spectrum of this rare disease.


Assuntos
Conservadores da Densidade Óssea/uso terapêutico , Difosfonatos/uso terapêutico , Deleção de Genes , Doenças Genéticas Ligadas ao Cromossomo X/genética , Imidazóis/uso terapêutico , Glicoproteínas de Membrana/genética , Proteínas dos Microfilamentos/genética , Osteoporose/genética , Adolescente , Densidade Óssea/genética , Doenças Genéticas Ligadas ao Cromossomo X/diagnóstico por imagem , Doenças Genéticas Ligadas ao Cromossomo X/tratamento farmacológico , Doenças Genéticas Ligadas ao Cromossomo X/fisiopatologia , Humanos , Masculino , Osteoporose/diagnóstico por imagem , Osteoporose/tratamento farmacológico , Osteoporose/fisiopatologia , Linhagem , Fenótipo , Radiografia , Ácido Zoledrônico
15.
Osteoporos Int ; 28(9): 2583-2590, 2017 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-28560474

RESUMO

In a random sample of postmenopausal Chinese women, the prevalence of radiographic vertebral fractures increased from 13% between ages 50 and 59 to over 50% after age 80 years. A model with seven clinical risk factors predicted the probability of vertebral fractures as well with as without BMD and better than a model with only three risk factors. More than half an hour of outdoor activity per day might correlate with lower risk of vertebral fracture in this population. INTRODUCTION: We aimed to describe the prevalence and develop a model for prediction of radiographic vertebral fractures in a large random sample of postmenopausal Chinese women. METHODS: We enrolled 1760 women from an age-stratified random sample of postmenopausal women in Beijing, China. The presence of vertebral fracture was assessed by semi-quantitative grading of lateral thoracolumbar radiographs, risk factors by interview, bone mineral density (BMD) of the proximal femur and lumbar spine by dual x-ray absorptiometry (DXA), and markers of bone turnover from a fasting blood sample. Associations of these factors were analyzed in logistic models and discrimination by areas of receiver operating characteristics curves (AUC). RESULTS: The prevalence of vertebral fracture, ranged from 13.4% ages 50 to 59 years old to 58.1% at age 80 years or older. Older age, a history of non-vertebral fracture, lower femoral neck BMD T-score, body mass index (BMI), height loss, housework, and less than half an hour of outdoor activity were significantly associated with increased probability of having a vertebral fracture. A model with those seven factors had a similar AUC with or without BMD and performed better than a simple model with three factors. CONCLUSION: This study is from a true random sample of postmenopausal women in urban China with high response rate. The prevalence of vertebral fractures in postmenopausal women in Beijing increases from 13% under age 60 to over 50% by age 80 years. A model with seven clinical risk factors with or without BMD is better than simple models and may guide the use of spine x-rays to identify women with vertebral fractures. More than half an hour of outdoor activity might correlate with lower risk of vertebral fracture in this population.


Assuntos
Osteoporose Pós-Menopausa/epidemiologia , Fraturas por Osteoporose/epidemiologia , Fraturas da Coluna Vertebral/epidemiologia , Absorciometria de Fóton , Idoso , Idoso de 80 Anos ou mais , Densidade Óssea/fisiologia , China/epidemiologia , Exercício/fisiologia , Feminino , Colo do Fêmur/fisiopatologia , Humanos , Vértebras Lombares/fisiopatologia , Pessoa de Meia-Idade , Osteoporose Pós-Menopausa/complicações , Osteoporose Pós-Menopausa/fisiopatologia , Fraturas por Osteoporose/etiologia , Fraturas por Osteoporose/fisiopatologia , Prevalência , Curva ROC , Fatores de Risco , Fraturas da Coluna Vertebral/etiologia , Fraturas da Coluna Vertebral/fisiopatologia
16.
Osteoporos Int ; 28(8): 2383-2390, 2017 08.
Artigo em Inglês | MEDLINE | ID: mdl-28439619

RESUMO

Myasthenia gravis (MG) patients had low proximal hip BMD, which could be explained by reduced muscle strength, elevated bone resorption markers, vitamin D deficiency, and increased PTH levels in those with MG compared to controls. INTRODUCTION: Muscle strength is closely correlated with bone mineral density (BMD) and vitamin D status. Here, we evaluated muscle strength, BMD, and vitamin D status in a large sample of Chinese patients with MG. METHODS: In this cross-sectional survey, 86 patients with MG without glucocorticoid treatment and 86 healthy controls were included. Serum levels of 25-hydroxyvitamin D [25OHD], parathyroid hormone (PTH), bone turnover markers (BTMs), and BMD were measured and compared between the two groups. Grip strength and one-leg standing time (OLST) were also assessed in MG patients. RESULTS: Low grip strength and short OLST were found in 11 (12.8%) and 12 (14.0%) MG patients, respectively. There were 3 (3.5%) MG patients with low bone mass for chronological age. Serum beta C-terminal telopeptide and PTH levels were higher (p < 0.001 and p = 0.001, respectively), and BMD at the femoral neck and trochanter were lower in MG patients (p < 0.001 and p < 0.001, respectively) compared to healthy controls. In patients with MG, grip strength was positively correlated with BMD. Serum 25OHD levels were lower in MG patients than in healthy controls (17.36 ± 6.64 vs. 22.11 ± 7.28 ng/ml, p < 0.001). CONCLUSION: Grip strength was positively correlated with BMD in Chinese patients with MG. MG patients tended to have low proximal hip BMD, which may partially be explained by reduced muscle strength, vitamin D deficiency, increased PTH levels, and elevated bone resorption markers compared to controls.


Assuntos
Densidade Óssea/fisiologia , Força Muscular/fisiologia , Miastenia Gravis/fisiopatologia , Vitamina D/análogos & derivados , Absorciometria de Fóton/métodos , Adolescente , Adulto , Biomarcadores/sangue , Remodelação Óssea/fisiologia , Estudos de Casos e Controles , Estudos Transversais , Feminino , Força da Mão/fisiologia , Humanos , Masculino , Pessoa de Meia-Idade , Miastenia Gravis/sangue , Miastenia Gravis/complicações , Equilíbrio Postural/fisiologia , Vitamina D/sangue , Deficiência de Vitamina D/sangue , Deficiência de Vitamina D/etiologia , Deficiência de Vitamina D/fisiopatologia , Adulto Jovem
17.
Int J Endocrinol ; 2017: 5372625, 2017.
Artigo em Inglês | MEDLINE | ID: mdl-28352283

RESUMO

Objective. To investigate the changes of serum zinc-α2-glycoprotein (ZAG) in type 2 diabetes mellitus (T2DM) with eGFR mild decrease. Subjects and Methods. A total of 438 T2DM patients (61.3 ± 4.0 y) were recruited and the demographic, anthropometric, and biochemical parameters were all collected. Serum ZAG levels were determined by commercially available ELISA kits. Results. The proportion of T2DM patients with the high tertile ZAG levels was 11.9% higher in patients with mildly decreased estimated glomerular filtration rate (eGFR) (<90 mL/min/1.73 m2) than those with the low tertile ZAG levels (P = 0.038). The probability of the eGFR < 90 mL/min/1.73 m2 in patients with the high ZAG levels was 94% higher than those with the low serum ZAG levels after adjusting for age, gender, and education [OR = 1.94, 95% CI (1.17-3.23), P = 0.0094]. This phenomenon was more likely to be observed in the condition of uACR ≥ 2.7 mg/mmol, WC ≥ 90 cm for men, or WC ≥ 85 cm for women. Conclusion. Serum ZAG levels were firstly found to be related with eGFR in T2DM patients. The patients with the high tertile ZAG levels were more likely to have mildly eGFR decrease, especially for female patients with higher uACR and bigger WC.

18.
Zhonghua Nei Ke Za Zhi ; 56(1): 19-23, 2017 Jan 01.
Artigo em Chinês | MEDLINE | ID: mdl-28056318

RESUMO

Objective: To study the clinical characteristics of primary hypoparathyroidism in adults. Methods: The clinical data of 200 cases with adult-onset primary hypoparathyroidism in Peking Union Medical College Hospital during December 1987 to December 2015 were collected and analyzed retrospectively. Among them, 128 cases were followed up for a median period of 3 years. Results: The major manifestations at their first visits were tetany and numbness in the distal extremities(81.5%, 163/200 and 62.0%, 124/200). Thirty-two percent of the cases (62 cases) had history of seizures, and 60.9%(98/161) and 74.4%(96/129) of them were with intracerebral calcifications and cataracts, respectively.Most of subjects(155/200)had more than one year delay in diagnosis. Hypercalciuria occurred in 67.2%(86/128) of the cases during the follow-up. No significant differences in the clinical characteristics and biochemical markers between the hypercalciuria subjects and the non-hypercalciuria subjects. Renal nephrocalcinosis or stones were found in 6.5%(5/77) of the cases, and kidney function decreased in 6.6%(6/91) of the patients. Kidney function was negatively associated with age and duration of disease. Conclusions: The predominant manifestations of primary hypoparathyroidism in adults included tetany and numbness in the distal extremities and seizures. It is often misdiagnosed. Calcium supplement combined with vitamin D or its metabolites effectively relieve clinical symptoms and signs. The serum and urinary calcium levels should be monitored frequently to reduce renal complications.


Assuntos
Calcitriol/uso terapêutico , Cálcio , Hipocalcemia/tratamento farmacológico , Hipoparatireoidismo/complicações , Hipoparatireoidismo/diagnóstico , Hormônio Paratireóideo/sangue , Vitamina D/uso terapêutico , Adulto , Calcitriol/efeitos adversos , Cálcio/sangue , Cálcio/urina , Feminino , Humanos , Hipocalcemia/sangue , Hipocalcemia/urina , Hipoparatireoidismo/sangue , Hipoparatireoidismo/terapia , Hipoparatireoidismo/urina , Rim/fisiopatologia , Masculino , Nefrocalcinose/epidemiologia , Estudos Retrospectivos , Convulsões/etiologia , Albumina Sérica/análise
19.
Zhonghua Nei Ke Za Zhi ; 55(11): 859-862, 2016 Nov 01.
Artigo em Chinês | MEDLINE | ID: mdl-27801341

RESUMO

Objective: To explore tissue expression of cyclin-dependent kinase inhibitor p27Kip1 and ß-catenin in multiple endocrine neoplasia type1 (MEN1)-related parathyroid tumors (MHPT). Methods: Immunohistochemistry was performed to analyze the expression of p27Kip1 and ß-catenin in parathyroid glands from 31 subjects with MHPT collected at Peking Union Medical College Hospital from 2002 to 2013. Five normal parathyroid glands were used as control. Results: In MHPT subjects, nuclear expression of p27Kip1 was absent in 4 (12.9%), weak in 10 (32.3%) and moderated staining in 17 parathyroid specimens (54.8%), respectively. While, in normal subjects, the nuclear expression of p27Kip1 was observed in all subjects and was stronger than that from MHPT subjects (P=0.001). As to the expression of ß-catenin, normal parathyroid showed a distinct to moderate membrane staining, a moderate to weak cytoplasmic staining and negative nuclear staining. Similarly, MHPT exhibited a marked to moderate membrane (P=0.087), a moderated to weak cytoplasmic (P=0.357), and negative nuclear ß-catenin staining. Conclusions: The expression of p27Kip1 is reduced or absent in MHPT tissue, and no nuclear expression of ß-catenin is observed in the tumors, which suggesting p27Kip1, but not ß-catenin nuclear accumulation, play a role in the development of the tumors.


Assuntos
Inibidor de Quinase Dependente de Ciclina p27/genética , Neoplasia Endócrina Múltipla Tipo 1/genética , Neoplasias das Paratireoides/genética , beta Catenina/genética , Regulação Neoplásica da Expressão Gênica , Humanos , Imuno-Histoquímica , Neoplasias das Paratireoides/patologia
20.
Zhonghua Nei Ke Za Zhi ; 55(10): 769-773, 2016 Oct 01.
Artigo em Chinês | MEDLINE | ID: mdl-27686437

RESUMO

Objective: To study the clinical characteristics of childhood- and adolescent- onset hypoparathyroidism. Methods: The clinical data of 128 hypoparathyroidism patients with onset before the age of 18 years were collected and analyzed retrospectively. Results: The predominant features of the hypoparathyroidism were carpopedal spasm (89.3%, 108/121) and seizures (66.1%, 84/127). Intracranial calcification was identified in 89.4%(101/113) of the patients. Duration is an independent predictive factor (OR=1.483, P=0.011) for intracranial calcification. All the patients were treated with calcium and vitamin D or its metabolites. Hypercalciuria was associated with serum calcium (P=0.016). Conclusions: Carpopedal spasm and seizures were the main manifestations of childhood- and adolescent- onset hypoparathyroidism. Calcium and vitamin D or its metabolites are effective. Monitoring the concentration of serum and urinary calcium is of highly importance for the prevention of hypercalciuria.


Assuntos
Cálcio/administração & dosagem , Hipocalcemia/complicações , Hipoparatireoidismo/tratamento farmacológico , Convulsões/etiologia , Vitamina D/administração & dosagem , Adolescente , Idade de Início , Cálcio/sangue , Cálcio/urina , Criança , Pré-Escolar , Feminino , Hospitais , Humanos , Hipoparatireoidismo/complicações , Hipoparatireoidismo/metabolismo , Masculino , Estudos Retrospectivos , Convulsões/diagnóstico , Espasmo/etiologia , Resultado do Tratamento
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA