Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 63
Filtrar
1.
Virol J ; 18(1): 38, 2021 Feb 18.
Artigo em Inglês | MEDLINE | ID: mdl-33602271

RESUMO

BACKGROUND: In recent years, fluorescent quantitative polymerase chain reaction assays for detecting viral DNA are in widespread use throughout the world. However, considering the wide distribution of new herpesvirus among the population, we constructed a method to detect HHV-6, 7, and 8 simultaneously. METHODS: The blood samples of 74 blood donors and 45 pityriasis rosea patients were collected. The recombinant plasmids containing U67, U36, and orf65 were constructed to optimize the PCR reaction system. The forward and reverse primers and probe sequences of HHV-6 were as follows: TAAATATCGATGCCGCTCTG, ACGTTCTAGCCATCTTCTTTG, CGCAAACGACAAAGCCA. The forward and reverse primers and probe sequences of HHV-7 were as follows: TTAGACATCTTACACGACAGC, CAGCTTTTCGAACTTGTCAC, TTCATCGGGTACGTCCA. The forward and reverse primers and probe sequences of HHV-8 were as follows: GCGACATATTTCCCTGATCC, CCAACTTTAAGGTGAGAGACC, CATGCGAGCCACCAG. Through the detection of housekeeping genes, DNA sequencing, and optimization of the PCR reaction system, the triple fluorescent quantitative PCR detection system was constructed. Blood samples of blood transfusion staff and pityriasis rosea patients were detected. RESULTS: The correlations of HHV-6, 7, and 8 between single and multiplex PCR are 0.980, 0.987, 0.965, respectively. In 74 blood donor samples, 16.2% of HHV-6 and 55% of HHV-7 were positive (viral load > 3 log10 copies/ml) according to multiplex real-time PCR. In 45 patients suspected of pityriasis rosea (PR) infection, 40% HHV-6, 73.3% positive cases are found. CONCLUSION: With the safety of blood transfusion being a major concern of the public, this method will show good specificity and sensitivity in blood transfusion screening.

2.
Biol Pharm Bull ; 2020 Dec 04.
Artigo em Inglês | MEDLINE | ID: mdl-33281147

RESUMO

Subtilisin NAT, a Bacillus subtilisin, is widely applied as a functional food and considered to be one of the most exploitable potential oral thrombolytic agents. Subtilisin QK, another Bacillus subtilisin, is a serine protease fermented by Bacillus subtilis 02 and has a better thrombolytic effect. Therefore, subtilisin QK is typically used for evaluating the safety of Bacillus subtilisins. Here, we conduct several good laboratory practice (GLP)-compliant studies in non-rodent animal, i.e. in Beagle dogs, including acute toxicity, subchronic toxicity, and safety pharmacology studies. No adverse effects were evident in the acute and 28-day subchronic toxicity studies at doses up to 40000 FU/kg and 16000 FU/kg/day, respectively. In evaluating the pharmacological safety of up to 2000FU/kg subtilisin QK, we found no significant differences between the electrocardiograms, blood pressures, and respiration of beagle dogs. These findings suggest the safety of Bacillus subtilisin, providing reliable pharmacological and toxicological data for its development and popularization as a functional food and drug.

3.
World J Diabetes ; 11(10): 400-415, 2020 Oct 15.
Artigo em Inglês | MEDLINE | ID: mdl-33133388

RESUMO

As a T cell-mediated autoimmune disease, type 1 diabetes mellitus (T1DM) is marked by insulin defect resulting from the destruction of pancreatic ß-cells. The understanding of various aspects of T1DM, such as its epidemiology, pathobiology, pathogenesis, clinical manifestations, and complications, has been greatly promoted by valuable research performed during the past decades. However, these findings have not been translated into an effective treatment. The ideal treatment should safely repair the destroyed immune balance in a long-lasting manner, preventing or stopping the destruction of ß-cells. As a type of immune hypo-responsiveness to the orally administrated antigen, oral tolerance may be induced by enhancement of regulatory T cells (Tregs) or by anergy/deletion of T cells, depending on the dosage of orally administrated antigen. Acting as an antigen-specific immunotherapy, oral tolerance therapy for T1DM has been mainly performed using animal models and some clinical trials have been completed or are still ongoing. Based on the review of the proposed mechanism of the development of T1DM and oral tolerance, we give a current overview of oral tolerance therapy for T1DM conducted in both animal models and clinical trials.

4.
Front Psychiatry ; 11: 559729, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-33101081

RESUMO

Objective: Decreased homotopic connectivity of brain networks such as the cortico-striato-thalamo-cortical (CSTC) circuits may contribute to the pathophysiology of obsessive-compulsive disorder (OCD). However, little is known about interhemispheric functional connectivity (FC) at rest in OCD. In this study, the voxel-mirrored homotopic connectivity (VMHC) method was applied to explore interhemispheric coordination at rest in OCD. Methods: Forty medication-free patients with OCD and 38 sex-, age-, and education level-matched healthy controls (HCs) underwent a resting-state functional magnetic resonance imaging. The VMHC and support vector machine (SVM) methods were used to analyze the data. Results: Patients with OCD had remarkably decreased VMHC values in the orbitofrontal cortex, thalamus, middle occipital gyrus, and precentral and postcentral gyri compared with HCs. A combination of the VMHC values in the thalamus and postcentral gyrus could optimally distinguish patients with OCD from HCs. Conclusions: Our findings highlight the contribution of decreased interhemispheric FC within and outside the CSTC circuits in OCD and provide evidence to the pathophysiology of OCD.

6.
Autophagy ; : 1-21, 2020 Oct 22.
Artigo em Inglês | MEDLINE | ID: mdl-32972302

RESUMO

Pancreatic cancer is one of the most aggressive tumors associated with a poor clinical prognosis, weakly effective therapeutic options. Therefore, there is a strong impetus to discover new therapeutic targets in pancreatic cancer. In the present study, we first demonstrated that TSPAN1 is upregulated in pancreatic cancer and that TSPAN1 depletion decreases pancreatic cancer cell proliferation in vitro and in vivo. TSPAN1 expression was correlated with poor overall survival of pancreatic cancer patients. Moreover, we demonstrated that TSPAN1 is a novel positive regulator of macroautophagy/autophagy characterized by decreased LC3-II and SQSTM1/p62 expressions, inhibited puncta formation of GFP-LC3 and autophagic vacuoles. We also demonstrated that tspan1 mutation impaired autophagy in the zebrafish model. Furthermore, we showed that TSPAN1 promoted autophagy maturation via direct binding to LC3 by two conserved LIR motifs. Mutations in the LIR motifs of TSPAN1 resulted in a loss of the ability to induce autophagy and promote pancreatic cancer proliferation. Second, we discovered two conservative TCF/LEF binding elements present in the promoter region of the TSPAN1 gene, which was further verified through luciferase activity and ChIP assays. Furthermore, TSPAN1 was upregulated by FAM83A through the canonical WNT-CTNNB1 signaling pathway. We further demonstrated that both TSPAN1 and FAM83A are both direct targets of MIR454 (microRNA 454). Additionally, we revealed the role of MIR454-FAM83A-TSPAN1 in the proliferation of pancreatic cancer cells in vitro and in vivo. Our findings suggest that components of the MIR454-FAM83A-TSPAN1 axis may be valuable prognosis markers or therapeutic targets for pancreatic cancer.Abbreviations: AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; APC: APC regulator of WNT signaling pathway; ATG: autophagy related; AXIN2: axin 2; BECN1: beclin 1; CCND1: cyclin D1; CSNK1A1/CK1α: casein kinase 1 alpha 1; CTNNB1/ß-catenin: catenin beta 1; DAPI: 4'6-diamino-2-phenylindole; EBSS: Earle's balanced salt solution; EdU: 5-ethynyl-20-deoxyuridine; FAM83A: family with sequence similarity 83 member A; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; GSK3B: glycogen synthase kinase 3 beta; IHC: immunohistochemical; LAMP1: lysosomal associated membrane protein 1; LIR: LC3-interacting region; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MIR454: microRNA 454; miRNA: microRNA; MKI67: antigen identified by monoclonal antibody Ki 67; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; MYC: MYC proto-oncogene, bHLH transcription factor; OS: overall survival; PDAC: pancreatic ductal adenocarcinoma; RAB7A: RAB7A, member RAS oncogene family; shRNA: short hairpin RNA; SQSTM1: sequestosome 1; TBE: TCF/LEF binding element; TCGA: The Cancer Genome Atlas; TCF/LEF: transcription factor/lymphoid enhancer binding factor; TCF4: transcription factor 4; TSPAN1: tetraspanin 1; TUNEL: terminal deoxynucleotidyl transferase mediated dUTP nick end labeling; UTR: untranslated region; WT: wild type.

7.
Transplantation ; 2020 Jul 27.
Artigo em Inglês | MEDLINE | ID: mdl-32776778

RESUMO

BACKGROUND: Ischemia reperfusion injury (IRI) is the major cause of primary graft dysfunction in organ transplantation. The MEK/ERK signaling pathway plays a crucial role in cell physiological and pathological processes including IRI. This study aims to investigate whether inhibition of ERK signaling with U0126 can prevent prolonged cold IRI in heart transplantation. METHODS: Rat cardiac cell line H9c2 cells were treated with U0126 prior to exposure to hypothermic hypoxia reoxygenation (H/R) conditions. The effect of U0126 on H9c2 cells in response to H/R stress was determined by measuring cell death, reactive oxygen species (ROS) production, mitochondrial membrane potential (MMP), and ERK signaling activation. Mouse syngeneic heterotopic heart transplantation was conducted where a donor heart was preserved in the University of Wisconsin (UW) solution supplemented with U0126 for 24 hrs at 4°C prior to transplantation. Heart graft function, histopathological chances, apoptosis, and fibrosis were measured to assess IRI. RESULTS: Phosphorylated ERK was increased in both in vitro H/R injured H9c2 cells and in vivo heart grafts with IRI. Pretreatment with U0126 inhibited ERK phosphorylation, prevented H9c2 cells from cell death, ROS generation and MMP loss in response to H/R. Preservation of donor hearts with U0126 supplemented solution improved graft function, and reduced IRI by reductions in cell apoptosis/death, neutrophil infiltration and fibrosis of the graft. CONCLUSIONS: Addition of U0126 to UW solution reduces ERK signal activation and attenuates prolonged cold IRI in a heart transplantation model. ERK inhibition with U0126 may be a useful strategy to minimize IRI in organ transplantation.

8.
J Pharm Biomed Anal ; 186: 113264, 2020 Jul 15.
Artigo em Inglês | MEDLINE | ID: mdl-32276207

RESUMO

Intravascular thrombosis is a main cause of multiple cardiovascular diseases. A high thrombolytic activity of the microbial fibrinolytic enzyme Subtilisin QK-2, which is highly homologous to Nattokinase, shows great exploitable potential in thrombolytic therapy. However, the lack of a sensitive detection method limits the further analysis of Subtilisin QK-2 in vivo. We prepared a polyclonal antibody and four monoclonal antibodies (IgG1, titers of 1:500,000) to establish a sensitive sandwich ELISA for Subtilisin QK-2 detection. The limit of detection (LOD) of this ELISA was 1.160 ng/mL. The linear range of the standard curve was 1.96-250 ng/mL (R2 = 0.9912). The cut-off value was 0.236. Subsequently, a pharmacokinetic dose (IV bolus) was administered and analyzed with the established ELISA. The concentration-time profiles were best fitted to a two-compartment model. T1/2α values for doses of 2 mg/kg, 4 mg/kg, and 8 mg/kg were 29.90 ±â€¯10.02 min, 27.17 ±â€¯1.96 min, and 21.83 ±â€¯9.95 min, and T1/2ß values were 144.43 ±â€¯49.73 min, 173.46 ±â€¯52.58 min, and 159.49 ±â€¯48.75 min, respectively. Subtilisin QK-2 was eliminated through a mechanism with first-order kinetics. In conclusion, this study provides useful data for further research and clinical applications of Subtilisin QK-2 in the treatment of cardiovascular diseases.

9.
Eur Arch Psychiatry Clin Neurosci ; 270(8): 1015-1024, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31570980

RESUMO

Abnormalities of the cerebellum and default-mode network (DMN) in patients with obsessive-compulsive disorder (OCD) have been widely reported. However, alterations of reciprocal functional connections between the cerebellum and DMN at rest in OCD remain unclear. Forty patients with OCD and 38 gender-, age-, and education-matched healthy controls (HCs) underwent resting-state functional magnetic resonance imaging scan. Seed-based functional connectivity (FC) and support vector machine (SVM) were applied to analyze the imaging data. Compared with HCs, patients with OCD exhibited increased FCs between the left Crus I-left superior medial prefrontal cortex (MPFC) and between the right Crus I-left superior MPFC, left middle MPFC, and left middle temporal gyrus (MTG). A significantly negative correlation was observed between the right Crus I-left MTG connectivity and the Yale-Brown Obsessive-Compulsive Scale compulsion subscale scores in the OCD group (r = - 0.476, p = 0.002, Bonferroni corrected). SVM classification analysis indicated that a combination of the left Crus I-left superior MPFC connectivity and the right Crus I-left middle MPFC connectivity can be used to discriminate patients with OCD from HCs with a sensitivity of 85.00%, specificity of 68.42%, and accuracy of 76.92%. Our study highlights the contribution of the cerebellar-DMN connectivity in OCD pathophysiology and provides new findings to OCD research.

10.
Autophagy ; 16(10): 1786-1806, 2020 10.
Artigo em Inglês | MEDLINE | ID: mdl-31696776

RESUMO

Macroautophagy/autophagy plays key roles in development, oncogenesis, and cardiovascular and metabolic diseases. Autophagy-specific class III phosphatidylinositol 3-kinase complex I (PtdIns3K-C1) is essential for autophagosome formation. However, the regulation of this complex formation requires further investigation. Here, we discovered that STYK1 (serine/threonine/tyrosine kinase 1), a member of the receptor tyrosine kinases (RTKs) family, is a new upstream regulator of autophagy. We discovered that STYK1 facilitated autophagosome formation in human cells and zebrafish, which was characterized by elevated LC3-II and lowered SQSTM1/p62 levels and increased puncta formation by several marker proteins, such as ATG14, WIPI1, and ZFYVE1. Moreover, we observed that STYK1 directly binds to the PtdIns3K-C1 complex as a homodimer. The binding with this complex was promoted by Tyr191 phosphorylation, by means of which the kinase activity of STYK1 was elevated. We also demonstrated that STYK1 elevated the serine phosphorylation of BECN1, thereby decreasing the interaction between BECN1 and BCL2. Furthermore, we found that STYK1 preferentially facilitated the assembly of the PtdIns3K-C1 complex and was required for PtdIns3K-C1 complex kinase activity. Taken together, our findings provide new insights into autophagy induction and reveal evidence of novel crosstalk between the components of RTK signaling and autophagy. Abbreviations: AICAR: 5-aminoimidazole-4-carboxamide ribonucleotide; AMPK: adenosine 5'-monophosphate (AMP)-activated protein kinase; ATG: autophagy related; ATP: adenosine triphosphate; BCL2: BCL2 apoptosis regulator; BECN1: beclin 1; Bre A: brefeldin A; Co-IP: co-immunoprecipitation; CRISPR: clustered regularly interspaced short palindromic repeats; DAPI: 4',6-diamidino-2-phenylindole; EBSS: Earle's balanced salt solution; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescent protein; GSEA: gene set enrichment analysis; MAP1LC3/LC3, microtubule associated protein 1 light chain 3; MAPK8/JNK1: mitogen-activated protein kinase 8; mRFP: monomeric red fluorescent protein; MTOR: mechanistic target of rapamycin kinase; MTT: 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide; PIK3C3: phosphatidylinositol 3-kinase catalytic subunit type 3; PIK3R4: phosphoinositide-3-kinase regulatory subunit 4; qRT-PCR: quantitative reverse transcription PCR; RACK1: receptor for activated C kinase 1; RUBCN: rubicon autophagy regulator; siRNA: small interfering RNA; SQSTM1: sequestosome 1; STYK1/NOK: serine/threonine/tyrosine kinase 1; TCGA: The Cancer Genome Atlas; Ub: ubiquitin; ULK1: unc-51 like autophagy activating kinase 1; UVRAG: UV radiation resistance associated; WIPI1: WD repeat domain, phosphoinositide interacting 1; ZFYVE1: zinc finger FYVE-type containing 1.

11.
Appl Microbiol Biotechnol ; 103(21-22): 8737-8751, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31637493

RESUMO

Insulin therapy remains the most effective method to treat diabetes mellitus (DM), and the demand for this valuable hormone has exceeded that of any other protein-based medicine as a result of the dramatic increase in the number of diabetic patients worldwide. Understanding the structure of insulin and the interaction with its receptor is important for developing proper formulations. As a result of the relatively low thermal stability of native insulin and its two-chain analogues, the application of single-chain insulin (SCI) analogues, which can be obtained relatively easily by recombinant DNA technology or chemical synthetic methods, represents a promising alternative approach. In this review, the basic knowledge of insulin (discovery, biosynthesis, and structure) and the current model of the interaction with its receptor are outlined. Furthermore, we outline the strategies for the design and production of various SCI analogues and their reported applications.


Assuntos
Hipoglicemiantes/uso terapêutico , Insulina , Receptor de Insulina/metabolismo , Diabetes Mellitus/tratamento farmacológico , Humanos , Insulina/análogos & derivados , Insulina/metabolismo , Insulina/uso terapêutico
12.
Immunol Lett ; 214: 37-44, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31473255

RESUMO

Oral tolerance, induced by oral administration of autoantigens, is a promising therapeutic approach to treat type 1 diabetes mellitus (T1DM). However, the degradation of antigens passing through the gastrointestinal tract (GIT) leads to low induction efficiency. Based on our previous study, a single-chain insulin (SCI-59) analog, bound to the surface of lactic acid bacteria (LAB) bacterium-like particles (BLPs), was more stable in the simulated gastric fluid, compared to free SCI-59 and insulin. Based on the analysis of diabetes progression, a significant decrease in the incidence of diabetes was observed in mice fed BLPs-SCI-59. Oral administration of BLPs-SCI-59 can enhance glucose tolerance in NOD mice and this effect may result from the protection of pancreatic islet beta cells, as compared to the free SCI-59 group and BLPs group. Oral administration of BLPs-SCI-59 can significantly reduce insulitis and preserve the ability of insulin secretion in treated mice. Oral vaccination with BLPs-SCI-59 induced SCI-59 specific T cell tolerance in treated mice, which may due to the repair of Th1/Th2 imbalance and increased CD4+CD25+FoxP3+ regulatory T cells (Tregs). These results show that oral vaccination with BLPs-SCI-59 is a promising way to prevent T1DM in NOD mice.


Assuntos
Diabetes Mellitus Tipo 1/imunologia , Tolerância Imunológica/efeitos dos fármacos , Insulina/farmacologia , Lactobacillales , Administração Oral , Animais , Diabetes Mellitus Tipo 1/tratamento farmacológico , Diabetes Mellitus Tipo 1/patologia , Insulina/imunologia , Camundongos , Camundongos Endogâmicos NOD , Linfócitos T Reguladores/imunologia , Linfócitos T Reguladores/patologia , Células Th1/imunologia , Células Th1/patologia , Células Th2/imunologia , Células Th2/patologia
13.
Cell Commun Signal ; 17(1): 105, 2019 08 22.
Artigo em Inglês | MEDLINE | ID: mdl-31438969

RESUMO

BACKGROUND: Breast cancer is a life-threatening disease in females and the leading cause of mortality among the female population, presenting huge challenges for prognosis and treatment. ITM2A is a member of the BRICHOS superfamily, which are thought to have a chaperone function. ITM2A has been identified to related to ovarian cancer progress recently. However, the biological role of ITM2A in breast cancer remains largely unclear. METHODS: Quantitative real-time polymerase chain reaction (qRT-PCR), western blotting assay and immunohistochemistry staining were used to analyzed the expression level of ITM2A. The patient overall survival versus ITM2A expression level was evaluated by Kaplan-Meier analysis. MTT assay, EdU incorporation assay and colony formation assay were used to evaluated the role of ITM2A on breast cancer cell proliferation. Autophagy was explored through autophagic flux detection using a confocal microscope and autophagic vacuoles investigation under a transmission electron microscopy (TEM). In vitro kinase assay was used to investigated the phosphorylation modification of ITM2A by HUNK. RESULTS: Our data showed that the expression of integral membrane protein 2A (ITM2A) was significantly down-regulated in human breast cancer tissues and cell lines. Kaplan-Meier analysis indicated that patients presenting with reduced ITM2A expression exhibited poor overall survival, and expression significantly correlated with age, progesterone receptor status, TNM classification and tumor stage. ITM2A overexpression significantly inhibited the proliferation of breast cancer cells. By studying several autophagic markers and events in human breast cancer SKBR-3 cells, we further demonstrated that ITM2A is a novel positive regulator of autophagy through an mTOR-dependent manner. Moreover, we found that ITM2A was phosphorylated at T35 by HUNK, a serine/threonine kinase significantly correlated with human breast cancer overall survival and HER2-induced mammary tumorigenesis. CONCLUSION: Our study provided evidence that ITM2A functions as a novel prognostic marker and represents a potential therapeutic target.


Assuntos
Apoptose , Neoplasias da Mama/metabolismo , Neoplasias da Mama/patologia , Proteínas de Membrana/metabolismo , Proliferação de Células , Células Cultivadas , Feminino , Humanos , Proteínas Serina-Treonina Quinases/metabolismo , Transdução de Sinais , Serina-Treonina Quinases TOR/metabolismo
14.
Mol Ther Nucleic Acids ; 17: 657-668, 2019 Sep 06.
Artigo em Inglês | MEDLINE | ID: mdl-31400608

RESUMO

Epstein-Barr virus (EBV) is a ubiquitous human γ-herpesvirus that infects over 90% of the global population. EBV is considered a contributory factor in a variety of malignancies including nasopharyngeal carcinoma, gastric carcinoma, Burkitt lymphoma, and Hodgkin's lymphoma. Notably, EBV was the first virus found to encode microRNAs (miRNAs). Increasing evidence indicates that EBV-encoded miRNAs contribute to the carcinogenesis and development of EBV-associated malignancies. EBV miRNAs have been shown to inhibit the expression of genes involved in cell proliferation, apoptosis, invasion, and immune signaling pathways. Therefore, EBV miRNAs perform a significant function in the complex host-virus interaction and EBV-driven carcinogenesis. However, the integrated mechanisms underlying the roles of EBV miRNAs in carcinogenesis remain to be further explored. In this review, we describe recent advances regarding the involvement of EBV miRNAs in the pathogenesis of EBV-associated malignancies and discuss their potential utility as cancer biomarkers. An in-depth investigation into the pro-carcinogenic role of EBV miRNAs will expand our knowledge of the biological processes associated with virus-driven tumors and contribute to the development of novel therapeutic strategies for the treatment of EBV-associated malignancies.

15.
Colloids Surf B Biointerfaces ; 178: 80-86, 2019 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-30844563

RESUMO

DNA nanostructures are effective intermediates for immobilizing biomolecules because of their high level of controllability, the flexibility to create desired nanostructures through precision "bottom-up" assembly and the convenience to building fine nanostructures. The purpose of this study was to demonstrate the potential use of aptamers bound to agarose through a DNA tetrahedral structure to make a novel type of immunosorbent for the removal of hepatitis B virus surface antigens. Our results show that the proposed immunosorbent exhibits favorable biocompatibility and specificity. Electrophoresis and confocal microscopy were used to confirm the formation of immunosorbents. The ARCHITECT HBsAg assay was performed to quantitatively measure hepatitis B surface antigen. The cytotoxic potential of the immunosorbent was determined by an in vitro viability assay using V79 lung fibroblasts, demonstrating that the immunosorbents are noncytotoxic. The high adsorption capacity of the novel DNA nanostructure-based adsorbents towards hepatitis B surface antigen indicated the potential application of these materials for the treatment of Hepatitis B infection.


Assuntos
DNA/química , Antígenos de Superfície da Hepatite B/química , Nanoestruturas/química , Sefarose/química , Aptâmeros de Nucleotídeos/química , Linhagem Celular , Sobrevivência Celular/fisiologia , Humanos
16.
Biomed Res Int ; 2018: 1269063, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-30671444

RESUMO

Objective: To establish a novel HBV specific immunoadsorbent for the removing of HBV particles. Methods: The anti-HBsAg monoclonal antibody was immobilized on sepharose beads to produce a sepharose anti-HBs column. Then the immunoadsorbent was evaluated and characterized by scanning electron microscopy. In addition, time-dependent effects of the eradication capacity of anti-HBsAg functionalized sepharose beads against HBV were investigated. Results: Proposed immunoadsorbents exhibited a favorable biocompatibility as well as specificity. With the optimized recycle time, the decontamination performance of HBV particles and quantity of HBsAg were assessed either by real-time quantitative PCR or ELISA, which showed that the immunoadsorbent could remove approximately 90% of the HBV and 90% of the HBsAg from human plasma samples. Conclusions: All these results indicated that the novel immunoadsorbent could effectively remove HBV particles and likely serve as a novel therapy option or at least supplementary for the treatment regimen of HBV.


Assuntos
Vírus da Hepatite B/imunologia , Hepatite B/imunologia , Hepatite B/virologia , Plasma/imunologia , Plasma/virologia , Anticorpos Imobilizados/imunologia , Ensaio de Imunoadsorção Enzimática/métodos , Anticorpos Anti-Hepatite B/imunologia , Antígenos de Superfície da Hepatite B/imunologia , Humanos , Técnicas de Imunoadsorção , Reação em Cadeia da Polimerase em Tempo Real/instrumentação
17.
Oncotarget ; 8(60): 101309-101324, 2017 Nov 24.
Artigo em Inglês | MEDLINE | ID: mdl-29254166

RESUMO

In the present study, we found the mRNA expression level of glycerol-3-phosphate dehydrogenase (GPD1) was significantly downregulated in human breast cancer patients. Patients with reduced GPD1 expression exhibited poorer overall metastatic relapse-free survival (p = 0.0013). Further Cox proportional hazard model analysis revealed that the reduced expression of GPD1 is an independent predictor of overall survival in oestrogen receptor-positive (p = 0.0027, HR = 0.91, 95% CI = 0.85-0.97, N = 3,917) and nodal-negative (p = 0.0013, HR = 0.87, 95% CI = 0.80-0.95, N = 2,456) breast cancer patients. We also demonstrated that GPD1 was a direct target of miR-370, which was significantly upregulated in human breast cancer. We further showed that exogenous expression of GPD1 in human MCF-7 and MDA-MB-231 breast cancer cells significantly inhibited cell proliferation, migration, and invasion. Our results, therefore, suggest a novel tumour suppressor function for GPD1 and contribute to the understanding of cancer metabolism.

18.
Oncotarget ; 8(17): 27915-27928, 2017 Apr 25.
Artigo em Inglês | MEDLINE | ID: mdl-28427190

RESUMO

Anti-microtubule drugs, such as paclitaxel (PTX), are extensively used for the treatment of numerous cancers. However, growing evidence has shown that PTX resistance, either intrinsic or acquired, frequently occurs in patients and results in the failure of treatment, contributing to the high cancer mortality rate. Therefore, it is necessary to identify the genes or pathways involved in anti-microtubule drug resistance for future successful treatment of cancers. Pygopus2 (Pygo2), which contains a Zn-coordinated plant homeodomain (PHD) finger domain, is critical for ß-catenin-dependent transcriptional switches in normal and malignant tissues and is over-expressed in various cancers, including human brain glioma. In this study, we report that over-expression of Pygo2 inhibited the efficacy of PTX and contributed to cell multidrug resistance in two different ways. First, over-expression of Pygo2 inhibited the PTX-induced phosphorylation of B-cell lymphoma 2 (Bcl-2), suppressing the proteolytic cleavage of procaspase-8/9 and further inhibiting the activation of caspase-3, which also inhibits the activation of the JNK/SAPK pathway, ultimately inhibiting cell apoptosis. Second, over-expression of Pygo2 facilitated the expression of P-glycoprotein, which acts as a drug efflux pump, by promoting the transcription of Multi-drug resistance 1 (MDR1) at the MDR1 promoter loci, resulting in acceleration of the efflux of PTX.


Assuntos
Antineoplásicos Fitogênicos/farmacologia , Neoplasias Encefálicas/genética , Regulação Neoplásica da Expressão Gênica , Glioma/genética , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Subfamília B de Transportador de Cassetes de Ligação de ATP/genética , Subfamília B de Transportador de Cassetes de Ligação de ATP/metabolismo , Membro 1 da Subfamília B de Cassetes de Ligação de ATP/metabolismo , Antineoplásicos Fitogênicos/uso terapêutico , Apoptose/efeitos dos fármacos , Neoplasias Encefálicas/tratamento farmacológico , Neoplasias Encefálicas/patologia , Caspase 3/metabolismo , Caspase 8/metabolismo , Caspase 9/metabolismo , Linhagem Celular Tumoral , Imunoprecipitação da Cromatina , Resistência a Múltiplos Medicamentos/genética , Resistencia a Medicamentos Antineoplásicos/genética , Glioma/tratamento farmacológico , Glioma/patologia , Humanos , Peptídeos e Proteínas de Sinalização Intracelular/genética , Sistema de Sinalização das MAP Quinases/genética , Paclitaxel/farmacologia , Paclitaxel/uso terapêutico , Fosforilação , Regiões Promotoras Genéticas , Proteínas Proto-Oncogênicas c-bcl-2/metabolismo , Reação em Cadeia da Polimerase Via Transcriptase Reversa , beta Catenina/metabolismo
19.
Appl Microbiol Biotechnol ; 101(8): 3259-3271, 2017 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-28120013

RESUMO

Insulin plays an important role in drug therapies for diabetes mellitus and as the main route of insulin delivery, subcutaneous injection may cause local discomfort, hypoglycemia, hyperinsulinemia, and patient non-compliance. Therefore, oral delivery of insulin is more preferred. However, there is a low bioavailability due to insulin degradation by proteolytic enzymes and severe pH conditions along the gastrointestinal tract. In order to use the food-grade bacteria lactic acid bacteria (LAB) as oral delivery vehicles, a new and bioactive single-chain insulin (SCI-59) analog, containing the insulin B- and A-chains connected by an eight-residue linker (RSRGLPFR), was secretory expressed in Lactococcus lactis NZ3900 without using an antibiotic resistance gene and displayed onto the surface of various non-viable bacteria (NVBs) without genetic modification. Both the free SCI-59 and SCI-59 displayed on the surface of NVBs are biologically active as assayed by their ability to stimulate Akt signaling in differentiated 3T3-L1 adipocytes. Modification of the pH of the medium by NaOH addition at early time during induction can enhance the bioactivity of SCI-59. The C-terminal fused anchoring domain, three LysM repeats, does not affect the formation of disulfide bonds and/or the folding of SCI-59, and SCI-59 could be exposed properly and fully when SCI-59-3LysM bound to the surface of NVBs. Compared to the free form SCI-59, SCI-59 displayed on the surface of NVBs is more stable in simulate gastric juice. It may open new prospects for possible oral treatments of diabetes using live LAB secreting or NVBs carrying bioactive SCI analogs.


Assuntos
Técnicas de Visualização da Superfície Celular/métodos , Insulina/análogos & derivados , Insulina/metabolismo , Lactococcus lactis/genética , Lactococcus lactis/metabolismo , Administração Oral , Transporte Biológico , Diabetes Mellitus/tratamento farmacológico , Sistemas de Liberação de Medicamentos , Humanos , Insulina/química , Insulina/genética , Secreção de Insulina , Viabilidade Microbiana , Transdução de Sinais
20.
PLoS One ; 11(11): e0165390, 2016.
Artigo em Inglês | MEDLINE | ID: mdl-27835633

RESUMO

D-dimer level in cancer patients is associated with risk of venous thromboembolism and deep venous thrombosis. Most cancer patients have "abnormal" D-dimer levels based on the current normal reference range. To investigate tumor-specific D-dimer reference range, we compared D-dimer levels for nine different tumour types with healthy controls by using simultaneous quantile regression and constructing a median, 5th percentile, and 95th percentile model of normal tumour D-dimer concentration. Associations with tumour primary site, stage, pathological type, and treatment were also explored. Additionally, 190 patients were tracked to reveal the relevance of initial D-dimer levels to cancer prognosis. D-dimer ranges (median, 5th, 95th) in various cancers (mg/L) were: liver 1.12, 0.27, 5.25; pancreatic 0.96, 0.23, 4.81; breast 0.44, 0.2, 2.17; gastric 0.65, 0.22, 5.03; colorectal 0.73, 0.22, 4.45; lung 0.7, 0.25, 4.0; gynaecological 0.61, 0.22, 3.98; oesophageal 0.23, 0.7, 3.45; and head and neck 0.22, 0.44, 2.19. All were significantly higher than that of healthy controls (0.18, 0.07, 0.57). D-dimer peaked 1-2 days postoperatively but had decreased to the normal range by 1 week. Additionally, cancer patients with high initial D-dimer were shown a tendency of poor prognosis in survival rate. In conclusion, D-dimer levels in cancer depend on patient age, tumour primary site, and tumour stage. Thrombosis prevention is necessary if D-dimer has not decreased to the tumor-specific baseline a week after surgery.


Assuntos
Produtos de Degradação da Fibrina e do Fibrinogênio/metabolismo , Neoplasias/diagnóstico , Tromboembolia Venosa/diagnóstico , Trombose Venosa/diagnóstico , Adulto , Fatores Etários , Idoso , Anticoagulantes/uso terapêutico , Estudos Transversais , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Estadiamento de Neoplasias , Neoplasias/complicações , Neoplasias/tratamento farmacológico , Neoplasias/mortalidade , Especificidade de Órgãos , Prognóstico , Valores de Referência , Taxa de Sobrevida , Fatores de Tempo , Tromboembolia Venosa/complicações , Tromboembolia Venosa/tratamento farmacológico , Tromboembolia Venosa/mortalidade , Trombose Venosa/complicações , Trombose Venosa/tratamento farmacológico , Trombose Venosa/mortalidade
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA