Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 46
Filtrar
Mais filtros











Intervalo de ano de publicação
1.
Journal of Practical Radiology ; (12): 385-389, 2024.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-1020221

RESUMO

Objective To explore the value of dual-phase enhanced CT radiomics in predicting post-acute pancreatitis diabetes mellitus(PPDM-A).Methods A total of 145 patients with acute pancreatitis(AP)were retrospectively collected,including 62 patients in PPDM-A group and 83 patients in non-PPDM-A group.The patients were randomly divided into training set and test set at a ratio of 7︰3,the pancreatic parenchyma in arterial phase and venous phase was delineated and the radiomics features were extracted.Vari-ance threshold method,univariate selection method and least absolute shrinkage and selection operator(LASSO)were used to screen radiomics features.The prediction performance of the model was evaluated by the area under the curve(AUC).The DeLong test was used to compare the prediction efficiency between the models,and the calibration curve and decision curve were used to evaluate the prediction efficiency of the model.Results The AUC of arterial phase model,venous phase model,combined arterial venous phase model,clinical model and radiomics combined clinical model in the training set were 0.845,0.792,0.829,0.656 and 0.862,respec-tively.The DeLong test results showed that only the difference between the radiomics combined clinical model and the clinical model in the training set and the test set was statistically significant(P<0.05).The decision curve showed that the radiomics combined clinical model had high clinical practicability in a certain range,and the calibration curve showed that the radiomics combined clinical model had the best fitting degree with the actual observation value.Conclusion Based on the dual-phase enhanced CT radiomics combined clinical model,PPDM-A can be predicted more accurately,and it can provide a certain reference value for the clinical development of per-sonalized treatment programs.

2.
Journal of Practical Radiology ; (12): 1980-1984, 2023.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-1020125

RESUMO

Objective To explore the value of CT enhanced radiomics model in predicting severe hyperlipidemic acute pancreatitis(HLAP).Methods The data of 117 HLAP patients were analyzed retrospectively and the patients were randomly divided into a training set(93 cases)and a test set(24 cases)in the ratio of 8∶2.CT enhanced images of arterial phase and venous phase were collected,and the optimal radiomics features were extracted and screened.The arterial phase model and venous phase model were established by support vector machine(SVM).Meanwhile,the bedside index for severity in acute pancreatitis(BISAP)was scored and a BISAP model was developed for the patients based on clinical information.The area under the curve(AUC)under the receiver operating characteristic(ROC)curve was used as the evaluation criterion for the model.DeLong test was used to compare the prediction efficiency of each model.Results The training set AUC of the arterial phase model,venous phase model and BISAP model were 0.777,0.788 and 0.732,respectively.And the AUC of the test set were 0.836,0.734 and 0.695,respectively.DeLong test results showed that the training set AUC of the arterial phase model and the venous phase model was better than that of BISAP model(P<0.05),but there was no significant difference between the AUC of the test set AUC(P>0.05).There was no significant difference in AUC between arterial phase model and venous phase model(P>0.05).Conclusion The radiomics model based on CT enhancement can predict the severity of HLAP at the early stage,which helps to target the treatment of HLAP patients in the early clinical stage.

3.
Preprint em Inglês | bioRxiv | ID: ppbiorxiv-517008

RESUMO

The coronavirus disease 2019 (COVID-19) pandemic caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has claimed millions of lives worldwide, not to mention innumerable losses in the global economy and disruptions in social relationships. Unfortunately, state-of-the-art treatments still lag behind the fast emergence of new variants of concern. The key to resolve this issue is to develop broad-spectrum antivirals with innovative antiviral mechanisms in which coronaviruses are deactivated regardless of their variant development. Herein, we report a new antiviral strategy involving extracellular disintegration of viral proteins that are indispensable for viral infection with hyperanion-grafted enediyne molecules. The sulfate groups ensure low cellular permeability and rather low cytotoxicity of the molecules, while the core enediyne generates reactive radical species and causes significant damage to the spike (S) protein of coronavirus. The enediyne compounds exhibit antiviral activity at micromolar to nanomolar concentrations, and the selectivity index of up to 20,000 against four kinds of human coronaviruses, including the SARS-CoV-2 omicron variant, suggesting the high potential of this new strategy in combating the COVID-19 pandemic.

4.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-955417

RESUMO

Objective:To explore the effects of small-incision carpal tunnel release on postoperative functional recovery and electrophysiological indexes in carpal tunnel syndrome (CTS).Methods:A total of 75 patients with CTS treated in Shulan (Hangzhou) Hospital were enrolled as the research objects between April 2016 and April 2021. According to different surgical methods, they were divided into group A (34 cases, small-incision carpal tunnel release) and group B (41 cases, traditional carpal tunnel release). The operation time, hospitalization time, time to resume work, electrophysiological indexesbefore and after surgery, and postoperative complications were compared between the two groups.Results:Compared with group B, operation time, hospitalization time and time to resume work were shorter in group A: (12.32 ± 3.26) min vs. (34.65 ± 7.49) min, (5.15 ± 1.68) d vs. (7.83 ± 2.24) d, (18.22 ± 2.03) d vs. (37.35 ± 3.16) d ( P<0.05). After surgery, electrophysiological indexes in both groups were improved ( P<0.05), but there was no significant difference between the two groups ( P>0.05). The incidence rates of scar pain, decreased grip strength and hand piercing pain in group A were lower than those in group B: 2.94%(1/34) vs. 19.51%(8/41), 0 vs. 21.95%(9/41), 0 vs. 12.20%(5/41) ( P<0.05). Conclusions:Compared with traditional carpal tunnel release, clinical curative effect of small-incision carpal tunnel release is comparable on CTS patients. However, it can shorten operation time, hospitalization time and time to resume work, reduce incidence of postoperative complications.

5.
Chinese Journal of Radiology ; (12): 772-777, 2022.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-956734

RESUMO

Objective:To evaluate the value of radiomics analysis based on enhanced MRI in predicting the recurrence of acute pancreatitis (AP).Methods:From January 2017 to December 2020, 201 patients diagnosed with AP were collected retrospectively in the Affiliated Hospital of North Sichuan Medical College. These patients underwent plain and enhanced MRI within 7 days after onset. After clinical follow-up, 102 cases were classified as non-recurrence AP group and 99 cases were classified as recurrent acute pancreatitis (RAP) group. They were divided into training set (140 cases, 71 cases in non-recurrence AP group, 69 cases in RAP group) and validation set (61 cases, 31 cases in non-recurrence AP group, 30 cases in RAP group) using a random number table method. The independent sample t-test, Mann-Whitney U test or χ 2 test were used to compare the clinical characteristics between the two groups, and the clinical characteristics with statistical differences were included in logistic regression to construct the clinical model. The quantitative features of radiomics were extracted based on the late arterial-phase images of contrast-enhanced MRI. The best radiomics features retained after dimensionality reduction were used to construct the radiomics model through logistic regression analysis, and a combined model was constructed by combining the clinical features. The prediction ability of the models was evaluated by the receiver operating characteristic curve, and the area under the curve (AUC) was compared by DeLong test. Results:There were statistical differences in gender, severity, local complications, hyperlipidemia and smoking between non-recurrence AP group and RAP group (all P<0.05). Hyperlipidemia was an independent risk factor for AP recurrence (OR=5.236, 95%CI 2.710-10.101). The 9 best radiomics features by dimensionality reduction were selected to construct a radiomics model. The AUCs of clinical model, radiomics model and combined model in the training set were 0.803, 0.944 and 0.978 respectively, and those in the validation set were 0.678, 0.940 and 0.955 respectively. In the training set and the validation set, the prediction ability of the radiomics model and combined model were higher than those of the clinical model (training set: Z=3.28, 4.83, P=0.001,<0.001; validation set: Z=3.48, 4.05, both P<0.001). Conclusions:The radiomics model based on late arterial-phase enhanced MRI has good quantitative prediction ability for the recurrence of AP, which can provide a reference for the prevention and treatment of RAP.

6.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-933905

RESUMO

We report a case of fetal akinesia deformation sequence (FADS), which was prenatally suspected on ultrasound and confirmed by whole exome sequencing and Sanger sequencing after mid-term termination. Prenatal ultrasonography revealed multiple abnormalities in a fetus at 21 +4 weeks of gestation, consisting of fixed posture of limbs, narrow thorax, markedly shrunken gastric vacuole, and thickened nuchal fold. After genetic counseling, the pregnancy was terminated, and the appearance of the fetus was consistent with the ultrasound findings. Whole exome sequencing and Sanger sequencing of the fetal tissue verified a compound heterozygous variation of the RAPSN gene--c.149_153delins AGATGGGCCGCTACAAGGAGATGG (p.V50Efs*114) and c.227T>C (p.L76P), which were inherited from the father and mother, respectively, ultimately confirming the diagnosis of FADS.

7.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-912847

RESUMO

Quality supervision is the important guarantee of hospital quality and patient safety, and also the core content of the fourth cycle grade hospital evaluation in Zhejiang province. Based on the evaluation standards, Hangzhou Women′s Hospital used information technology to optimize the hospital′s quality supervision and feedback system, and set up a traceable and closed-loop quality and safety supervision system. The system realized five function points: storage and extraction of supervision problems, online recording of supervision results, real-time feedback of supervision results, online feedback of rectification opinions of supervised departments, and tracking and evaluation of functional departments. After the operation of the system, the quality supervision process of the hospital realized information operation, and could be tracked online at all time points, which improved the efficiency of hospital quality management, better ensured the implementation of medical system and patient safety, and promoted the continuous improvement of medical quality indicators.

8.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-934549

RESUMO

Hospital is a crowded place, and the population health management is very important. In the context of the normalized control of COVID-19, it is crucial to establish a set of insensitive, intelligent and effective crowd diversion management strategies. By deeply integrating information technologies such as big data processing, movement tracking and face recognition, Hangzhou Ninth People′s Hospital built a set of crowd health management and population diversion work mechanism, which included temperature monitoring, health code inspection and epidemiological history investigation. The mechanism could effectively promote the efficiency and accuracy of hospital population health screening under the situation of normalized epidemic prevention and control.

9.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-1003933

RESUMO

【Objective】 To conduct accurate analysis of blood inventory, so as to provide basis for taking targeted measures. 【Methods】 Taking the suspended red blood cells(RBCs) as an example, mathematical formulas were set by online Excel table, and the inventory of each blood group of RBCs in a certain day can be predicted accurately by inputting daily inventory and units distributed, and estimated daily units collected.Preventive measures such as enhancing recruitment or limiting collection could be taken as soon as possible to keep the blood inventory at a reasonable level. 【Results】 Blood inventory had been moderate during the six months of practice, and neither blood shortage nor collected blood expiring occurred. 【Conclusion】 The early warning system based on the online form, which is highly practical and easy to operate, is suitable for inventory management of blood components.

10.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-872255

RESUMO

Public hospitals in the face of COVID-19, should prioritize medical services of patients as the topmost task. In order to ensure the smooth progress of diagnosis and treatment, and prevent the occurrence of nosocomial infection, the hospital took an overall response strategy featuring " logistics support mode 3+ 1" . This strategy requires to make facilities ready by transforming isolation wards, overall management and deployment of protection supplies, optimizing logistics service flow, strict sterilization and isolation of medical wastes and environment, optimizing catering service within the hospital to reduce the gathering and flow of personnel. It also enhanced personnel training, to eliminate staff panic and to stabilize the logistics support team. Meanwhile, the logistics department took over the hospital access screening work for tight access control, which maximize the safety and reliability of the logistics support within the hospital, and ensure the smooth progress of the epidemic prevention work.

11.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-872263

RESUMO

At present, we are fighting against the outbreak of COVID-19 in China.For the purposes of diagnosis and treatment of these patients, Hangzhou Xixi Hospital, as a designated hospital, made available the wards quickly, initiated the management system of public health emergencies, and established a " tolerate admission-strict discharge" patients management program. Meanwhile, the hospital has established an emergency supply and coordinated distribution mechanism for medical protection materials, and a full-system and multi-model training system, ensuring smooth progress of the diagnosis and treatment work.

12.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-811541

RESUMO

Nowadays hospitals have been at the forefront fighting against novel coronavirus pneumonia, with diagnosing and treating of patients as a top priority. In order to ensure the smooth progress of diagnosis and treatment, and prevent the occurrence of nosocomial infection, logistics support needs to make allowances for the isolation ward in time from the perspectives of logistics, facilities and equipment, and to transform the in-and-out double channels of ward access as required, thus setting up the partition of the three zones. Secondly, logistics support needs to optimize the logistics service workflow, including the medical waste management, the environmental disinfection isolation, and to optimize the catering service within hospitals to reduce the gathering and flow of personnel. Thirdly, logistics support needs to increase personnel training, and to eliminate psychological panic as well as to stabilize the logistics support team by putting logistics management cadres on the front line. Meanwhile, the logistics department needs to take over the hospital access screening work, strictly manage those who enter the hospital, maximize the safety and reliability of the logistics support within the hospital, and ensure the smooth progress of the epidemic prevention work.

13.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-811543

RESUMO

At present, we are fighting against the outbreak of novel coronavirus pneumonia (NCP) in China. For the purposes of diagnosis and treatment of NCP patients, Hangzhou Xixi Hospital, as a designated hospital, make available the wards quickly, initiated the management system of public health emergencies, and established a "tolerate admission- strict discharge" patients management program. Meanwhile, the hospital has established an emergency supply and coordinated distribution mechanism for medical protection materials, and a full-system and multi-model training system, ensuring smooth progress of the diagnosis and treatment work.

14.
Journal of Practical Radiology ; (12): 1081-1085, 2019.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-752496

RESUMO

Objective Toinvestigatethechangesofiron,fatandwatercontentinspleentissuesforacutepancreatitis(AP).Methods Atotal of44patientswithAP(experimentalgroup)and21healthysubjects(controlgroup)wererecruitedinthisstudy.RoutineupperabdominalMR scansandIDEAL-IQsequencescanwereperformed.TheR2?,Water,FatandFFvaluesofspleenwererespectivelymeasuredinthe experimentalgroupandcontrolgroup,andthedataofthetwogroupswereanalyzedstatistically.Results TheR2?value(P=0.011),Water value(P=0.003)andFatvalue(P=0.022)ofspleenintheexperimentalgroupandthecontrolgrouphadsignificantdifferences, whiletheFFvalue(P=0.861)didn’t.TherewerenosignificantdifferencesinR2?,WaterandFatvaluesinthemild,moderateand severeAP (P>0.05).aswellasintheyounggroup (14-44yearsold),themiddle-agedgroup (45-59yearsold)andtheelderly group (≥60yearsold)inAP (P>0.05).Conclusion APcanleadtothechangesofirondeposition,fatandwatercontentinspleen tissue,andIDEAL-IQtechnologycanquantitativelyevaluatethechangeofthem.

15.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-756588

RESUMO

Systems and procedures are key to a hospital. How to upgrade hospital quality and medical level with systems and procedures, achieving a consistency among " drafting-practice-presentation" , deserves further attention by hospital administrators. The rounding process used at the hospital is designed to reform and optimize the institutional development. Following the PDCA cycle, the hospital established rounding teams to check the quality compliance, and correct defects found to improve hospital management. Such efforts adapt to conditions of the hospital and help build a closed-loop management model for hospital′s institutional development. Initial success has been observed, as staff compliance of regulations is upgraded, better ensuring medical quality and safety of the hospital.

16.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-696750

RESUMO

Objective To study the CT perfusion imaging features of pancreas under liver cirrhosis.Methods 191 cases including 48 normal controls(group A)and 143 patients with liver cirrhosis(group B)were randomly collected according to the inclusion and exclusion criteria.The scope of pancreatic perfusion imaging scan was determined based on conventional plain CT scan of middle and upper abdomen.All patients were injected with contrast agent at the antecubital vein tunnel group and then with normal saline at the same rate.The original perfusion images were transmitted to the workstation and were analyzed by the pancreatic perfusion software package,and the perfusion parameters were recorded for statistical analysis.Results (1)There were statistical differences in pancreatic perfusion parameter values,namely blood flow(BF),blood volume(BV)and mean transit time(MTT),between group A and group B(P<0.05).BF and BV of group B were lower than those of group A but MTT was higher than that of group A,and there was no statistical difference in permeability surface(PS)(P>0.05).(2)For group B,each pancreas part(head,body and tail)had no statistical difference in perfusion parameter values,namely BF,BV,PS and MTT(P>0.05).(3)For group B which was divided into three groups according to Child-Pugh,there were statistical differences in parameter values BF and BV(P<0.05)among the three groups and no statistical differences in BF and BV among any two of the groups(P<0.05);there were no statistical differences in PS and MTT among the three groups.(4)In group B,there was a statistical difference in BF between the subgroup with collateral circulation and the one without collateral circulation(P<0.05),the subgroup with collateral circulation showed lower BF than that of the subgroup without collateral circulation and there were no statistical differences in BV,PS and MTT(P>0.05).Conclusion Liver cirrhosis can result in microcirculation disturbance of pancreas,the change in microcirculation varies depending on the degree of liver cirrhosis, and CT perfusion imaging is helpful to the evaluation of pancreatic microcirculation in the state of liver cirrhosis.

17.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-712487

RESUMO

Under the mission of "patient safety first",this paper discussed the development of a hospital intelligent transport system by means of information technology, and its successful practice in the hospital.Information technology,internet of things, "internet plus"concept, and intelligent platform can provide logistic transport services of high efficiency and quality, and achieve the development of hospital meticulous management and intelligent medical logistics in China.

18.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-712617

RESUMO

This paper presented the introduction of information technology to develop the hospital's one-card intelligent management system and its successful application. Thanks to the effective integration and linkage of hospital resources and information technology, such a system is built on the Internet of Things, platform + application, " Internet +" mindset. Thus the system can effectively achieve the service philosophy of strong security, high efficiency, and sustainable development, as well as more convenient access to medical treatment, more effective communication, and a new pattern of more comfortable medical and health services.

19.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-735122

RESUMO

This paper, based on the development and practice of hospital intelligent transport platform, discussed the practice and exploration of the digital transport mode of " pay for order" . With the help of information technology, internet of things, and " internet plus" concept, the intelligent platform can further motivate the staff, and encourage optimization of the hospital logistic management. Logistic transportation workers can gain more pay by more work via such a platform, thus forming a hospital logistic management key performance indicator evaluation system, and further the development of hospital fine management and smart development.

20.
Artigo em Chinês | WPRIM (Pacífico Ocidental) | ID: wpr-607315

RESUMO

Objective In order to improve blood donors to understand the health education knowledge,this study designed and evaluated a new project,that is the health education pathway for primary apheresis donors.Methods A total of 2900 primary apheresis donors participated in the current study,who were randomly divided into the experimental group and the control group.The experimental group was performed the health education pathway for primary apheresis donors,while the control group was conducted in the traditional health educational ways.We compared the basic information,the awareness rate of apheresis donation knowledge,the number of regnlar/repeated donors,and the frequency of donations.Results Two groups were matched with no group differences in basic information (P>0.05).After performed the health education pathway for primary apheresis donors,the awareness rate of apheresis donation knowledge was significantly improved from 23.6% to 84.3% (P<0.01).Moreover,the percentage of regular donors (40.2%) in the experimental group higher than the percentage (26.7%) in the control group(P<0.01).The average donation times of experimental group (3.8) was also higher than the control group.There were 79.2% donors changed to regular/repeated donors higher than the percentage (66.4%) in the control group,and the average frequency of apheresis of those regular/repeated apheresis donors (7.4) in the experimental group higher than the control group (6.4) (P<0.01).Conclusion As showed in our results,the health education pathway for primary apheresis donors could effectively help donors to understand the knowledge of blood donation and health care,and promote team construction of regular donors.We hope,in the future,the health education pathway for primary apheresis donors could be widely spread.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA