Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.605
Filtrar
1.
Sci Total Environ ; 838(Pt 3): 156501, 2022 Sep 10.
Artigo em Inglês | MEDLINE | ID: mdl-35667430

RESUMO

Many exoelectrogens utilize small redox mediators for extracellular electron transfer (EET). Notable examples include Shewanella species, which synthesize flavins, and Pseudomonas species, which produce phenazines. In natural and engineered environments, redox-active metabolites from different organisms coexist. The interaction between Shewanella oneidensis and phenazine 1-carboxylic acid (PCA, a representative phenazine compound) was investigated to demonstrate exoelectrogens utilizing metabolites secreted by other organisms as redox mediators. After 24 h in a reactor with and without added PCA (1 µM), the anodic current generated by Shewanella was 235 ± 11 and 51.7 ± 2.8 µA, respectively. Shewanella produced oxidative current approximately three times as high with medium containing PCA as with medium containing the same concentration of riboflavin. PCA also stimulated inward EET in Shewanella. The strong effect of PCA on EET was attributed to its enrichment at the biofilm/electrode interface. The PCA voltammetric peak heights with a Shewanella bioanode were 25-30 times higher than under abiotic conditions. The electrochemical properties of PCA were also altered by the transition from two-electron to single-electron electrochemistry, which suggests PCA was bound between the electrode and cell surface redox proteins. This behavior would benefit electroactive bacteria, which usually dwell in open systems where mediators are present in low concentrations. Like flavins, PCA can be immobilized under both bioanode and biocathode conditions but not under metabolically inactive conditions. Shewanella rapidly transfers electrons to PCA via its Mtr pathway. Compared with wild-type Shewanella, the PCA reduction ability was decreased in gene knockout mutants lacking Mtr pathway cytochromes, especially in the mutants with severely undermined electrode-reduction capacities. These strains also lost the ability to immobilize PCA, even under current-generating conditions.


Assuntos
Shewanella , Ácidos Carboxílicos/metabolismo , Flavinas/química , Flavinas/metabolismo , Oxirredução , Fenazinas/metabolismo , Shewanella/metabolismo
2.
Adv Mater ; : e2200430, 2022 May 28.
Artigo em Inglês | MEDLINE | ID: mdl-35643987

RESUMO

Long processing time and high temperatures are often required in sintering ceramic electrolytes, which lead to volatile element loss and high cost. Here, we report an ultrafast sintering method of microwave-induced carbothermal shock to fabricate various ceramic electrolytes in seconds. Furthermore, it is also able to integrate electrode and electrolyte in one step by simultaneous co-sintering. Based on this ultrafast co-sintering technique, an all-solid-state lithium-metal battery with a high areal capacity is successfully achieved, realizing a promising electrochemical performance at room temperature. This method can extend to other various ceramic multilayer based solid devices. This article is protected by copyright. All rights reserved.

3.
Chem Commun (Camb) ; 2022 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-35647676

RESUMO

Carbon monoxide (CO) plays an important role in signaling in cells, making its use as a therapeutic tool highly intriguing. Reduced burst emissions are important to avoid the cytotoxicity and tissue damage caused by CO. Here, we developed a stable diiron carbonyl [FeFe] hydrogenase agent that enables prolonged CO release activity (half-life of over 9 h) in cells. The integrated analysis allowed the identification of the key intermediate sites and CO accumulations with subcellular resolution. We observed that the [FeFe]A complex was enriched in neurons with S-methyl bond rupture. Furthermore, the [FeFe]A complex efficiently reduced the aggregation of tau proteins (49.3% reduction) and showed superior biocompatibility in nerve cells (∼ 95% survival).

4.
Digit Health ; 8: 20552076221102770, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35646378

RESUMO

Objective: The UPrEPU mobile app is a self-monitoring system to enable men who have sex with men to optimize their pre-exposure prophylaxis adherence for HIV prevention. The app was designed to accommodate a rather complicated event-driven dosing schedule. We aim to evaluate the usability of the UPrEPU app and its effectiveness in improving adherence monitoring. Methods: From May to October 2020, 35 participants were enrolled for the usability study and followed up for 4 months. Blood samples for the drug concentration in the dried blood spots were obtained once during the second to fourth follow-up visits. The effectiveness of adherence monitoring was analyzed using Cohen's kappa statistic to calculate the concordance between the average number of pills taken and drug concentration in the dried blood spots. Results: Overall retention was 91.4% (32 participants) at the end of the study. Participants used the app for a mean of 29 days and made 2565 data entries in total, with an average of 76 data entries. The average systematic usability scale score for the app was 71.5, indicating acceptable usability. Slight agreement was reached between the dried blood spots measurement and the number of pills taken and recorded in the app (weighted kappa: 0.21). Conclusions: Our user-centered UPrEPU app demonstrated that it could accommodate both daily and event-driven dosing schedules for men who have sex with men clients with acceptable usability scores. We confirmed that complex behaviors such as different drug-dosing regimens that are contingent on sexual behaviors could be incorporated into the design of a mobile app.

5.
Mol Cell ; 2022 May 31.
Artigo em Inglês | MEDLINE | ID: mdl-35662397

RESUMO

Coenzyme A (CoA) is essential for metabolism and protein acetylation. Current knowledge holds that each cell obtains CoA exclusively through biosynthesis via the canonical five-step pathway, starting with pantothenate uptake. However, recent studies have suggested the presence of additional CoA-generating mechanisms, indicating a more complex system for CoA homeostasis. Here, we uncovered pathways for CoA generation through inter-organismal flows of CoA precursors. Using traceable compounds and fruit flies with a genetic block in CoA biosynthesis, we demonstrate that progeny survive embryonal and early larval development by obtaining CoA precursors from maternal sources. Later in life, the microbiome can provide the essential CoA building blocks to the host, enabling continuation of normal development. A flow of stable, long-lasting CoA precursors between living organisms is revealed. This indicates the presence of complex strategies to maintain CoA homeostasis.

6.
Dis Markers ; 2022: 5286820, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35707714

RESUMO

Background: CYP26A1 has been reported in multiple cancers. However, the role of CYP26A1 in pancreatic cancer (PC) has not been explored. Method: The public data used for this study was obtained from The Cancer Genome Atlas (TCGA), Gene Expression Omnibus (GEO), and Cancer Cell Line Encyclopedia (CCLE) cell lines. CCK8, colony formation, and EdU assay were used to assess the proliferation ability of cancer cells. Transwell and wound healing assays were used to evaluate the invasion and migration ability of cancer cells. qRT-PCR and western blot assays were used to analyze the RNA and protein level of genes. Survival package was used for prognosis analysis. Gene Set Enrichment Analysis (GSEA) was used to identify biological pathway differences between two groups. ssGSEA analysis was used to quantify the immune microenvironment in PC tissue. GDSC and TIDE analyses were used for sensitivity analysis of chemotherapy and immunotherapy. Results: Our results showed that CYP26A1 was overexpressed in PC tissue and cell lines. Meanwhile, metastatic PC cell lines tend to have a higher CYP26A1 level compared with the primary PC cell lines based on CCLE data. Moreover, CYP26A1 was associated with worse clinical features. Also, we found that CYP26A1 had a satisfactory efficiency in predicting overall survival, disease-specific survival, and progression-free interval of PC patients, independent of other clinical features. In vitro experiments indicated that CYP26A1 could significantly facilitate the proliferation, invasion, and migration ability of PC cells. GSEA showed that the pathways of angiogenesis, E2F target, MYC target, mTORC signaling, G2M checkpoint, and epithelial-mesenchymal transition were activated in high CYP26A1 patients. Immune infiltration analysis showed that CYP26A1 was positively correlated with macrophages, Th1 cells, and Treg cells, but negatively correlated with Th17 cells. TIDE analysis showed that non_responder patients had a higher CYP26A1 level compared with predicted responder patients of immunotherapy. Drug sensitivity analysis and assay showed that CYP26A1 could increase the chemotherapy sensitivity of gemcitabine. Conclusions: In summary, CYP26A1 promotes PC progression and is a novel biomarker of PC, with potential for clinical application.


Assuntos
Biomarcadores Tumorais , Neoplasias Pancreáticas , Ácido Retinoico 4 Hidroxilase , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Linhagem Celular Tumoral , Proliferação de Células/genética , Humanos , Neoplasias Pancreáticas/patologia , Prognóstico , Ácido Retinoico 4 Hidroxilase/genética , Microambiente Tumoral
7.
J Am Chem Soc ; 2022 Jun 09.
Artigo em Inglês | MEDLINE | ID: mdl-35679487

RESUMO

Multi-wavelength lasers, especially the triple-wavelength laser around 1060 nm, could be produced by the 4F3/2 → 4I11/2 transition of Nd3+ and present numerous challenges and opportunities in the field of optoelectronics. The Nd3+-doped high-temperature phase of LaBSiO5 (ß-LBSO) is an ideal crystal to produce triple-wavelength lasers; however, the crystal growth is challenging because of the phase transition from ß-LBSO to low-temperature phase (α-LBSO) at 162 °C. This phase transition is successfully suppressed when the doping content of Nd3+ is larger than 6.3 at. %, and the Nd3+-doped ß-LBSO is stable at room temperature. The local disorder of BO4 tetrahedra due to Nd3+ doping is essential to the stabilization of ß-LBSO. For the first time, the ß-LBSO:8%Nd3+ crystal with a dimension of 1.8 × 1.8 × 1.8 cm3 is obtained through the top-seeded solution method. The crystal shows strong optical absorption in the range of 785-815 nm, matching well with the commercial laser diode pumping source. The optical emission of 4F3/2 → 4I11/2 splits into four peaks with the highest optical emission cross section of 2.14 × 10-20 cm2 at 1068 nm. The continuous-wave triple-wavelength generation of coherent light at 1047, 1071, and 1092 nm is achieved with the highest output power of 235 mW and efficiency of 12.1%.

8.
Chin J Dent Res ; 25(2): 131-137, 2022 Jun 10.
Artigo em Inglês | MEDLINE | ID: mdl-35686593

RESUMO

OBJECTIVE: To investigate the relationship between chewing sugar-free gum (SFG) and dental caries status in China. METHODS: A total of 860 teenagers (aged 12 to 15 years) and 490 adults (aged ≥ 18 years) were recruited using a multistage stratified cluster method from economically developed areas (Beijing, Guangdong) and less economically developed areas (Hubei, Xinjiang). Each participant completed a questionnaire including oral health-related knowledge of SFG and chewing habits of SFG and agreed to undertake a clinical assessment. Potential factors associated with chewing conditions were analysed through a chi-square statistical test. A negative binominal regression analysis was performed to quantify the relationship between dental caries and consumption of SFG. RESULTS: The overall percentage of the survey population who consumed SFG was 43.4%, and SFG-related knowledge and awareness was only 19.4%. For decayed, missing and filled permanent teeth (DMFT), the mean value was 1.63 ± 2.41 and 2.29 ± 3.65 in the chewing group and non-chewing group, respectively. According to the negative binominal regression analysis, the caries status in the SFG chewing group was better than in the non-chewing group (adjusted prevalence rate ratio [PRR] 0.73; 95% confidence interval [CI] 0.62-0.87). CONCLUSION: The chewing condition and oral health-related knowledge and awareness of SFG is low. Chewing SFG is related to a better dental caries status, so regular consumption of SFG should be recommended when promoting oral health.


Assuntos
Goma de Mascar , Cárie Dentária , Adolescente , Adulto , China/epidemiologia , Cárie Dentária/epidemiologia , Humanos , Mastigação , Saúde Bucal
9.
Phytomedicine ; 102: 154194, 2022 Jul 20.
Artigo em Inglês | MEDLINE | ID: mdl-35660348

RESUMO

BACKGROUND: Uncontrolled inflammation causes health problems. Extracellular signal-regulated kinase (ERK) phosphorylates signal transducer and activator of transcription 3 (STAT3) at Ser727, resulting in inflammation. The leaf of Vernonia amygdalina (VA) is a medicinal herb for managing inflammation-associated diseases. Oral administration or topical application of VA leaf extract exerts anti-inflammatory effects in rat models. However, the anti-inflammatory mechanisms of the herb are not fully understood. PURPOSE: In this study, we aimed to investigate the involvement of ERK/STAT3 (Ser727) signaling in the anti-inflammatory effects of an ethanolic extract of VA leaves. STUDY DESIGN AND METHODS: Extracts of VA leaves were prepared with different concentrations of ethanol. A LPS-stimulated RAW264.7 cell model was used for in vitro assays, and a TPA (12-O-tetradecanoylphorbol-13-acetate)-induced ear edema mouse model was employed for in vivo assays. The 95% ethanol extract of VA leaves (VAE) exerted the strongest inhibitory effect on nitric oxide (NO) production in LPS-stimulated macrophages; thus it was selected for use in this study. Hematoxylin and eosin (H&E) staining was used to examine pathological conditions of mouse ear tissues. Griess reagent was employed to examine NO generation in cell cultures. Immunoblotting and ELISA were used to examine protein levels, and RT-qPCR was employed to examine mRNA levels. RESULTS: Topical application of VAE ameliorated mouse ear edema induced by TPA. VAE suppressed the phosphorylation of ERK (Thr202/Tyr204) and STAT3 (Ser727); and decreased protein levels of inducible nitric oxide synthase (iNOS), cyclooxygenase-2 (COX-2), interleukin (IL)-6, IL-1ß and tumor necrosis factor-α (TNF-α) in the mouse ear tissues and in LPS-stimulated RAW 264.7 cells. VAE also inhibited NO production, and lowered mRNA levels of IL-6, IL-1ß and TNF-α in the macrophages. CONCLUSIONS: VAE ameliorates TPA-induced mouse ear edema. Suppression of ERK/STAT3 (Ser727) signaling is involved in VAE's anti-inflammatory effects. These novel data provide further pharmacological justifications for the medicinal use of VA in treating inflammation-associated diseases, and lay the groundwork for developing VAE into a new anti-inflammatory agent.


Assuntos
Fator de Transcrição STAT3 , Vernonia , Animais , Anti-Inflamatórios/farmacologia , Anti-Inflamatórios/uso terapêutico , Edema/tratamento farmacológico , Etanol , MAP Quinases Reguladas por Sinal Extracelular/metabolismo , Inflamação/induzido quimicamente , Inflamação/tratamento farmacológico , Interleucina-6/metabolismo , Lipopolissacarídeos/farmacologia , Camundongos , NF-kappa B/metabolismo , Óxido Nítrico/metabolismo , Óxido Nítrico Sintase Tipo II/metabolismo , Extratos Vegetais/uso terapêutico , RNA Mensageiro , Ratos , Fator de Transcrição STAT3/metabolismo , Fator de Necrose Tumoral alfa/metabolismo
10.
Artigo em Inglês | MEDLINE | ID: mdl-35708236

RESUMO

Confined liquid has attracted great attention due to its potential applications in nanofluidic devices. With the development of liquid-cell transmission electron microscopy (LC-TEM), investigating the behaviors of confined liquid can be realized in real time. However, the dynamics of the liquid layer in liquid cells have not been fully understood. Here, nanoparticles (NPs) adhered to the cell window membranes are used as reference objects to study the flow regime of the liquid layer, which causes cooperative motion of the membranes and the NPs. Two categories of motion behaviors are investigated. One is the contraction of NPs toward the interior viewing area which results from the spreading out of the liquid to the surrounding region, with the bending of the membranes increasing with the loss of liquid in the viewing area. The other motion behavior is the occasional movement of all the NPs in the same direction with the directional movement of the liquid layer. This work offers a new method to study the dynamics of liquids by LC-TEM, the discoveries of which are valuable for understanding the confined liquid dynamics.

11.
Orthop Surg ; 2022 Jun 13.
Artigo em Inglês | MEDLINE | ID: mdl-35698255

RESUMO

OBJECTIVE: With or without screw stabilization for diastatic syndesmosis in advanced pronation-external rotation (PE) ankle injuries has not yet been well-determined. Both techniques were retrospectively compared to investigate the superiority of either of the two. METHODS: A retrospective cohort study was carried out. From January 1, 2008, to December 31, 2017, 81 consecutive adult patients (average, 42 years; range, 18-78 years; 44 men and 37 women) with advanced PE ankle injuries (stage 3 or 4 PE type) were treated. After malleolar fractures were internally stabilized with screws and plates, the syndesmotic stability was rechecked by external rotation and hook tests. The necessity of cortical screw insertion to stabilize diastatic syndesmosis was decided by the individual orthopaedic surgeon. Postoperatively, a short leg splint was used for 6 weeks. The syndesmotic screw was removed based on the surgeon's policy. The removal of internal fixation for malleolar fractures was required after 1 year. The outcomes of both approaches were compared clinically, and ankle function was compared using the American Orthopaedic Foot and Ankle Society (AOFAS) score. For statistical comparison, the chi-square test was used for categorical data and the Mann-Whitney U test was used for numerical data. RESULTS: Seventy-one patients (average, 40 years; range, 18-78 years; 40 men and 31 women) were followed for at least 1 year (87.7%; average, 2 years; range, 1-11 years). Group 1 (with syndesmotic stabilization) had 22 patients and Group 2 (without syndesmotic stabilization), 49 patients. The union rate in Group 1 patients was 100% (22/22), and in Group 2 patients, 91.8% (45/49; p = 0.17). One deep wound infection occurred in Group 1 patients and two in Group 2 patients. Syndesmosis re-diastasis occurred in 13.6% (3/22) of Group 1 patients and 30.6% (15/49) of Group 2 patients (p = 0.13). One syndesmotic screw broke at 6 months. Satisfactory ankle function according to the AOFAS score was noted in 86.4% (19/22) of Group 1 patients and 65.3% (32/49) of Group 2 patients (p = 0.07). CONCLUSION: Insertion of syndesmotic screws to promote ligament healing after internal fixation of malleolar fractures in advanced PE ankle injuries may be reasonable.

12.
Cancer Inform ; 21: 11769351221100718, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35722224

RESUMO

Motivation: The precise diagnosis of the major subtypes, lung adenocarcinoma and lung squamous cell carcinoma, of non-small-cell lung cancer is of practical importance as some treatments are subtype-specific. However, in some cases diagnosis via the commonly-used method, that is staining the specimen using immunohistochemical markers, may be challenging. Hence, having a computational method that complements the diagnosis is desirable. In this paper, we propose a gene signature for this purpose. Results: We developed an expression-based method that systematically suggests a huge set of candidate gene signatures and finds the best candidate. By applying this method to a training set, the optimal gene signature was found by considering close to 765 billion candidate signatures. The 8-gene signature found for classifying the 2 aforementioned subtypes comprises TP63, CALML3, KRT5, PKP1, TESC, SPINK1, C9orf152, and KRT7. The signature achieved a high overall prediction accuracy of 0.936 when tested using 34 independent gene expression datasets obtained using different technologies and comprising 2556 adenocarcinoma and 1630 squamous cell carcinoma samples. Additionally, the signature performed well in clinically challenging cases, that is poorly differentiated tumors and specimens obtained from biopsies. In comparison with 2 previously reported signatures, our signature performed better in terms of overall accuracy and especially accuracy of classifying lung squamous cell carcinoma. Conclusions: Our signature is easy to use and accurate regardless of the technology used to obtain the gene expression profiles. It performs well even in clinically challenging cases and thus can assist pathologists in diagnosis of the ambiguous cases.

13.
Plant Dis ; 2022 Jun 19.
Artigo em Inglês | MEDLINE | ID: mdl-35722916

RESUMO

'Baiwei' (swallowwort root, Cynanchum versicolor Bunge), is a perennial cranberry type of Chinese medicinal herb, and grows in mountains with wide distribution in many provinces including Shandong, Henan, Hebei, Liaoning, Anhui and others. The functions of 'Baiwei' are strengthening myocardial contraction, detoxifying, and as a diuretic; thus it is one of very important herbs in China (Yunsi Su et al. 2021). With the increasing need for this herbal medicine in China, farmers are trying to cultivate the wild type of 'Baiwei'. In 2019, we found severe crop damage in a second-year planting of 'Baiwei' with many dead plants in a field (Fig. S1A, B) in Mengyin County of Shandong Province, China. Root galls were clearly seen in the roots and the typical root-knot nematode (Meloidogyne spp.) symptoms were observed (Fig. S1C). The previous crop was peanut. Peanut is widely planted in Shandong Province and peanut root-knot nematode (M. arenaria) is one of its major root-knot nematode pests. We suspected that the damage was caused by peanut root-knot nematode. The roots were taken to the lab and kept at 10℃ for morphological and molecular identification of root-knot nematodes, and pathogenicity testing. Twenty females were picked up from the infected roots for perineal pattern observation. The perineal pattern had distinct characteristics such as a low dorsal arch and lateral field marked by forked and broken striae and without punctate markings between the anus and tail terminus (Fig. S2A), which is similar to the description of M. arenaria (Eisenback et al., 1981). Eggs were extracted from roots and hatched to second-stage juveniles (J2s). The morphometric characters of J2s (n = 30) demonstrated body length = 437.35 ± SE 3.51 µm, body width = 16.74 ± 0.16 µm, stylet length = 11.31 ± 0.20 µm, DGO = 3.87 ± 0.07 µm, tail length = 53.32 ± 0.99 µm, and hyaline tail terminus = 11.14 ± 0.12 µm. The universal primer 194/195 (5.8S-18S rDNA TTAACTTGCCAGATCGGACG/TCTAATGAGCCGTACGC) for confirmation of Meloidogyne spp. was chosen and the sequence characterized amplified region (SCAR) PCR specific markers for M. incognita (Finc/Rinc GGGATGTGTAAATGCTCCTG/CCCGCTACACCCTCAACTTC), M. javanica (Fjav/Rjav ACGCTAGAATTCGACCCTGG/GGTACCAGAAGCAGCCATGC), M. enterolobii (Fent/Rent GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC), M. arenaria (Fare/Rare TCGGCGATAGAGGTAAATGAC/TCGGCGATAGACACTACAACT), M. hapla (Fhap/Rhap TGACGGCGGTGAGTGCGA/TGACGGCGGTACCTCATAG) and M. chitwoodi (Fchi/Rchi TGGAGAGCAGCAGGAGAAAGA/GGTCTGAGTGAGGACAAGAGTA) were utilized for species identification (Mao et al., 2019). PCR products of J2 amplification were run in the agar gel (Fig. S2B). A PCR product of 750 bp was obtained for 194/195 primer pair and a 420 bp band was identified for M. arenaria for all tested J2 samples. There were no bands for other specific primers. The amplicons from 194/195 and M. arenaria primer pairs were sequenced. A 100% identity of the Fare/Rare sequence (MZ522722.1) with M. arenaria KP234264.1 and a 99.8% identity with M. arenaria MW315990.1 were found through NCBI blast. A 100% identity of the 194/195 sequence (MZ555753.1) with both M. arenaria GQ395518.1 and U42342.1 and M. thailandica HF568829.1. To confirm the pathogenicity, 2000 J2s obtained from the same population as described above were used to inoculate each plant of one-month old 'Baiwei' seedlings (n = 5) and of one-month-old tomato cv. 'Zhongshu4' seedlings (n = 5) growing in 15-cm-diameter and 10-cm-height plastic pot containing sand and soil (2:1 ratio) in the glasshouse at 22-28℃ and 16/8 h day/night. Plants without J2s were used as control. Sixty days later, roots were stained with erioglaucine (Omwega et al. 1988) and an average of 107 ± SE 59 and 276 ± SE 31 egg masses per gram root were produced in each infected 'Baiwei' (Fig. S3A) and tomato (Fig. S3B) root, respectively. PCR amplification of the hatched J2s reconfirmed the reproduced nematode in 'Baiwei' and tomato was M. arenaria. This is the first report on M. arenaria parasitizing the medicinal herb C. versicolor in China.

14.
Health Sci Rep ; 5(3): e572, 2022 May.
Artigo em Inglês | MEDLINE | ID: mdl-35509410

RESUMO

Background: We compared the temporal changes of immunoglobulin M (IgM), IgG, and IgA antibodies against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) nucleoprotein (N), spike 1 subunit (S1), and receptor-binding domain (RBD), and neutralizing antibodies (NAbs) against SARS-CoV-2 in patients with coronavirus disease 2019 (COVID-19) to understand the humoral immunity in COVID-19 patients for developing drugs and vaccines for COVID-19. Methods: A total of five confirmed COVID-19 cases in Nissan Tamagawa Hospital in early August 2020 were recruited in this study. Using a fully automated chemiluminescence immunoassay analyzer, we measured the levels of IgG, IgA, and IgM against SARS-CoV-2 N, S1, and RBD and NAbs against SARS-CoV-2 in COVID-19 patients' sera acquired multiple times in individuals from 0 to 76 days after symptom onset. Results: IgG levels against SARS-CoV-2 structural proteins increased over time in all cases but IgM and IgA levels against SARS-CoV-2 showed different increasing trends among individuals in the early stage. In particular, we observed IgA increasing before IgG and IgM in some cases. The NAb levels were more than cut-off value in 4/5 COVID-19 patients some of whose antibodies against RBD did not exceed the cut-off value in the early stage. Furthermore, NAb levels against SARS-CoV-2 increased and kept above cut-off value more than around 70 days after symptom onset in all cases. Conclusion: Our findings indicate COVID-19 patients should be examined for IgG, IgA, and IgM against SARS-CoV-2 structural proteins and NAbs against SARS-CoV-2 to analyze the diversity of patients' immune mechanisms.

15.
J Ginseng Res ; 46(3): 418-425, 2022 May.
Artigo em Inglês | MEDLINE | ID: mdl-35600776

RESUMO

Background: Sorafenib is effective in treating hepatoma, but most patients develop resistance to it. STAT3 signaling has been implicated in sorafenib resistance. Artesunate (ART) and 20(R)-ginsenoside Rg3 (Rg3) have anti-hepatoma effects and can inhibit STAT3 signaling in cancer cells. This study aimed to evaluate the effects of Rg3 in combination with ART (Rg3-plus-ART) in overcoming sorafenib resistance, and to examine the involvement of STAT3 signaling in these effects. Methods: Sorafenib-resistant HepG2 cells (HepG2-SR) were used to evaluate the in vitro anti-hepatoma effects of Rg3-plus-ART. A HepG2-SR hepatoma-bearing BALB/c-nu/nu mouse model was used to assess the in vivo anti-hepatoma effects of Rg3-plus-ART. CCK-8 assays and Annexin V-FITC/PI double staining were used to examine cell proliferation and apoptosis, respectively. Immunoblotting was employed to examine protein levels. ROS generation was examined by measuring DCF-DA fluorescence. Results: Rg3-plus-ART synergistically reduced viability of, and evoked apoptosis in HepG2-SR cells, and suppressed HepG2-SR tumor growth in mice. Mechanistic studies revealed that Rg3-plus-ART inhibited activation/phosphorylation of Src and STAT3 in HepG2-SR cultures and tumors. The combination also decreased the STAT3 nuclear level and induced ROS production in HepG2-SR cultures. Furthermore, over-activation of STAT3 or removal of ROS diminished the anti-proliferative effects of Rg3-plus-ART, and removal of ROS diminished Rg3-plus-ART's inhibitory effects on STAT3 activation in HepG2-SR cells. Conclusions: Rg3-plus-ART overcomes sorafenib resistance in experimental models, and inhibition of Src/STAT3 signaling and modulation of ROS/STAT3 signaling contribute to the underlying mechanisms. This study provides a pharmacological basis for developing Rg3-plus-ART into a novel modality for treating sorafenib-resistant hepatoma.

16.
Plant Physiol ; 2022 May 28.
Artigo em Inglês | MEDLINE | ID: mdl-35640107

RESUMO

Pre-mRNA splicing is an important step in the post-transcriptional processing of transcripts and a key regulator of development. The heterotrimeric retention and splicing (RES) complex plays vital roles in the growth and development of yeast, zebrafish, and humans by mediating pre-mRNA splicing of multiple genes. However, whether the RES complex is conserved in plants and what specific functions it has remain unknown. In this study, we identified Arabidopsis (Arabidopsis thaliana) BUD13 (AtBUD13), GROWTH, DEVELOPMENT AND SPLICING 1 (GDS1), and DAWDLE (DDL) as the counterparts of the yeast RES complex subunits Bud site selection protein 13 (Bud13), U2 snRNP component Snu17 (Snu17), and Pre-mRNA leakage protein 1 (Pml1), respectively. Moreover, we showed that RES is an ancient complex evolutionarily conserved in eukaryotes. GDS1 directly interacts with both AtBUD13 and DDL in nuclear speckles. The BUD13 domain of AtBUD13 and the RRM domain of GDS1 are necessary and sufficient for AtBUD13-GDS1 interaction. Mutants of AtBUD13, GDS1, and DDL failed to properly splice multiple genes involved in cell proliferation and showed defects in early embryogenesis and root development. In addition, we found that GDS1 and DDL interact, respectively, with the U2 small nuclear ribonucleoproteins (snRNP) auxiliary factor AtU2AF65B and the NineTeen Complex-related splicing factor SKIP, which are essential for early steps of spliceosome assembly and recognition of splice sites. Altogether, our work reveals that the Arabidopsis RES complex is important for root and early embryo development by modulating pre-mRNA splicing.

17.
J Am Soc Mass Spectrom ; 33(6): 917-931, 2022 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-35500907

RESUMO

Fast and accurate identifications of pathogenic bacteria along with their associated antibiotic resistance proteins are of paramount importance for patient treatments and public health. To meet this goal from the mass spectrometry aspect, we have augmented the previously published Microorganism Classification and Identification (MiCId) workflow for this capability. To evaluate the performance of this augmented workflow, we have used MS/MS datafiles from samples of 10 antibiotic resistance bacterial strains belonging to three different species: Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa. The evaluation shows that MiCId's workflow has a sensitivity value around 85% (with a lower bound at about 72%) and a precision greater than 95% in identifying antibiotic resistance proteins. In addition to having high sensitivity and precision, MiCId's workflow is fast and portable, making it a valuable tool for rapid identifications of bacteria as well as detection of their antibiotic resistance proteins. It performs microorganismal identifications, protein identifications, sample biomass estimates, and antibiotic resistance protein identifications in 6-17 min per MS/MS sample using computing resources that are available in most desktop and laptop computers. We have also demonstrated other use of MiCId's workflow. Using MS/MS data sets from samples of two bacterial clonal isolates, one being antibiotic-sensitive while the other being multidrug-resistant, we applied MiCId's workflow to investigate possible mechanisms of antibiotic resistance in these pathogenic bacteria; the results showed that MiCId's conclusions agree with the published study. The new version of MiCId (v.07.01.2021) is freely available for download at https://www.ncbi.nlm.nih.gov/CBBresearch/Yu/downloads.html.


Assuntos
Proteômica , Espectrometria de Massas em Tandem , Antibacterianos/farmacologia , Bactérias/química , Farmacorresistência Bacteriana , Resistência Microbiana a Medicamentos , Escherichia coli , Humanos , Proteômica/métodos , Pseudomonas aeruginosa , Espectrometria de Massas em Tandem/métodos , Fluxo de Trabalho
18.
Org Lett ; 24(18): 3378-3383, 2022 May 13.
Artigo em Inglês | MEDLINE | ID: mdl-35499470

RESUMO

An efficient methodology to access various fluoroalkyl sulfoxides bearing ortho/para-functionalized amine scaffolds from arylhydroxylamines is described. The transformation was featured with new electrophilic trifluoromethylthiolated reagents, good functional group tolerance, and late-stage modification of complex bioactive scaffolds, providing a rapid access to prepare numerous trifluoromethyl- and difluoromethyl-substituted sulfoxides. Mechanism studies and density functional theory calculations suggest this reaction goes through a nucleophilic trifluoromethylthiolation of arylhydroxylamine and subsequent internal 2,3-sigmatropic rearrangement involving a sulfur and oxygen transfer process.

19.
Front Genet ; 13: 849941, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35559038

RESUMO

Circular RNA (circRNA), which is a newly discovered non-coding RNA, has been documented to play important roles in miRNA sponges, and the dysregulation of which is involved in cancer development. However, circRNA expression profiles and their role in initiation and progression of Wilms tumor (WT) remain largely unclear at present. Here, we used paired WT samples and high-throughput RNA sequencing to identify differentially expressed circRNAs (DE-circRs) and mRNAs (DE-mRs). A total of 314 DE-circRs and 1612 DE-mRs were identified. The expression of a subset of differentially expressed genes was validated by qRT-PCR. A complete circRNA-miRNA-mRNA network was then constructed based on the common miRNA targets of DE-circRs and DE-mRs identified by miRanda prediction tool. The Gene set enrichment analysis (GSEA) indicated that several signaling pathways involving targeted DE-mRs within the ceRNA network were associated with cell cycle and immune response, which implies their participation in WT development to some extent. Subsequently, these targeted DE-mRs were subjected to implement PPI analysis and to identify 10 hub genes. Four hub genes were closely related to the survival of WT patients. We then filtered prognosis-related hub genes by Cox regression and least absolute shrinkage and selection operator (LASSO) regression analysis to construct a prognosis-related risk score system based on a three-gene signature, which showed good discrimination and predictive ability for WT patient survival. Additionally, we analyzed the mutational landscape of these genes and the associations between their expression levels and those of immune checkpoint molecules and further demonstrated their potential impact on the efficacy of immunotherapy. qRT-PCR and western blotting (WB) analysis were used to validate key differentially expressed molecules at the RNA and protein levels, respectively. Besides these, we selected a key circRNA, circEYA1, for function validation. Overall, the current study presents the full-scale expression profiles of circRNAs and the circRNA-related ceRNA network in WT for the first time, deepening our understanding of the roles and downstream regulatory mechanisms of circRNAs in WT development and progression. We further constructed a useful immune-related prognostic signature, which could improve clinical outcome prediction and guide individualized treatment.

20.
Hortic Res ; 9: uhac023, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-35531313

RESUMO

Non-conventional peptides (NCPs), which are peptides derived from previously unannotated coding sequences, play important biological roles in plants. In this study, we used peptidogenomic methods that integrated mass spectrometry (MS) peptidomics and a six-frame translation database to extensively identify NCPs in grape. In total, 188 and 2021 non-redundant peptides from the Arabidopsis thaliana and Vitis vinifera L. protein database at Ensembl/URGI and an individualized peptidogenomic database were identified. Unlike conventional peptides, these NCPs derived mainly from intergenic, intronic, upstream ORF, 5'UTR, 3'UTR, and downstream ORF regions. These results show that unannotated regions are translated more broadly than we thought. We also found that most NCPs were derived from regions related to phenotypic variations, LTR retrotransposons, and domestication selection, indicating that the NCPs have an important function in complex biological processes. We also found that the NCPs were developmentally specific and had transient and specific functions in grape berry development. In summary, our study is the first to extensively identify NCPs in grape. It demonstrated that there was a large amount of translation in the genome. These results lay a foundation for studying the functions of NCPs and also provide a reference for the discovery of new functional genes in grape.

SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...