Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 3.062
Filtrar
1.
Medicine (Baltimore) ; 98(28): e16389, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31305444

RESUMO

INTRODUCTION: Various phenotypes have been identified for MYH7 gene mutation-related myopathy. Here, we describe a patient with severe muscular weakness and skeletal deformity with de novo heterozygous MYH7 gene mutation. PATIENT CONCERNS: A 33-year-old woman presented with early onset of muscular weakness, with delayed motor development during infancy. At age 8 years, she was unable to walk, with signs of skeletal deformity, including the progression of kyphoscoliosis. At age 31 years, she developed dyspnea. DIAGNOSIS: She diagnosed with esophageal hiatal hernia with abdominal CT. In electromyography, short duration, small amplitude motor unit action potential (MUAP), and early recruitment patterns were observed in the involved proximal muscles, suggesting myopathy. Muscle histopathology showed fiber-type disproportion. INTERVENTIONS: Next-generation sequencing study revealed a heterozygous in-frame deletion variation in the exon 14 of the MYH7 gene (c.1498_1500del/p.Glu500del), which is a novel variation confirmed by conventional Sanger sequencing. Compared with the parental test, this variant was concluded as de novo. OUTCOMES: She received laparoscopic hiatal hernia repair and Nissen fundoplication for esophageal hiatal hernia. After surgery, her postural dyspnea improved. As there is no fundamental treatment for MYH7-related myopathies, she continued conservative treatment for her symptoms. CONCLUSION: Here, we presented a rare case of de novo mutation of the myosin head domain in the MYH7 gene. This report broadens both the phenotypic and genotypic spectra of MYH7-related myopathies.


Assuntos
Miosinas Cardíacas/genética , Cifose/genética , Debilidade Muscular/genética , Mutação , Cadeias Pesadas de Miosina/genética , Escoliose/genética , Adulto , Idade de Início , Dispneia/etiologia , Dispneia/genética , Dispneia/cirurgia , Feminino , Humanos , Cifose/fisiopatologia , Debilidade Muscular/patologia , Debilidade Muscular/fisiopatologia , Fenótipo , Escoliose/fisiopatologia
2.
J Toxicol Sci ; 44(7): 505-513, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31270306

RESUMO

Dioxins are a group of structurally related chemicals that persist in the environment. Exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD), the most toxic congener, is a suspected risk factor for cardiac diseases in humans. TCDD induces signs of cardiotoxicity in various animals. Mouse models of TCDD exposure suggest cardiotoxicity phenotypes develop differently depending on the timing and time-course of exposure. In order to clarify and characterize the TCDD-induced cardiotoxicity in the developing period, we utilized mouse pups exposed to TCDD. One day after delivery, groups of nursing C57BL/6J dams were orally administered TCDD at a dose of 0 (Control), 20 (TCDD-20), or 80 µg/kg (TCDD-80) body weight (BW). On postnatal days (PNDs) 7 and 21, pups' hearts were examined by histological and gene expression analyses. The TCDD-80 group was found to have a left ventricular remodeling on PND 7, and to develop heart hypertrophy on PND 21. It was accompanied by fibrosis and increased expression of associated genes, such as those for atrial natriuretic peptide (ANP), ß-myosin heavy chain (ß-MHC), and endothelin-1 (ET-1). These results revealed that TCDD directly induces cardiotoxicity in the postnatal period represented by progressive hypertrophy in which ANP, ß-MHC, and ET-1 have potentials to mediate the cardiac hypertrophy and heart failure.


Assuntos
Cardiomegalia/induzido quimicamente , Cardiomegalia/genética , Cardiotoxicidade , Poluentes Ambientais/metabolismo , Poluentes Ambientais/toxicidade , Insuficiência Cardíaca/induzido quimicamente , Insuficiência Cardíaca/genética , Lactação/metabolismo , Dibenzodioxinas Policloradas/metabolismo , Dibenzodioxinas Policloradas/toxicidade , Administração Oral , Animais , Animais Recém-Nascidos , Fator Natriurético Atrial/genética , Fator Natriurético Atrial/metabolismo , Endotelina-1/genética , Endotelina-1/metabolismo , Poluentes Ambientais/administração & dosagem , Feminino , Expressão Gênica/efeitos dos fármacos , Humanos , Camundongos Endogâmicos C57BL , Modelos Animais , Cadeias Pesadas de Miosina/genética , Cadeias Pesadas de Miosina/metabolismo , Dibenzodioxinas Policloradas/administração & dosagem , Gravidez
3.
Nat Commun ; 10(1): 2685, 2019 06 18.
Artigo em Inglês | MEDLINE | ID: mdl-31213605

RESUMO

Hypertrophic cardiomyopathy (HCM) affects 1 in 500 people and leads to hyper-contractility of the heart. Nearly 40 percent of HCM-causing mutations are found in human ß-cardiac myosin. Previous studies looking at the effect of HCM mutations on the force, velocity and ATPase activity of the catalytic domain of human ß-cardiac myosin have not shown clear trends leading to hypercontractility at the molecular scale. Here we present functional data showing that four separate HCM mutations located at the myosin head-tail (R249Q, H251N) and head-head (D382Y, R719W) interfaces of a folded-back sequestered state referred to as the interacting heads motif (IHM) lead to a significant increase in the number of heads functionally accessible for interaction with actin. These results provide evidence that HCM mutations can modulate myosin activity by disrupting intramolecular interactions within the proposed sequestered state, which could lead to hypercontractility at the molecular level.


Assuntos
Miosinas Cardíacas/metabolismo , Cardiomiopatia Hipertrófica/genética , Cardiomiopatia Hipertrófica/fisiopatologia , Contração Miocárdica/genética , Cadeias Pesadas de Miosina/metabolismo , Actinas/metabolismo , Animais , Miosinas Cardíacas/genética , Linhagem Celular , Movimento Celular/genética , Coração/fisiopatologia , Humanos , Camundongos , Mutação , Mioblastos , Cadeias Pesadas de Miosina/genética , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo
4.
J Anim Sci ; 97(8): 3180-3192, 2019 Jul 30.
Artigo em Inglês | MEDLINE | ID: mdl-31228349

RESUMO

The present study aimed to investigate the influence of dietary butyrate supplementation on muscle fiber-type composition and mitochondrial biogenesis of finishing pigs, and the underlying mechanisms. Thirty-two LY (Landrace × Yorkshire) growing pigs with BW of 64.9 ± 5.7 kg were randomly allotted to either control (basal diet) or butyrate diets (0.3% butyrate sodium). Compared with the control group, diet supplemented with butyrate tended to increase average daily gain (P < 0.10). Pigs fed butyrate diet had higher intramuscular fat content, marbling score and pH24 h, and lower shear force and L*24 h in longissimus thoracis (LT) muscle than that fed control diet (P < 0.05). Interestingly, supplemented with butyrate increased (P < 0.05) the mRNA level of myosin heavy chain I (MyHC-I) and the percentage of slow-fibers, and decreased (P < 0.05) the mRNA level of MyHC-IIb in LT muscle. Meanwhile, pigs in butyrate group had an increase in mitochondrial DNA (mtDNA) copy number and the mRNA levels of mtDNA-encoded genes (P < 0.05). Moreover, feeding butyrate diet increased PGC-1α (PPAR γ coactivator 1α) level, decreased miR-133a-3p level and increased its target gene level (TEAD1, TEA domain transcription factor 1), increased miR-208b and miR-499-5p levels and decreased their target genes levels (Sp3 and Sox6, specificity protein 3 and SRY-box containing gene 6; P < 0.05) in the LT muscle. Collectively, these findings suggested that butyrate promoted slow-twitch myofiber formation and mitochondrial biogenesis, and the molecular mechanism may be via upgrading specific microRNAs and PGC-1α expression, finally improving meat quality.


Assuntos
Butiratos/administração & dosagem , Suplementos Nutricionais/análise , Regulação da Expressão Gênica/genética , MicroRNAs/genética , Coativador 1-alfa do Receptor gama Ativado por Proliferador de Peroxissomo/genética , Suínos/fisiologia , Animais , Dieta/veterinária , Feminino , Fibras Musculares de Contração Lenta/efeitos dos fármacos , Cadeias Pesadas de Miosina/efeitos dos fármacos , Cadeias Pesadas de Miosina/genética , Biogênese de Organelas , RNA Mensageiro/genética , RNA Mitocondrial/genética , Distribuição Aleatória , Suínos/genética
5.
PLoS Genet ; 15(6): e1008228, 2019 06.
Artigo em Inglês | MEDLINE | ID: mdl-31220078

RESUMO

Dendrite growth is constrained by a self-avoidance response that induces retraction but the downstream pathways that balance these opposing mechanisms are unknown. We have proposed that the diffusible cue UNC-6(Netrin) is captured by UNC-40(DCC) for a short-range interaction with UNC-5 to trigger self-avoidance in the C. elegans PVD neuron. Here we report that the actin-polymerizing proteins UNC-34(Ena/VASP), WSP-1(WASP), UNC-73(Trio), MIG-10(Lamellipodin) and the Arp2/3 complex effect dendrite retraction in the self-avoidance response mediated by UNC-6(Netrin). The paradoxical idea that actin polymerization results in shorter rather than longer dendrites is explained by our finding that NMY-1 (non-muscle myosin II) is necessary for retraction and could therefore mediate this effect in a contractile mechanism. Our results also show that dendrite length is determined by the antagonistic effects on the actin cytoskeleton of separate sets of effectors for retraction mediated by UNC-6(Netrin) versus outgrowth promoted by the DMA-1 receptor. Thus, our findings suggest that the dendrite length depends on an intrinsic mechanism that balances distinct modes of actin assembly for growth versus retraction.


Assuntos
Actinas/genética , Proteínas de Caenorhabditis elegans/genética , Células Dendríticas/metabolismo , Netrinas/genética , Neurônios/metabolismo , Citoesqueleto de Actina/genética , Complexo 2-3 de Proteínas Relacionadas à Actina/genética , Actinas/metabolismo , Animais , Caenorhabditis elegans/genética , Caenorhabditis elegans/crescimento & desenvolvimento , Proteínas de Membrana/genética , Cadeias Pesadas de Miosina/genética , Proteínas do Tecido Nervoso/genética , Miosina não Muscular Tipo IIB/genética
6.
Anim Sci J ; 90(8): 1042-1049, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31237073

RESUMO

Glycogen synthase kinase beta (GSK3ß) plays an important role in skeletal muscle growth, regeneration, and repair. However, the mechanism of GSK3ß regulating MyHC2a expression is currently not clear. In this study, GSK3ß inhibition promoted skeletal muscle satellite cells (SMSCs) differentiation and increased expression of MyoD, MyoG, MyHC1, and MyHC2a genes. Then we cloned approximately 1.1 kb of goat MyHC2a gene promoter. The deletion fragment (-514/+55) of MyHC2a promoter exhibited the highest level of promoter activity, and a NFATc2 element in this region was responsible for MyHC2a promoter activity. Treatment of SB216713 significantly decreased the transcriptional activity of the fragment (-514/+55). Furthermore, GSK3ß inhibition had no effect on the luciferase activity of MyHC2a promoter after mutating the NFATc2-binding site. These results demonstrated that GSK3ß inhibition promoted SMSCs differentiation and regulated the MyHC2a gene expression through NFATc2 in goat-differentiated SMSCs.


Assuntos
Regulação da Expressão Gênica no Desenvolvimento/genética , Expressão Gênica/genética , Glicogênio Sintase Quinase 3 beta/antagonistas & inibidores , Glicogênio Sintase Quinase 3 beta/fisiologia , Músculo Esquelético/citologia , Cadeias Pesadas de Miosina/genética , Cadeias Pesadas de Miosina/metabolismo , Células Satélites de Músculo Esquelético/metabolismo , Animais , Diferenciação Celular/genética , Células Cultivadas , Feminino , Cabras , Luciferases/metabolismo , Fatores de Transcrição NFATC
7.
BMC Med Genet ; 20(1): 78, 2019 05 08.
Artigo em Inglês | MEDLINE | ID: mdl-31068177

RESUMO

BACKGROUND: Few manuscripts have reported phenotypes of skeletal muscle myopathies caused by mutations in the head region of slow/cardiac beta-myosin heavy chain (MyHCI). Among the patients, some of them showed the phenotype of skeletal muscle weakness with the obvious clinical features of cardiomyopathy while others showed pure skeletal muscle weakness with no symptoms of cardiac involvement. Genotype-phenotype relationship regarding the effect of a mutation on MyHCI is complex. Questions regarding why some mutations cause cardiomyopathy or skeletal muscle disorders alone or a combination of both still need to be answered. More findings in genetic variation are needed to extend knowledge of mutations in the MYH7 gene linked to skeletal muscle disorders. CASE PRESENTATION: Here we present a female adult patient with a phenotype of childhood onset of muscular disorders and predominant involvement of thigh muscles with biopsy showing intrasarcoplasmic inclusion bodies. Whole exome sequencing showed that variant c.1370 T > G (p.Ile457Arg) in the MYH7 gene is a missense mutation possibly linked to the clinical findings. Our patient likely shows an uncharacteristic myosin storage myopathy associated with respiratory and cardiac involvement linked to a missense mutation in the head of MyHCI. CONCLUSIONS: Given this mutation is located within the motor domain of MyHCI, this might affect the regulation of myosin mechano-chemical activity during the contractile cycle. Consequently, this potentially damaging effect can be easily amplified within the network of ~ 300-myosin molecules forming the thick filament and therefore become cumulatively deleterious, affecting, in turn, the overall organization and performance of sarcomere.


Assuntos
Miosinas Cardíacas/genética , Doenças Musculares/congênito , Mutação de Sentido Incorreto , Cadeias Pesadas de Miosina/genética , Adulto , Criança , Feminino , Humanos , Pessoa de Meia-Idade , Doenças Musculares/genética , Fenótipo
8.
MBio ; 10(3)2019 05 07.
Artigo em Inglês | MEDLINE | ID: mdl-31064828

RESUMO

Viral infections induce proinflammatory signaling cascades and inflammatory cytokine production, which is precisely regulated for host benefits. In the current study, we unravel a previously unappreciated role of nonmuscle myosin heavy chain IIA (NMHC-IIA) as a negative regulator in inflammatory responses. We identified that cell surface NMHC-IIA recognized sialic acids on sialylated RNA viruses during early infections and interacted with an immune adaptor DNAX activation protein of 12 kDa (DAP12) to recruit downstream spleen tyrosine kinase (Syk), leading to suppressed virus-triggered proinflammatory responses. More importantly, recognition of sialylated RNA viruses or sialic acid mimics by NMHC-IIA was shown to inhibit lipopolysaccharide (LPS)-induced proinflammatory responses via the DAP12-Syk pathway. These findings uncover a novel negative regulation mechanism of proinflammatory responses and provide a molecular basis to design anti-inflammatory drugs.IMPORTANCE NMHC-IIA, a subunit of nonmuscle myosin IIA (NM-IIA), takes part in diverse physiological processes, including cell movement, cell shape maintenance, and signal transduction. Recently, NMHC-IIA has been demonstrated to be a receptor or factor contributing to viral infections. Here, we identified that NMHC-IIA recognizes sialic acids on sialylated RNA viruses, vesicular stomatitis virus (VSV) and porcine reproductive and respiratory syndrome virus (PRRSV). Upon recognition, NMHC-IIA associates with the transmembrane region of DAP12 to recruit Syk. Activation of the DAP12-Syk pathway impairs the host antiviral proinflammatory cytokine production and signaling cascades. More importantly, sialic acid mimics and sialylated RNA viruses enable the antagonism of LPS-triggered proinflammatory responses through engaging the NMHC-IIA-DAP12-Syk pathway. These results actually support that NMHC-IIA is involved in negative modulation of the host innate immune system, which provides a molecular basis for prevention and control of the sialylated RNA viruses and treatment of inflammatory diseases.


Assuntos
Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Cadeias Pesadas de Miosina/metabolismo , Vírus de RNA/metabolismo , Ácidos Siálicos/metabolismo , Transdução de Sinais , Quinase Syk/metabolismo , Proteínas Adaptadoras de Transdução de Sinal/genética , Animais , Proteínas do Citoesqueleto/metabolismo , Técnicas de Silenciamento de Genes , Células HEK293 , Humanos , Imunidade Inata , Camundongos , Cadeias Pesadas de Miosina/genética , Células RAW 264.7 , Suínos , Quinase Syk/genética
9.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 36(4): 352-356, 2019 Apr 10.
Artigo em Chinês | MEDLINE | ID: mdl-30950024

RESUMO

OBJECTIVE: To identify the mutation type of non-muscle myosin heavy chain 9 (MYH9) gene and investigate the clinical features of a pedigree affected with MYH9 gene-related disease. METHODS: Peripheral blood samples of the proband and his family members were collected. Routine blood tests were performed, which included platelet counting and Wright's staining to observe the granulocyte inclusions and giant platelets. PCR was used to amplify exons 2, 17, 27, 31, 39 and 41 of the MYH9 gene, and the mutation site was determined by Sanger sequencing. RESULTS: All patients from the pedigree presented a typical triad of thrombocytopenia, giant platelets, and inclusion bodies in leukocytes. In addition, two patients had nephritis and cataract. All affected members carried a heterozygous missense mutation of c.5521G>A (p.glu1841Lys) in exon 39 of the MYH9 gene. The same mutation was not found among healthy members of the pedigree and the controls. CONCLUSION: The c.5521G>A (p.Glu1841Lys) mutation in the MYH9 gene probably underlies the MYH9-related disease in this pedigree.


Assuntos
Proteínas Motores Moleculares/genética , Cadeias Pesadas de Miosina/genética , Trombocitopenia , Feminino , Testes Genéticos , Humanos , Masculino , Mutação , Linhagem
10.
Zhonghua Er Ke Za Zhi ; 57(4): 286-290, 2019 Apr 02.
Artigo em Chinês | MEDLINE | ID: mdl-30934202

RESUMO

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.


Assuntos
Perda Auditiva Neurossensorial/genética , Proteínas Motores Moleculares/genética , Cadeias Pesadas de Miosina/genética , Irmãos , Trombocitopenia/congênito , Criança , Feminino , Variação Genética , Humanos , Masculino , Estudos Retrospectivos , Trombocitopenia/genética
11.
Appl Biochem Biotechnol ; 189(2): 396-410, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31025171

RESUMO

Although embryonic stem (ES) cells (ESCs) may be a promising donor source for the repair of infarcted or ischemic heart tissues, their successful application in regenerative medicine has been hampered by difficulties in enriching, identifying, and selecting cardiomyocytes from the differentiating cells. We established transgenic human ES cell lines by transcriptional control of the α-cardiac myosin heavy chain (α-MHC) promoter driving green fluorescent protein (GFP) expression. Differentiated GFP-expressing cells display the characteristics of cardiomyocytes (CMs). Apela, a recently identified short peptide, up-regulated the expression of the cardiac-restricted transcription factors Tbx5 and GATA4 as well as differentiated the cardiomyocyte markers α-MHC and ß-MHC. Flow cytometric analysis showed that apela increased the percentage of GFP-expressing cells in the beating foci of the embryoid bodies. The percentage of cardiac troponin T (TNT)-positive cells and the protein expression of TNT were increased in the ES cell-derived CMs with apela treatment. Functionally, the contractile frequency of the ES-derived CMs responded appropriately to the vasoactive drugs isoprenaline and carbachol. Our work presented a protocol for specially labelling and enriching CMs by combining transgenic human ES cell lines and exogenous growth factor treatment.


Assuntos
Diferenciação Celular , Células-Tronco Embrionárias Humanas/metabolismo , Miócitos Cardíacos/metabolismo , Hormônios Peptídicos/metabolismo , Miosinas Cardíacas/genética , Miosinas Cardíacas/metabolismo , Linhagem Celular , Fator de Transcrição GATA4/genética , Fator de Transcrição GATA4/metabolismo , Células-Tronco Embrionárias Humanas/citologia , Humanos , Miócitos Cardíacos/citologia , Cadeias Pesadas de Miosina/genética , Cadeias Pesadas de Miosina/metabolismo , Hormônios Peptídicos/genética , Proteínas com Domínio T/genética , Proteínas com Domínio T/metabolismo , Troponina T/metabolismo , Regulação para Cima , Miosinas Ventriculares/genética , Miosinas Ventriculares/metabolismo
13.
Biomed Res Int ; 2019: 3805405, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-30906771

RESUMO

Background: The Myosin Heavy Chain 15 gene (MYH15) is expressed in the airway epithelium and variants in the gene have been associated with airway responsiveness. The aim of this study was to perform the first investigation of MYH15 polymorphisms in relation to asthma susceptibility. Methods: A total of 410 asthma patients and 418 controls from the Chinese Han population were enrolled in the study. Tag-single nucleotide polymorphisms were genotyped and associations between the polymorphisms and asthma risk were analyzed by logistic regression analysis adjusting for confounding factors. Dual-luciferase reporter gene analysis was performed to detect allele-dependent promoter activity of MYH15 variants in HEK293 cells. Results: The A allele of rs9288876 decreased risk of asthma (allelic model: OR=0.808, 95% CI: 0.658-0.993, additive model: OR=0.747, 95% CI: 0.588-0.947, dominant model: OR=0.693, 95% CI: 0.502-0.955). The G alleles of both rs7635009 and rs1454197 were associated with decreased risk of asthma under the additive model (OR=0.779, 95% CI: 0.618-0.981 and OR=0.756, 95% CI: 0.600-0.953, respectively). rs9288876 allele A was associated with higher luciferase activity than allele T (P<0.001). The luciferase activity of rs7635009 allele A was lower than allele G (P=0.001), while rs1454197 allele T had lower luciferase activity than allele G (P<0.001). Conclusion: This is the first study to report the association of MYH15 gene polymorphisms with asthma. Polymorphisms of rs9288876, rs7635009, and rs1454197 altered transcriptional regulation of MYH15 and may be functional variants conferring susceptibility to asthma. Further study with larger sample size in different ethnic populations is needed.


Assuntos
Asma/genética , Estudos de Associação Genética , Predisposição Genética para Doença , Cadeias Pesadas de Miosina/genética , Adulto , Alelos , Grupo com Ancestrais do Continente Asiático , Asma/fisiopatologia , Feminino , Genótipo , Células HEK293 , Humanos , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética , Regiões Promotoras Genéticas/genética
14.
Skelet Muscle ; 9(1): 7, 2019 03 05.
Artigo em Inglês | MEDLINE | ID: mdl-30836986

RESUMO

Striated muscles express an array of sarcomeric myosin motors that are tuned to accomplish specific tasks. Each myosin isoform found in muscle fibers confers unique contractile properties to the fiber in order to meet the demands of the muscle. The sarcomeric myosin heavy chain (MYH) genes expressed in the major cardiac and skeletal muscles have been studied for decades. However, three ancient myosins, MYH7b, MYH15, and MYH16, remained uncharacterized due to their unique expression patterns in common mammalian model organisms and due to their relatively recent discovery in these genomes. This article reviews the literature surrounding these three ancient sarcomeric myosins and the specialized muscles in which they are expressed. Further study of these ancient myosins and how they contribute to the functions of the specialized muscles may provide novel insight into the history of striated muscle evolution.


Assuntos
Músculo Esquelético/metabolismo , Miócitos Cardíacos/metabolismo , Cadeias Pesadas de Miosina/metabolismo , Animais , Evolução Molecular , Humanos , Músculo Esquelético/ultraestrutura , Cadeias Pesadas de Miosina/genética , Isoformas de Proteínas/genética , Isoformas de Proteínas/metabolismo
16.
Molecules ; 24(6)2019 Mar 26.
Artigo em Inglês | MEDLINE | ID: mdl-30917606

RESUMO

The genetic modification of the mouse genome using the cre-lox system has been an invaluable tool in deciphering gene and protein function in a temporal and/or spatial manner. However, it has its pitfalls, as researchers have shown that the unregulated expression of cre recombinase can cause DNA damage, the consequences of which can be very detrimental to mouse health. Previously published literature on the most utilized cardiac-specific cre, αMHC-cre, mouse model exhibited a nonlethal hypertrophic cardiomyopathy (HCM) with aging. However, using the same αMHC-cre mice, we observed a cardiac pathology, resulting in complete lethality by 11 months of age. Echocardiography and histology revealed that the αMHC-cre mice were displaying symptoms of dilated cardiomyopathy (DCM) by seven months of age, which ultimately led to their demise in the absence of any HCM at any age. Molecular analysis showed that this phenotype was associated with the DNA damage response through the downregulation of activated p38 and increased expression of JNK, p53, and Bax, known inducers of myocyte death resulting in fibrosis. Our data urges strong caution when interpreting the phenotypic impact of gene responses using αMHC-cre mice, since a lethal DCM was induced by the cre driver in an age-dependent manner in this commonly utilized model system.


Assuntos
Envelhecimento/genética , Cardiomiopatia Dilatada/diagnóstico por imagem , Integrases/metabolismo , Cadeias Pesadas de Miosina/genética , Envelhecimento/metabolismo , Animais , Cardiomiopatia Dilatada/genética , Cardiomiopatia Dilatada/metabolismo , Dano ao DNA , Modelos Animais de Doenças , Ecocardiografia , Regulação da Expressão Gênica , Genes Letais , Integrases/genética , Camundongos , Cadeias Pesadas de Miosina/metabolismo , Fenótipo
17.
J Biol Chem ; 294(15): 5896-5906, 2019 04 12.
Artigo em Inglês | MEDLINE | ID: mdl-30804213

RESUMO

Class V myosins are actin-dependent motors, which recognize numerous cellular cargos mainly via the C-terminal globular tail domain (GTD). Myo2, a yeast class V myosin, can transport a broad range of organelles. However, little is known about the capacity of Myo2-GTD to recognize such a diverse array of cargos specifically at the molecular level. Here, we solved crystal structures of Myo2-GTD (at 1.9-3.1 Å resolutions) in complex with three cargo adaptor proteins: Smy1 (for polarization of secretory vesicles), Inp2 (for peroxisome transport), and Mmr1 (for mitochondria transport). The structures of Smy1- and Inp2-bound Myo2-GTD, along with site-directed mutagenesis experiments, revealed a binding site in subdomain-I having a hydrophobic groove with high flexibility enabling Myo2-GTD to accommodate different protein sequences. The Myo2-GTD-Mmr1 complex structure confirmed and complemented a previously identified mitochondrion/vacuole-specific binding region. Moreover, differences between the conformations and locations of cargo-binding sites identified here for Myo2 and those reported for mammalian MyoVA (MyoVA) suggest that class V myosins potentially have co-evolved with their specific cargos. Our structural and biochemical analysis not only uncovers a molecular mechanism that explains the diverse cargo recognition by Myo2-GTD, but also provides structural information useful for future functional studies of class V myosins in cargo transport.


Assuntos
Cadeias Pesadas de Miosina/química , Cadeias Pesadas de Miosina/metabolismo , Miosina Tipo V/química , Miosina Tipo V/metabolismo , Proteínas de Saccharomyces cerevisiae/química , Proteínas de Saccharomyces cerevisiae/metabolismo , Saccharomyces cerevisiae/enzimologia , Sítios de Ligação , Evolução Molecular , Proteínas Associadas aos Microtúbulos/química , Proteínas Associadas aos Microtúbulos/genética , Proteínas Associadas aos Microtúbulos/metabolismo , Proteínas Mitocondriais/química , Proteínas Mitocondriais/genética , Proteínas Mitocondriais/metabolismo , Complexos Multiproteicos/química , Complexos Multiproteicos/genética , Complexos Multiproteicos/metabolismo , Cadeias Pesadas de Miosina/genética , Miosina Tipo V/genética , Domínios Proteicos , Saccharomyces cerevisiae/genética , Proteínas de Saccharomyces cerevisiae/genética
18.
Cell Mol Life Sci ; 76(15): 2987-3004, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-30701284

RESUMO

Mechanosensors govern muscle tissue integrity and constitute a subcellular structure known as costameres. Costameres physically link the muscle extracellular matrix to contractile and signaling 'hubs' inside muscle fibers mainly via integrins and are localized beneath sarcolemmas of muscle fibers. Costameres are the main mechanosensors converting mechanical cues into biological events. However, the fiber type-specific costamere architecture in muscles is unexplored. We hypothesized that fiber types differ in the expression of genes coding for costamere components. By coupling laser microdissection to a multiplex tandem qPCR approach, we demonstrate that type 1 and type 2 fibers indeed show substantial differences in their mechanosensor complexes. We confirmed these data by fiber type population-specific protein analysis and confocal microscopy-based localization studies. We further show that knockdown of the costamere gene integrin-linked kinase (Ilk) in muscle precursor cells results in significantly increased slow-myosin-coding Myh7 gene, while the fast-myosin-coding genes Myh1, Myh2, and Myh4 are downregulated. In parallel, protein synthesis-enhancing signaling molecules (p-mTORSer2448, p < 0.05; p-P70S6KThr389, tendency with p < 0.1) were reduced upon Ilk knockdown. However, overexpression of slow type-inducing NFATc1 in muscle precursor cells did not change Ilk or other costamere gene expressions. In addition, we demonstrate fiber type-specific costamere gene regulation upon mechanical loading and unloading conditions. Our data imply that costamere genes, such as Ilk, are involved in the control of muscle fiber characteristics. Further, they identify costameres as muscle fiber type-specific loading management 'hubs' and may explain adaptation differences of muscle fiber types to mechanical (un)loading.


Assuntos
Costâmeros/metabolismo , Fibras Musculares Esqueléticas/metabolismo , Actinina/genética , Actinina/metabolismo , Proteínas Adaptadoras de Transdução de Sinal/genética , Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Animais , Linhagem Celular , Costâmeros/genética , Regulação da Expressão Gênica , Proteínas com Domínio LIM/genética , Proteínas com Domínio LIM/metabolismo , Masculino , Proteínas de Membrana/genética , Proteínas de Membrana/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Cadeias Pesadas de Miosina/genética , Cadeias Pesadas de Miosina/metabolismo , Fatores de Transcrição NFATC/genética , Fatores de Transcrição NFATC/metabolismo , Proteínas Serina-Treonina Quinases/antagonistas & inibidores , Proteínas Serina-Treonina Quinases/genética , Proteínas Serina-Treonina Quinases/metabolismo , Interferência de RNA , RNA Interferente Pequeno/metabolismo , Estresse Mecânico , Serina-Treonina Quinases TOR/genética , Serina-Treonina Quinases TOR/metabolismo
20.
Genesis ; 57(5): e23286, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30801883

RESUMO

Evolutionarily conserved Akirin nuclear proteins interact with chromatin remodeling complexes at gene enhancers and promoters, and have been reported to regulate cell proliferation and differentiation. Of the two mouse Akirin genes, Akirin2 is essential during embryonic development, with known in vivo roles in immune system function and the formation of the cerebral cortex. Here we demonstrate that Akirin2 is critical for mouse myogenesis, a tightly regulated developmental process through which myoblast precursors fuse to form mature skeletal muscle fibers. Loss of Akirin2 in somitic muscle precursor cells via Sim1-Cre-mediated excision of a conditional Akirin2 allele results in neonatal lethality. Mutant embryos exhibit a complete lack of forelimb, intercostal, and diaphragm muscles due to extensive apoptosis and loss of Pax3-positive myoblasts. Severe skeletal defects, including craniofacial abnormalities, disrupted ossification, and rib fusions are also observed, attributable to lack of skeletal muscles as well as patchy Sim1-Cre activity in the embryonic sclerotome. We further show that Akirin2 levels are tightly regulated during muscle cell differentiation in vitro, and that Akirin2 is required for the proper expression of muscle differentiation factors myogenin and myosin heavy chain. Our results implicate Akirin2 as a major regulator of mammalian muscle formation in vivo.


Assuntos
Células Musculares/metabolismo , Proteínas Repressoras/genética , Proteínas Repressoras/fisiologia , Animais , Fatores de Transcrição Hélice-Alça-Hélice Básicos/metabolismo , Diferenciação Celular , Proliferação de Células , Embrião de Mamíferos , Desenvolvimento Embrionário , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Células Musculares/fisiologia , Desenvolvimento Muscular/fisiologia , Músculo Esquelético/metabolismo , Músculos/metabolismo , Mioblastos/metabolismo , Cadeias Pesadas de Miosina/genética , Proteínas Nucleares/genética , Proteínas Nucleares/metabolismo , Regiões Promotoras Genéticas/genética , Proteínas Repressoras/metabolismo , Transdução de Sinais , Fatores de Transcrição/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA