Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 2.504
Filtrar
1.
PLoS Genet ; 16(2): e1008572, 2020 02.
Artigo em Inglês | MEDLINE | ID: mdl-32012149

RESUMO

Cancer genomes with mutations in the exonuclease domain of Polymerase Epsilon (POLE) present with an extraordinarily high somatic mutation burden. In vitro studies have shown that distinct POLE mutants exhibit different polymerase activity. Yet, genome-wide mutation patterns and driver mutation formation arising from different POLE mutants remains unclear. Here, we curated somatic mutation calls from 7,345 colorectal cancer samples from published studies and publicly available databases. These include 44 POLE mutant samples including 9 with whole genome sequencing data available. The POLE mutant samples were categorized based on the specific POLE mutation present. Mutation spectrum, associations of somatic mutations with epigenomics features and co-occurrence with specific driver mutations were examined across different POLE mutants. We found that different POLE mutants exhibit distinct mutation spectrum with significantly higher relative frequency of C>T mutations in POLE V411L mutants. Our analysis showed that this increase frequency in C>T mutations is not dependent on DNA methylation and not associated with other genomic features and is thus specifically due to DNA sequence context alone. Notably, we found strong association of the TP53 R213* mutation specifically with POLE P286R mutants. This truncation mutation occurs within the TT[C>T]GA context. For C>T mutations, this sequence context is significantly more likely to be mutated in POLE P286R mutants compared with other POLE exonuclease domain mutants. This study refines our understanding of DNA polymerase fidelity and underscores genome-wide mutation spectrum and specific cancer driver mutation formation observed in POLE mutant cancers.


Assuntos
Carcinogênese/genética , Neoplasias Colorretais/genética , DNA Polimerase II/metabolismo , Proteínas de Ligação a Poli-ADP-Ribose/metabolismo , Domínios Proteicos/genética , Proteína Supressora de Tumor p53/genética , Ilhas de CpG/genética , Citosina/metabolismo , Metilação de DNA/genética , Análise Mutacional de DNA/estatística & dados numéricos , DNA Polimerase II/genética , Bases de Dados Genéticas/estatística & dados numéricos , Conjuntos de Dados como Assunto , Epigênese Genética , Humanos , Mutação , Proteínas de Ligação a Poli-ADP-Ribose/genética , Sequenciamento Completo do Genoma/estatística & dados numéricos
2.
PLoS One ; 15(2): e0229144, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32084194

RESUMO

The multi-domain protein UHRF1 is essential for DNA methylation maintenance and binds DNA via a base-flipping mechanism with a preference for hemi-methylated CpG sites. We investigated its binding to hemi- and symmetrically modified DNA containing either 5-methylcytosine (mC), 5-hydroxymethylcytosine (hmC), 5-formylcytosine (fC), or 5-carboxylcytosine (caC). Our experimental results indicate that UHRF1 binds symmetrically carboxylated and hybrid methylated/carboxylated CpG dyads in addition to its previously reported substrates. Complementary molecular dynamics simulations provide a possible mechanistic explanation of how the protein could differentiate between modification patterns. First, we observe different local binding modes in the nucleotide binding pocket as well as the protein's NKR finger. Second, both DNA modification sites are coupled through key residues within the NKR finger, suggesting a communication pathway affecting protein-DNA binding for carboxylcytosine modifications. Our results suggest a possible additional function of the hemi-methylation reader UHRF1 through binding of carboxylated CpG sites. This opens the possibility of new biological roles of UHRF1 beyond DNA methylation maintenance and of oxidised methylcytosine derivates in epigenetic regulation.


Assuntos
5-Metilcitosina/metabolismo , Proteínas Estimuladoras de Ligação a CCAAT/metabolismo , Ilhas de CpG/genética , Citosina/análogos & derivados , Ubiquitina-Proteína Ligases/metabolismo , Animais , Sequência de Bases , Proteínas Estimuladoras de Ligação a CCAAT/química , Citosina/metabolismo , Epigênese Genética , Camundongos , Simulação de Dinâmica Molecular , Ligação Proteica , Domínios Proteicos , Especificidade por Substrato , Ubiquitina-Proteína Ligases/química
3.
Plant Mol Biol ; 103(1-2): 75-89, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-32040758

RESUMO

KEY MESSAGE: Multiple variables that control the relative levels of successful heritable plant genome editing were addressed using simple case studies in Arabidopsis thaliana. The recent advent of genome editing technologies (especially CRISPR, Clustered Regularly Interspaced Short Palindromic Repeats) has revolutionized various fields of scientific research. The process is much more specific than previous mutagenic processes and allows for targeting of nearly any gene of interest for the creation of loss-of-function mutations and many other types of editing, including gene-replacement and gene activation. However, not all CRISPR construct designs are successful, due to several factors, including differences in the strength and cell- or tissue-type specificity of the regulatory elements used to express the Cas9 (CRISPR Associated protein 9) DNA nuclease and single guide RNA components, and differences in the relative editing efficiency at different target areas within a given gene. Here we compare the levels of editing created in Arabidopsis thaliana by CRISPR constructs containing either different promoters, or altered target sites with varied levels of guanine-cytosine base content. Additionally, nuclease activity at sites targeted by imperfectly matched single guide RNAs was observed, suggesting that while the primary goal of most CRISPR construct designs is to achieve rapid, robust, heritable gene editing, the formation of unintended mutations at other genomic loci must be carefully monitored.


Assuntos
Arabidopsis/genética , Edição de Genes , Sistemas CRISPR-Cas , Citosina/metabolismo , Regulação da Expressão Gênica de Plantas , Genoma de Planta , Guanosina/metabolismo , Mutação
4.
Nat Biomed Eng ; 4(1): 97-110, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31937940

RESUMO

The success of base editors for the study and treatment of genetic diseases depends on the ability to deliver them in vivo to the relevant cell types. Delivery via adeno-associated viruses (AAVs) is limited by AAV packaging capacity, which precludes the use of full-length base editors. Here, we report the application of dual AAVs for the delivery of split cytosine and adenine base editors that are then reconstituted by trans-splicing inteins. Optimized dual AAVs enable in vivo base editing at therapeutically relevant efficiencies and dosages in the mouse brain (up to 59% of unsorted cortical tissue), liver (38%), retina (38%), heart (20%) and skeletal muscle (9%). We also show that base editing corrects, in mouse brain tissue, a mutation that causes Niemann-Pick disease type C (a neurodegenerative ataxia), slowing down neurodegeneration and increasing lifespan. The optimized delivery vectors should facilitate the efficient introduction of targeted point mutations into multiple tissues of therapeutic interest.


Assuntos
Adenina/metabolismo , Citosina/metabolismo , Dependovirus/fisiologia , Edição de Genes/métodos , Animais , Encéfalo/metabolismo , Vetores Genéticos/administração & dosagem , Células HEK293 , Humanos , Fígado/metabolismo , Camundongos Endogâmicos C57BL , Músculo Esquelético/metabolismo , Miocárdio/metabolismo , Retina/metabolismo
5.
Nucleic Acids Res ; 48(3): 1120-1130, 2020 02 20.
Artigo em Inglês | MEDLINE | ID: mdl-31912153

RESUMO

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.


Assuntos
Citosina/química , Quadruplex G , Regiões Promotoras Genéticas , Proteína Wnt1/genética , Citosina/metabolismo , Metilação de DNA , Epigênese Genética , Ressonância Magnética Nuclear Biomolecular
6.
Nucleic Acids Res ; 47(19): e119, 2019 11 04.
Artigo em Inglês | MEDLINE | ID: mdl-31418020

RESUMO

The current methods for quantifying genome-wide 5-methylcytosine (5mC) oxides are still scarce, mostly restricted with two limitations: assay sensitivity is seriously compromised with cost, assay time and sample input; epigenetic information is irreproducible during polymerase chain reaction (PCR) amplification without bisulfite pretreatment. Here, we propose a novel Polymerization Retardation Isothermal Amplification (PRIA) strategy to directly amplify the minute differences between epigenetic bases and others by arranging DNA polymerase to repetitively pass large electron-withdrawing groups tagged 5mC-oxides. We demonstrate that low abundant 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxycytosine (5caC) in genomic DNA can be accurately quantified within 10 h with 100 ng sample input on a laboratory real-time quantitative PCR instrument, and even multiple samples can be analyzed simultaneously in microplates. The global levels of 5hmC and 5fC in mouse and human brain tissues, rat hippocampal neuronal tissue, mouse kidney tissue and mouse embryonic stem cells were quantified and the observations not only confirm the widespread presence of 5hmC and 5fC but also indicate their significant variation in different tissues and cells. The strategy is easily performed in almost all research and medical laboratories, and would provide the potential capability to other candidate modifications in nucleotides.


Assuntos
5-Metilcitosina/isolamento & purificação , Metilação de DNA/genética , DNA Polimerase Dirigida por DNA/genética , Epigenômica/métodos , 5-Metilcitosina/análogos & derivados , 5-Metilcitosina/metabolismo , Animais , Citosina/análogos & derivados , Citosina/metabolismo , DNA/genética , Genoma/genética , Humanos , Camundongos , Óxidos/química , Reação em Cadeia da Polimerase , Polimerização , Ratos
7.
PLoS Genet ; 15(8): e1008086, 2019 08.
Artigo em Inglês | MEDLINE | ID: mdl-31412020

RESUMO

DNA methyltransferases are ubiquitous enzymes conserved in bacteria, plants and opisthokonta. These enzymes, which methylate cytosines, are involved in numerous biological processes, notably development. In mammals and higher plants, methylation patterns established and maintained by the cytosine DNA methyltransferases (DMTs) are essential to zygotic development. In fungi, some members of an extensively conserved fungal-specific DNA methyltransferase class are both mediators of the Repeat Induced Point mutation (RIP) genome defense system and key players of sexual reproduction. Yet, no DNA methyltransferase activity of these purified RID (RIP deficient) proteins could be detected in vitro. These observations led us to explore how RID-like DNA methyltransferase encoding genes would play a role during sexual development of fungi showing very little genomic DNA methylation, if any. To do so, we used the model ascomycete fungus Podospora anserina. We identified the PaRid gene, encoding a RID-like DNA methyltransferase and constructed knocked-out ΔPaRid defective mutants. Crosses involving P. anserina ΔPaRid mutants are sterile. Our results show that, although gametes are readily formed and fertilization occurs in a ΔPaRid background, sexual development is blocked just before the individualization of the dikaryotic cells leading to meiocytes. Complementation of ΔPaRid mutants with ectopic alleles of PaRid, including GFP-tagged, point-mutated and chimeric alleles, demonstrated that the catalytic motif of the putative PaRid methyltransferase is essential to ensure proper sexual development and that the expression of PaRid is spatially and temporally restricted. A transcriptomic analysis performed on mutant crosses revealed an overlap of the PaRid-controlled genetic network with the well-known mating-types gene developmental pathway common to an important group of fungi, the Pezizomycotina.


Assuntos
Proteínas de Bactérias/fisiologia , Metilases de Modificação do DNA/fisiologia , Redes Reguladoras de Genes/genética , Podospora/fisiologia , Citosina/metabolismo , Metilação de DNA/fisiologia , Epigênese Genética/fisiologia , Perfilação da Expressão Gênica , Técnicas de Silenciamento de Genes , Genes Fúngicos Tipo Acasalamento/genética , Genoma Bacteriano
8.
Nucleic Acids Res ; 47(17): 9024-9036, 2019 09 26.
Artigo em Inglês | MEDLINE | ID: mdl-31329950

RESUMO

In plants, nuclear multisubunit RNA polymerases IV and V are RNA Polymerase II-related enzymes that synthesize non-coding RNAs for RNA-directed DNA methylation (RdDM) and transcriptional gene silencing. Here, we tested the importance of the C-terminal domain (CTD) of Pol IV's largest subunit given that the Pol II CTD mediates multiple aspects of Pol II transcription. We show that the CTD is dispensable for Pol IV catalytic activity and Pol IV termination-dependent activation of RNA-DEPENDENT RNA POLYMERASE 2, which partners with Pol IV to generate dsRNA precursors of the 24 nt siRNAs that guide RdDM. However, 24 nt siRNA levels decrease ∼80% when the CTD is deleted. RNA-dependent cytosine methylation is also reduced, but only ∼20%, suggesting that siRNA levels typically exceed the levels needed for methylation of most loci. Pol IV-dependent loci affected by loss of the CTD are primarily located in chromosome arms, similar to loci dependent CLSY1/2 or SHH1, which are proteins implicated in Pol IV recruitment. However, deletion of the CTD does not phenocopy clsy or shh1 mutants, consistent with the CTD affecting post-recruitment aspects of Pol IV activity at target loci.


Assuntos
Proteínas de Arabidopsis/genética , Metilação de DNA/genética , RNA Polimerases Dirigidas por DNA/genética , Regulação da Expressão Gênica de Plantas/genética , RNA Interferente Pequeno/metabolismo , Arabidopsis/genética , Proteínas de Arabidopsis/metabolismo , Citosina/química , Citosina/metabolismo , RNA Polimerases Dirigidas por DNA/metabolismo , Inativação Gênica , Loci Gênicos , Proteínas de Homeodomínio/genética , Proteínas de Homeodomínio/metabolismo , Peptídeos e Proteínas de Sinalização Intracelular/genética , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Metiltransferases/metabolismo , Plantas Geneticamente Modificadas , Domínios Proteicos , Subunidades Proteicas/genética , Subunidades Proteicas/metabolismo , RNA Replicase/metabolismo , Sequenciamento Completo do Genoma
9.
Nucleic Acids Res ; 47(14): 7199-7212, 2019 08 22.
Artigo em Inglês | MEDLINE | ID: mdl-31287873

RESUMO

The cytosine (C)-rich sequences that can fold into tetraplex structures known as i-motif are prevalent in genomic DNA. Recent studies of i-motif-forming sequences have shown increasing evidence of their roles in gene regulation. However, most of these studies have been performed in short single-stranded oligonucleotides, far from the intracellular environment. In cells, i-motif-forming sequences are flanked by DNA duplexes and packed in the genome. Therefore, exploring the conformational dynamics and kinetics of i-motif under such topologically constrained environments is highly relevant in predicting their biological roles. Using single-molecule fluorescence analysis of self-assembled DNA duplexes and nanocircles, we show that the topological environments play a key role on i-motif stability and dynamics. While the human telomere sequence (C3TAA)3C3 assumes i-motif structure at pH 5.5 regardless of topological constraint, it undergoes conformational dynamics among unfolded, partially folded and fully folded states at pH 6.5. The lifetimes of i-motif and the partially folded state at pH 6.5 were determined to be 6 ± 2 and 31 ± 11 s, respectively. Consistent with the partially folded state observed in fluorescence analysis, interrogation of current versus time traces obtained from nanopore analysis at pH 6.5 shows long-lived shallow blockades with a mean lifetime of 25 ± 6 s. Such lifetimes are sufficient for the i-motif and partially folded states to interact with proteins to modulate cellular processes.


Assuntos
Citosina/química , DNA/química , Nanoporos , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Algoritmos , Dicroísmo Circular , Citosina/metabolismo , DNA/genética , Humanos , Concentração de Íons de Hidrogênio , Cinética , Microscopia de Fluorescência , Modelos Moleculares
10.
Nature ; 571(7764): 275-278, 2019 07.
Artigo em Inglês | MEDLINE | ID: mdl-31181567

RESUMO

Recently developed DNA base editing methods enable the direct generation of desired point mutations in genomic DNA without generating any double-strand breaks1-3, but the issue of off-target edits has limited the application of these methods. Although several previous studies have evaluated off-target mutations in genomic DNA4-8, it is now clear that the deaminases that are integral to commonly used DNA base editors often bind to RNA9-13. For example, the cytosine deaminase APOBEC1-which is used in cytosine base editors (CBEs)-targets both DNA and RNA12, and the adenine deaminase TadA-which is used in adenine base editors (ABEs)-induces site-specific inosine formation on RNA9,11. However, any potential RNA mutations caused by DNA base editors have not been evaluated. Adeno-associated viruses are the most common delivery system for gene therapies that involve DNA editing; these viruses can sustain long-term gene expression in vivo, so the extent of potential RNA mutations induced by DNA base editors is of great concern14-16. Here we quantitatively evaluated RNA single nucleotide variations (SNVs) that were induced by CBEs or ABEs. Both the cytosine base editor BE3 and the adenine base editor ABE7.10 generated tens of thousands of off-target RNA SNVs. Subsequently, by engineering deaminases, we found that three CBE variants and one ABE variant showed a reduction in off-target RNA SNVs to the baseline while maintaining efficient DNA on-target activity. This study reveals a previously overlooked aspect of off-target effects in DNA editing and also demonstrates that such effects can be eliminated by engineering deaminases.


Assuntos
DNA/genética , Edição de Genes/métodos , Mutagênese , Mutação , Nucleosídeo Desaminases/genética , Engenharia de Proteínas , RNA/genética , Adenina/metabolismo , Aminoidrolases/genética , Aminoidrolases/metabolismo , Citosina/metabolismo , Citosina Desaminase/genética , Citosina Desaminase/metabolismo , Células HEK293 , Humanos , Nucleosídeo Desaminases/metabolismo , Especificidade por Substrato , Transfecção
11.
PLoS Biol ; 17(6): e3000297, 2019 06.
Artigo em Inglês | MEDLINE | ID: mdl-31199786

RESUMO

Posttranscriptional modifications in transfer RNA (tRNA) are often critical for normal development because they adapt protein synthesis rates to a dynamically changing microenvironment. However, the precise cellular mechanisms linking the extrinsic stimulus to the intrinsic RNA modification pathways remain largely unclear. Here, we identified the cytosine-5 RNA methyltransferase NSUN2 as a sensor for external stress stimuli. Exposure to oxidative stress efficiently repressed NSUN2, causing a reduction of methylation at specific tRNA sites. Using metabolic profiling, we showed that loss of tRNA methylation captured cells in a distinct catabolic state. Mechanistically, loss of NSUN2 altered the biogenesis of tRNA-derived noncoding fragments (tRFs) in response to stress, leading to impaired regulation of protein synthesis. The intracellular accumulation of a specific subset of tRFs correlated with the dynamic repression of global protein synthesis. Finally, NSUN2-driven RNA methylation was functionally required to adapt cell cycle progression to the early stress response. In summary, we revealed that changes in tRNA methylation profiles were sufficient to specify cellular metabolic states and efficiently adapt protein synthesis rates to cell stress.


Assuntos
DNA-Citosina Metilases/metabolismo , Metiltransferases/metabolismo , Animais , Linhagem Celular , Citosina/metabolismo , Metilação de DNA/fisiologia , DNA-Citosina Metilases/fisiologia , Humanos , Camundongos , Estresse Oxidativo/fisiologia , Biossíntese de Proteínas/fisiologia , RNA/metabolismo , RNA de Transferência/metabolismo
12.
Nat Commun ; 10(1): 2550, 2019 06 11.
Artigo em Inglês | MEDLINE | ID: mdl-31186410

RESUMO

The presence and absence of RNA modifications regulates RNA metabolism by modulating the binding of writer, reader, and eraser proteins. For 5-methylcytosine (m5C) however, it is largely unknown how it recruits or repels RNA-binding proteins. Here, we decipher the consequences of m5C deposition into the abundant non-coding vault RNA VTRNA1.1. Methylation of cytosine 69 in VTRNA1.1 occurs frequently in human cells, is exclusively mediated by NSUN2, and determines the processing of VTRNA1.1 into small-vault RNAs (svRNAs). We identify the serine/arginine rich splicing factor 2 (SRSF2) as a novel VTRNA1.1-binding protein that counteracts VTRNA1.1 processing by binding the non-methylated form with higher affinity. Both NSUN2 and SRSF2 orchestrate the production of distinct svRNAs. Finally, we discover a functional role of svRNAs in regulating the epidermal differentiation programme. Thus, our data reveal a direct role for m5C in the processing of VTRNA1.1 that involves SRSF2 and is crucial for efficient cellular differentiation.


Assuntos
5-Metilcitosina/metabolismo , Metilação de DNA , Células Epidérmicas/citologia , Metiltransferases/metabolismo , RNA/metabolismo , Partículas de Ribonucleoproteínas em Forma de Abóbada/genética , Diferenciação Celular , Linhagem Celular , Citosina/metabolismo , Células Epidérmicas/metabolismo , Células HEK293 , Células HeLa , Células-Tronco Embrionárias Humanas/citologia , Humanos , Metiltransferases/genética , RNA/genética , Partículas de Ribonucleoproteínas em Forma de Abóbada/metabolismo
13.
Nat Commun ; 10(1): 2461, 2019 06 05.
Artigo em Inglês | MEDLINE | ID: mdl-31165727

RESUMO

Epigenetic changes might provide the biological explanation for the long-lasting impact of metabolic alterations of diabetic kidney disease development. Here we examined cytosine methylation of human kidney tubules using Illumina Infinium 450 K arrays from 91 subjects with and without diabetes and varying degrees of kidney disease using a cross-sectional design. We identify cytosine methylation changes associated with kidney structural damage and build a model for kidney function decline. We find that the methylation levels of 65 probes are associated with the degree of kidney fibrosis at genome wide significance. In total 471 probes improve the model for kidney function decline. Methylation probes associated with kidney damage and functional decline enrich on kidney regulatory regions and associate with gene expression changes, including epidermal growth factor (EGF). Altogether, our work shows that kidney methylation differences can be detected in patients with diabetic kidney disease and improve kidney function decline models indicating that they are potentially functionally important.


Assuntos
Citosina/metabolismo , Metilação de DNA , Nefropatias Diabéticas/genética , Rim/metabolismo , Idoso , Estudos de Casos e Controles , Ilhas de CpG , Estudos Transversais , Nefropatias Diabéticas/metabolismo , Nefropatias Diabéticas/patologia , Progressão da Doença , Epigênese Genética , Feminino , Fibrose , Regulação da Expressão Gênica , Taxa de Filtração Glomerular , Humanos , Rim/patologia , Masculino , Pessoa de Meia-Idade
14.
BMC Genomics ; 20(1): 445, 2019 Jun 03.
Artigo em Inglês | MEDLINE | ID: mdl-31159718

RESUMO

BACKGROUND: Directed DNA methylation on N6-adenine (6mA), N4-cytosine (4mC), and C5-cytosine (5mC) can potentially increase DNA coding capacity and regulate a variety of biological functions. These modifications are relatively abundant in bacteria, occurring in about a percent of all bases of most bacteria. Until recently, 5mC and its oxidized derivatives were thought to be the only directed DNA methylation events in metazoa. New and more sensitive detection techniques (ultra-high performance liquid chromatography coupled with mass spectrometry (UHPLC-ms/ms) and single molecule real-time sequencing (SMRTseq)) have suggested that 6mA and 4mC modifications could be present in a variety of metazoa. RESULTS: Here, we find that both of these techniques are prone to inaccuracies, which overestimate DNA methylation concentrations in metazoan genomic DNA. Artifacts can arise from methylated bacterial DNA contamination of enzyme preparations used to digest DNA and contaminating bacterial DNA in eukaryotic DNA preparations. Moreover, DNA sonication introduces a novel modified base from 5mC that has a retention time near 4mC that can be confused with 4mC. Our analyses also suggest that SMRTseq systematically overestimates 4mC in prokaryotic and eukaryotic DNA and 6mA in DNA samples in which it is rare. Using UHPLC-ms/ms designed to minimize and subtract artifacts, we find low to undetectable levels of 4mC and 6mA in genomes of representative worms, insects, amphibians, birds, rodents and primates under normal growth conditions. We also find that mammalian cells incorporate exogenous methylated nucleosides into their genome, suggesting that a portion of 6mA modifications could derive from incorporation of nucleosides from bacteria in food or microbiota. However, gDNA samples from gnotobiotic mouse tissues found rare (0.9-3.7 ppm) 6mA modifications above background. CONCLUSIONS: Altogether these data demonstrate that 6mA and 4mC are rarer in metazoa than previously reported, and highlight the importance of careful sample preparation and measurement, and need for more accurate sequencing techniques.


Assuntos
Adenina/análogos & derivados , Artefatos , Citosina/análogos & derivados , Metilação de DNA , DNA/genética , Eucariotos/genética , Genoma , Adenina/análise , Adenina/metabolismo , Animais , Células Cultivadas , Citosina/análise , Citosina/metabolismo , Genômica , Humanos , Camundongos , Mioblastos/citologia , Mioblastos/metabolismo
15.
Am J Bot ; 106(6): 798-806, 2019 06.
Artigo em Inglês | MEDLINE | ID: mdl-31157419

RESUMO

PREMISE: Phenotypic heterogeneity of reiterated, homologous structures produced by individual plants has ecological consequences for plants and their animal consumers. This paper examines experimentally the epigenetic mosaicism hypothesis, which postulates that within-plant variation in traits of reiterated structures may partly arise from different parts of the same genetic individual differing in patterns or extent of genomic DNA methylation. METHODS: Leaves of paired ramets borne by field-growing Helleborus foetidus plants were infiltrated periodically over the entire flowering period with either a water solution of the demethylating agent zebularine or just water as the control. The effects of the zebularine treatment were assessed by quantifying genome-wide DNA cytosine methylation in leaves and monitoring inflorescence growth and flower production, number of ovules per flower, pollination success, fruit set, seed set, seed size, and distribution of sap-feeding insects. RESULTS: Genomic DNA from leaves in zebularine-treated ramets was significantly less methylated than DNA from leaves in control ones. Inflorescences in treated ramets grew smaller and produced fewer flowers, with fewer ovules and lower follicle and seed set, but did not differ from inflorescences in untreated ramets in pollination success or seed size. The zebularine treatment influenced the within-plant distribution of sap-feeding insects. CONCLUSIONS: Experimental manipulation of genomic DNA methylation level in leaves of wild-growing H. foetidus plants induced considerable within-plant heterogeneity in phenotypic (inflorescences, flowers, fecundity) and ecologically relevant traits (herbivore distribution), which supports the hypothesis that epigenetic mosaicism may partly account for within-plant variation.


Assuntos
Citosina/metabolismo , Metilação de DNA , Epigênese Genética , Fertilidade/genética , Helleborus/fisiologia , Herbivoria/fisiologia , Flores/genética , Flores/fisiologia , Helleborus/genética , Inflorescência/genética , Inflorescência/fisiologia , Mosaicismo , Folhas de Planta/fisiologia , Sementes/genética , Sementes/fisiologia
16.
Genome Res ; 29(8): 1277-1286, 2019 08.
Artigo em Inglês | MEDLINE | ID: mdl-31239280

RESUMO

The repressive capacity of cytosine DNA methylation is mediated by recruitment of silencing complexes by methyl-CpG binding domain (MBD) proteins. Despite MBD proteins being associated with silencing, we discovered that a family of arthropod Copia retrotransposons have incorporated a host-derived MBD. We functionally show how retrotransposon-encoded MBDs preferentially bind to CpG-dense methylated regions, which correspond to transposable element regions of the host genome, in the myriapod Strigamia maritima Consistently, young MBD-encoding Copia retrotransposons (CopiaMBD) accumulate in regions with higher CpG densities than other LTR-retrotransposons also present in the genome. This would suggest that retrotransposons use MBDs to integrate into heterochromatic regions in Strigamia, avoiding potentially harmful insertions into host genes. In contrast, CopiaMBD insertions in the spider Stegodyphus dumicola genome disproportionately accumulate in methylated gene bodies compared with other spider LTR-retrotransposons. Given that transposons are not actively targeted by DNA methylation in the spider genome, this distribution bias would also support a role for MBDs in the integration process. Together, these data show that retrotransposons can co-opt host-derived epigenome readers, potentially harnessing the host epigenome landscape to advantageously tune the retrotransposition process.


Assuntos
Artrópodes/genética , Ilhas de CpG , Proteínas de Ligação a DNA/genética , Genoma , Retroelementos , Sequência de Aminoácidos , Animais , Artrópodes/classificação , Artrópodes/metabolismo , Citosina/metabolismo , Metilação de DNA , Proteínas de Ligação a DNA/metabolismo , Filogenia , Domínios Proteicos , Alinhamento de Sequência , Homologia de Sequência de Aminoácidos , Especificidade da Espécie
17.
Molecules ; 24(10)2019 May 14.
Artigo em Inglês | MEDLINE | ID: mdl-31091778

RESUMO

The clinically widely-used anticancer drug, cisplatin, binds strongly to DNA as a DNA-damaging agent. Herein, we investigated the interaction of cisplatin with a 15-mer single-stranded C,T-rich oligodeoxynucleotide, 5'-CCTT4CTT7G8C9T10TCTCC-3' (ODN15), using ultra-high resolution Fourier transform ion cyclotron resonance mass spectrometry (FT-ICR MS) in conjunction with tandem mass spectrometry (top-down MS). Top-down MS analysis with collision-induced dissociation (CID) fragmentation of the mono-platinated and di-platinated ODN15 provided abundant and informative Pt-containing or Pt-free a/[a - B], w and internal fragments, allowing the unambiguous identification of T4, T7, C9, and T10 as the platination sites on the cisplatin-ODN15 adducts. These results revealed that, in addition to the well-established guanine site, the unexpected thermodynamic binding of cisplatin to cytosine and thymine bases was also evident at the oligonucleotide level. Furthermore, the binding models of cisplatin with cytosine and thymine bases were built as the Pt coordinated to cytosine-N(3) and thymine-N(3) with displacement of the proton or tautomerization of thymine. These findings contribute to a better understanding of the mechanism of action of cisplatin and its preference for gene loci when the drug binds to cellular DNA, and also demonstrate the great potential and superiority of FT-ICR MS in studying the interactions of metallodrugs with large biomolecules.


Assuntos
Cisplatino/farmacologia , Oligodesoxirribonucleotídeos/química , Oligodesoxirribonucleotídeos/metabolismo , Citosina/metabolismo , Modelos Moleculares , Espectrometria de Massas em Tandem , Timina/metabolismo
18.
Plant Sci ; 284: 16-24, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31084868

RESUMO

In this paper, we evaluated the genotoxicity of cadmium (Cd) in plants by performing a methylation-sensitive amplification polymorphism (MSAP) on the model plant Nicotiana benthamiana. Among 255 loci examined, 14 genes were found to show altered cytosine methylation patterns in response to Cd stress. Four of those genes (NbMORC3, NbHGSNAT, NbMUT, and NbBG) were selected for further analysis due to their predicted roles in plant development. Cd-induced changes of cytosine methylation status in MSAP fragments of selected genes were confirmed using bisulfite sequencing polymerase chain reaction (BSP). In addition, the expression levels of these genes were found to correlate with cadmium dosage, and a knock-down of these four genes via virus-induced genes silencing (VIGS) led to abnormal development and elevated sensitivity to cadmium stress. Silencing of these four genes resulted in altered cadmium accumulation in different parts of the experimental plants. Our data indicate that cadmium exposure causes dramatic changes in the cytosine methylation status of the plant genome, thus affecting the expression of many genes that are vital for plant growth and are involved in cadmium stress response.


Assuntos
Cádmio/toxicidade , Citosina/metabolismo , Regulação da Expressão Gênica de Plantas/efeitos dos fármacos , Tabaco/efeitos dos fármacos , DNA de Plantas/efeitos dos fármacos , Genes de Plantas/efeitos dos fármacos , Metilação/efeitos dos fármacos , Reação em Cadeia da Polimerase em Tempo Real , Estresse Fisiológico/efeitos dos fármacos , Tabaco/genética , Tabaco/metabolismo
19.
Photochem Photobiol Sci ; 18(7): 1761-1772, 2019 Jul 10.
Artigo em Inglês | MEDLINE | ID: mdl-31111854

RESUMO

Biomolecules like cysteine and cytosine play a significant role in many physiological processes, and their unusual level in biological systems can lead to many diseases including cancer. Indeed, the need for selective detection of these moieties by a fluorescence probe is imperative. Thus, thiophene based Schiff N,N'-bis(thiophene-2-ylmethylene)thiophenemethane (BMTM) was synthesized and then characterized using several analytical techniques before converting it into organic nanoparticles (ONPs). Then, fluorescent organic inorganic nanohybrids (FONs) were obtained after decorating ONPs with AuNPs to yield BMTM-Au-ONPs (FONPs). The morphology of the particles, analyzed using a Transmission Electron Microscope (TEM), shows that AuNPs were embedded with low density organic matter (ONPs). FONPs were employed to recognize cysteine and cytosine simultaneously. No interference was observed from other moieties such as guanine, uracyl, NADH, NAD, ATP, and adenine during the detection. It means that the intensity of the fluorescence signal was significantly changed (enhanced for cytosine and quenched for cysteine). So, FONPs were used to detect cysteine and cytosine in real samples, like Saccharomyces cerevisiae cells. As expected, no considerable fluorescence signal for cysteine was observed, while for cytosine, strong fluorescence signals were detected in the cells. DFT was used to explain the interaction of FONPs with cysteine or cytosine.


Assuntos
Cisteína/análise , Citosina/análise , Ouro/química , Nanopartículas Metálicas/química , Tiofenos/química , Cisteína/metabolismo , Citosina/metabolismo , Teoria da Densidade Funcional , Bactérias Gram-Negativas/efeitos dos fármacos , Bactérias Gram-Positivas/efeitos dos fármacos , Nanopartículas Metálicas/toxicidade , Microscopia Confocal , Microscopia Eletrônica de Transmissão , NAD/química , Saccharomyces cerevisiae/metabolismo
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA