Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 415
Filtrar
1.
Nucleic Acids Res ; 49(4): 2179-2191, 2021 02 26.
Artigo em Inglês | MEDLINE | ID: mdl-33533925

RESUMO

Replication forks often stall at damaged DNA. To overcome these obstructions and complete the DNA duplication in a timely fashion, replication can be restarted downstream of the DNA lesion. In mammalian cells, this repriming of replication can be achieved through the activities of primase and polymerase PrimPol. PrimPol is stimulated in DNA synthesis through interaction with PolDIP2, however the exact mechanism of this PolDIP2-dependent stimulation is still unclear. Here, we show that PrimPol uses a flexible loop to interact with the C-terminal ApaG-like domain of PolDIP2, and that this contact is essential for PrimPol's enhanced processivity. PolDIP2 increases primer-template and dNTP binding affinities of PrimPol, which concomitantly enhances its nucleotide incorporation efficiency. This stimulation is dependent on a unique arginine cluster in PolDIP2. Since the polymerase activity of PrimPol alone is very limited, this mechanism, where the affinity for dNTPs gets increased by PolDIP2 binding, might be critical for the in vivo function of PrimPol in tolerating DNA lesions at physiological nucleotide concentrations.


Assuntos
Arginina/química , DNA Primase/química , DNA Polimerase Dirigida por DNA/química , DNA/biossíntese , Enzimas Multifuncionais/química , Proteínas Nucleares/química , Proteínas Nucleares/metabolismo , Motivos de Aminoácidos , DNA Primase/metabolismo , DNA Polimerase Dirigida por DNA/metabolismo , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/metabolismo , Modelos Moleculares , Enzimas Multifuncionais/metabolismo , Ligação Proteica
2.
Biochemistry ; 60(1): 1-5, 2021 01 12.
Artigo em Inglês | MEDLINE | ID: mdl-33356161

RESUMO

A recently described DNA polymerase ribozyme, obtained by in vitro evolution, provides the opportunity to investigate mechanistic features of RNA catalysis using methods that previously had only been applied to DNA polymerase proteins. Insight can be gained into the transition state of the DNA polymerization reaction by studying the behavior of various ß,γ-bridging substituted methylene (CXY; X, Y = H, halo, methyl) or imido (NH) dNTP analogues that differ with regard to the pKa4 of the bisphosphonate or imidodiphosphate leaving group. The apparent rate constant (kpol) of the polymerase ribozyme was determined for analogues of dGTP and dCTP that span a broad range of acidities for the leaving group, ranging from 7.8 for the CF2-bisphosphonate to 11.6 for the CHCH3-bisphosphonate. A Brønsted plot of log(kpol) versus pKa4 of the leaving group demonstrates linear free energy relationships (LFERs) for dihalo-, monohalo-, and non-halogen-substituted analogues of the dNTPs, with negative slopes, as has been observed for DNA polymerase proteins. The unsubstituted dNTPs have a faster catalytic rate than would be predicted from consideration of the linear free energy relationship alone, presumably due to a relatively more favorable interaction of the ß,γ-bridging oxygen within the active site. Although the DNA polymerase ribozyme is considerably slower than DNA polymerase proteins, it exhibits a similar LFER fingerprint, suggesting mechanistic commonality pertaining to the buildup of negative charge in the transition state, despite the very different chemical compositions of the two catalysts.


Assuntos
DNA Polimerase Dirigida por DNA/metabolismo , DNA/química , Desoxirribonucleotídeos/química , Polifosfatos/química , RNA Catalítico/metabolismo , Humanos , Cinética , Polimerização , RNA Catalítico/química
3.
Sci Rep ; 10(1): 611, 2020 01 17.
Artigo em Inglês | MEDLINE | ID: mdl-31953472

RESUMO

The levels of the four deoxynucleoside triphosphates (dNTPs) are under strict control in the cell, as improper or imbalanced dNTP pools may lead to growth defects and oncogenesis. Upon treatment of cancer cells with therapeutic agents, changes in the canonical dNTPs levels may provide critical information for evaluating drug response and mode of action. The radioisotope-labeling enzymatic assay has been commonly used for quantitation of cellular dNTP levels. However, the disadvantage of this method is the handling of biohazard materials. Here, we described the use of click chemistry to replace radioisotope-labeling in template-dependent DNA polymerization for quantitation of the four canonical dNTPs. Specific oligomers were designed for dCTP, dTTP, dATP and dGTP measurement, and the incorporation of 5-ethynyl-dUTP or C8-alkyne-dCTP during the polymerization reaction allowed for fluorophore conjugation on immobilized oligonucleotides. The four reactions gave a linear correlation coefficient >0.99 in the range of the concentration of dNTPs present in 106 cells, with little interference of cellular rNTPs. We present evidence indicating that data generated by this methodology is comparable to radioisotope-labeling data. Furthermore, the design and utilization of a robust microplate assay based on this technology evidenced the modulation of dNTPs in response to different chemotherapeutic agents in cancer cells.


Assuntos
Química Click/métodos , Cobre/química , Desoxirribonucleotídeos/análise , Nucleotídeos de Desoxiuracil/química , Reação de Cicloadição , Nucleotídeos de Desoxiadenina/análise , Nucleotídeos de Desoxiadenina/química , Nucleotídeos de Desoxicitosina/análise , Nucleotídeos de Desoxicitosina/química , Nucleotídeos de Desoxiguanina/análise , Nucleotídeos de Desoxiguanina/química , Desoxirribonucleotídeos/química , Células HCT116 , Células HEK293 , Humanos , Células K562 , Rodaminas/química , Coloração e Rotulagem , Nucleotídeos de Timina/análise , Nucleotídeos de Timina/química
4.
Postepy Biochem ; 65(2): 143-152, 2019 06 06.
Artigo em Polonês | MEDLINE | ID: mdl-31642653

RESUMO

High replication fidelity, understood as the DNA polymerases' ability to select nucleotides with both correct base and sugar, is of critical importance for maintaining the genetic stability. Due to the fact that the cellular levels of ribonucleotides are much higher than the concentrations of deoxyribonucleotides, replicative polymerases are able to incorporate ribonucleotides with up to 1000-fold higher frequency than mismatched deoxyribonucleotides. The ability to discriminate against ribonucleotides by the DNA polymerases relies on the steric gate residue in the enzyme's catalytic centre. Despite the fact that ribonucleotides are the most abundantly inserted incorrect nucleotides in DNA, they are not observed in properly functioning cells. The major pathway responsible for the recognition and removal of ribonucleotides from DNA is called Ribonucleotide Excision Repair. The impairment of ribonucleotide removal pathways can cause increased mutation rate, replication stress, DNA breakage, problems with transcription, chromatin structure maintenance, genetic disorders and cell death. In spite of that, ribonucleotide incorporation into DNA may have some positive biological impact, stimulating mismatch repair and non-homologous end joining.


Assuntos
Reparo do DNA , DNA Polimerase Dirigida por DNA/metabolismo , DNA/química , DNA/metabolismo , Instabilidade Genômica , Ribonucleotídeos/metabolismo , DNA/genética , Replicação do DNA , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/metabolismo , Ribonucleotídeos/química
5.
Anal Chem ; 91(22): 14569-14576, 2019 11 19.
Artigo em Inglês | MEDLINE | ID: mdl-31638773

RESUMO

Accurate, traceable quantification of ribonucleotide or deoxyribonucleotide oligomers is achievable using acid hydrolysis and isotope dilution mass spectrometry (ID-MS). In this work, formic acid hydrolysis is demonstrated to generate stoichiometric release of nucleobases from intact oligonucleotides, which then can be measured by ID-MS, facilitating true and precise absolute quantification of RNA, short linearized DNA, or genomic DNA. Surrogate nucleobases are quantified with a liquid chromatography-tandem mass spectrometry (LC-MS/MS) workflow, using multiple reaction monitoring (MRM). Nucleobases were chromatographically resolved using a novel cation-exchange separation, incorporating a pH gradient. Trueness of this quantitative assay is estimated from agreement among the surrogate nucleobases and by comparison to concentrations provided for commercial materials or Standard Reference Materials (SRMs) from the National Institute of Standards and Technology (NIST). Comparable concentration estimates using NanoDrop spectrophotometry or established from droplet-digital polymerase chain reaction (ddPCR) techniques agree well with the results. Acid hydrolysis-ID-LC-MS/MS provides excellent quantitative selectivity and accuracy while enabling traceability to mass unit. Additionally, this approach can be uniquely useful for quantifying modified nucleobases or mixtures.


Assuntos
Cromatografia Líquida/métodos , DNA Viral/análise , RNA/análise , Espectrometria de Massas em Tandem/métodos , Vírus BK/química , DNA Viral/química , Desoxirribonucleotídeos/análise , Desoxirribonucleotídeos/química , Formiatos/química , Humanos , Hidrólise , RNA/química , Ribonucleotídeos/análise , Ribonucleotídeos/química
6.
Cell Cycle ; 18(21): 2817-2827, 2019 11.
Artigo em Inglês | MEDLINE | ID: mdl-31544596

RESUMO

Deoxyribonucleotide metabolites (dNTPs) are the substrates for DNA synthesis. It has been proposed that their availability influences the progression of the cell cycle during development and pathological situations such as tumor growth. The mechanism has remained unclear for the link between cell cycle and dNTP levels beyond their role as substrates. Here, we review recent studies concerned with the dynamics of dNTP levels in early embryos and the role of DNA replication checkpoint as a sensor of dNTP levels.


Assuntos
Ciclo Celular/fisiologia , Desoxirribonucleotídeos/biossíntese , Desoxirribonucleotídeos/química , Drosophila/embriologia , Animais , Divisão Celular/fisiologia , Replicação do DNA/genética , Drosophila/genética , Redes e Vias Metabólicas/fisiologia , Óvulo/crescimento & desenvolvimento
7.
Anal Chem ; 91(16): 10381-10385, 2019 08 20.
Artigo em Inglês | MEDLINE | ID: mdl-31364352

RESUMO

DNA damage seriously threats the genomic stability and is linked to mutagenesis, carcinogenesis, and cell death. DNA damage includes the isolated damage and the clustered damages, but few approaches are available for efficient detection of the clustered damage due to its spatial distribution. Herein, we present a single-molecule counting approach with the capability of detecting both the isolated and the clustered damages in genomic DNAs. We employed the repair enzymes to remove the DNA damage and used the terminal deoxynucleotidyl transferase (TdT) to incorporate biotinylated nucleotides and fluorescent nucleotides into the damage sites in a template-independent manner. The number of total oxidative damaged bases is quantified to be 7328-7406 in a single HeLa cell treated with 150 µM H2O2. This method in combination with special repair enzymes can detect a variety of DNA damage in different types of cells, holding great potential for early diagnosis of DNA damage-related human diseases.


Assuntos
Reparo do DNA/efeitos dos fármacos , DNA/análise , Imagem Individual de Molécula/métodos , Coloração e Rotulagem/métodos , Biotina/química , Biotinilação , Carbocianinas/química , DNA/genética , DNA/metabolismo , Dano ao DNA , DNA Glicosilases/química , DNA Glicosilases/metabolismo , DNA Nucleotidilexotransferase/química , DNA Nucleotidilexotransferase/metabolismo , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/química , DNA Liase (Sítios Apurínicos ou Apirimidínicos)/metabolismo , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/metabolismo , Células HeLa , Humanos , Peróxido de Hidrogênio/farmacologia , Estreptavidina/química
8.
Nucleic Acids Res ; 47(17): e101, 2019 09 26.
Artigo em Inglês | MEDLINE | ID: mdl-31318971

RESUMO

A new approach to single-molecule DNA sequencing in which dNTPs, released by pyrophosphorolysis from the strand to be sequenced, are captured in microdroplets and read directly could have substantial advantages over current sequence-by-synthesis methods; however, there is no existing method sensitive enough to detect a single nucleotide in a microdroplet. We have developed a method for dNTP detection based on an enzymatic two-stage reaction which produces a robust fluorescent signal that is easy to detect and process. By taking advantage of the inherent specificity of DNA polymerases and ligases, coupled with volume restriction in microdroplets, this method allows us to simultaneously detect the presence of and distinguish between, the four natural dNTPs at the single-molecule level, with negligible cross-talk.


Assuntos
Desoxirribonucleotídeos/análise , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Análise de Sequência de DNA/métodos , DNA Polimerase Dirigida por DNA/metabolismo , Desoxirribonucleosídeos/química , Desoxirribonucleotídeos/química , Limite de Detecção , Microscopia de Fluorescência , Oligodesoxirribonucleotídeos/biossíntese , Oligodesoxirribonucleotídeos/química , Sensibilidade e Especificidade
9.
Biochem Biophys Res Commun ; 515(4): 551-557, 2019 08 06.
Artigo em Inglês | MEDLINE | ID: mdl-31176489

RESUMO

A novel DNA polymerase from the deep-sea vent phage NrS-1, was characterized as a primase-polymerase (referred to as prim-pol), which works as a self-priming DNA polymerase to synthesize de novo long DNA strands. Functional research on the NrS-1 prim-pol illustrated that the N-terminal 300 residues (referred to as N300) have de novo synthesis activity similar to that of the full-length enzyme. Just like other prim-pols, NrS-1 prim-pol was able to initiate DNA synthesis, proficiently discriminating against ribonucleotides (NTPs), exclusively using deoxynucleotides (dNTPs). However, the structural basis for this discrimination is not well understood. Here, the three kinds of crystal structures of N300-dNTPs-Mg2+ complex were determined. These complex structures shared the identical steric architecture and hydrogen-bond interactions in the catalytic center. The results of biochemical studies indicated that R145 possibly plays an indispensable role in the primer extension. Mutagenesis and structural simulation showed that the backbone carboxyl group of Y146, as a potential sugar selector, was involved in steric clashing with the incoming 2'-OH group of NTPs. However, the mechanism of substrate discrimination probably was different from that of other prim-pols, according to the structural analyses and sequence comparison.


Assuntos
Bacteriófagos/química , DNA Polimerase Dirigida por DNA/química , Magnésio/química , Especificidade por Substrato , Proteínas Virais/química , Trifosfato de Adenosina/química , Domínio Catalítico , Cristalografia por Raios X , DNA Primase/química , Primers do DNA/genética , Replicação do DNA , DNA Viral/química , Desoxirribonucleotídeos/química , Íons , Modelos Moleculares , Mutagênese , Mutação , Domínios Proteicos
10.
ACS Sens ; 4(7): 1835-1843, 2019 07 26.
Artigo em Inglês | MEDLINE | ID: mdl-31250628

RESUMO

We describe a molecular sensor that reports, using fluorescence resonance energy transfer (FRET), on the degree of macromolecular crowding in different cellular compartments. The oligonucleotide-based sensor is sensitive to changes in the volume fraction of macromolecules over a wide range in vitro and, when introduced in cells, rapidly distributes and shows a striking contrast between the cytosol and the nucleus. This contrast can be modulated by osmotic stress or by using a number of drugs that alter chromatin organization within the nucleus. These findings suggest that the sensor can be used as a tool to probe chromosome organization. Further, our finding that the cell maintains different degrees of macromolecular crowding in the cytoplasm and nucleoplasm has implications on molecular mechanisms since crowding can alter protein conformations, binding rates, reaction kinetics, and therefore protein function.


Assuntos
Núcleo Celular/metabolismo , Cromatina/metabolismo , Citoplasma/metabolismo , Desoxirribonucleotídeos/química , Transferência Ressonante de Energia de Fluorescência/métodos , Corantes Fluorescentes/química , Animais , Carbocianinas/química , Fibroblastos/metabolismo , Camundongos , Pressão Osmótica
11.
J Am Chem Soc ; 141(27): 10644-10653, 2019 07 10.
Artigo em Inglês | MEDLINE | ID: mdl-31241334

RESUMO

Previously, we reported the creation of a semi-synthetic organism (SSO) that stores and retrieves increased information by virtue of stably maintaining an unnatural base pair (UBP) in its DNA, transcribing the corresponding unnatural nucleotides into the codons and anticodons of mRNAs and tRNAs, and then using them to produce proteins containing noncanonical amino acids (ncAAs). Here we report a systematic extension of the effort to optimize the SSO by exploring a variety of deoxy- and ribonucleotide analogues. Importantly, this includes the first in vivo structure-activity relationship (SAR) analysis of unnatural ribonucleoside triphosphates. Similarities and differences between how DNA and RNA polymerases recognize the unnatural nucleotides were observed, and remarkably, we found that a wide variety of unnatural ribonucleotides can be efficiently transcribed into RNA and then productively and selectively paired at the ribosome to mediate the synthesis of proteins with ncAAs. The results extend previous studies, demonstrating that nucleotides bearing no significant structural or functional homology to the natural nucleotides can be efficiently and selectively paired during replication, to include each step of the entire process of information storage and retrieval. From a practical perspective, the results identify the most optimal UBP for replication and transcription, as well as the most optimal unnatural ribonucleoside triphosphates for transcription and translation. The optimized SSO is now, for the first time, able to efficiently produce proteins containing multiple, proximal ncAAs.


Assuntos
Nucleotídeos/genética , Biossíntese de Proteínas , Biologia Sintética/métodos , Transcrição Genética , Pareamento de Bases , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/genética , Código Genético , Nucleotídeos/química
12.
Nucleic Acids Res ; 47(12): 6084-6097, 2019 07 09.
Artigo em Inglês | MEDLINE | ID: mdl-31114917

RESUMO

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.


Assuntos
DNA/química , Desoxirribonucleotídeos/química , Putrescina/química , Espermidina/química , Espermina/química , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Eletricidade Estática
13.
Nucleic Acids Res ; 47(7): 3306-3320, 2019 04 23.
Artigo em Inglês | MEDLINE | ID: mdl-30820542

RESUMO

For oligonucleotide therapeutics, chemical modifications of the sugar-phosphate backbone are frequently used to confer drug-like properties. Because 2'-deoxy-2'-fluoro (2'-F) nucleotides are not known to occur naturally, their safety profile was assessed when used in revusiran and ALN-TTRSC02, two short interfering RNAs (siRNAs), of the same sequence but different chemical modification pattern and metabolic stability, conjugated to an N-acetylgalactosamine (GalNAc) ligand for targeted delivery to hepatocytes. Exposure to 2'-F-monomer metabolites was low and transient in rats and humans. In vitro, 2'-F-nucleoside 5'-triphosphates were neither inhibitors nor preferred substrates for human polymerases, and no obligate or non-obligate chain termination was observed. Modest effects on cell viability and mitochondrial DNA were observed in vitro in a subset of cell types at high concentrations of 2'-F-nucleosides, typically not attained in vivo. No apparent functional impact on mitochondria and no significant accumulation of 2'-F-monomers were observed after weekly administration of two GalNAc-siRNA conjugates in rats for ∼2 years. Taken together, the results support the conclusion that 2'-F nucleotides can be safely applied for the design of metabolically stabilized therapeutic GalNAc-siRNAs with favorable potency and prolonged duration of activity allowing for low dose and infrequent dosing.


Assuntos
Acetilgalactosamina/efeitos adversos , Acetilgalactosamina/química , Desoxirribonucleotídeos/efeitos adversos , Desoxirribonucleotídeos/química , Flúor/química , RNA Interferente Pequeno/efeitos adversos , RNA Interferente Pequeno/química , Animais , Feminino , Flúor/efeitos adversos , Humanos , Masculino , Ratos , Ratos Sprague-Dawley
14.
Biochemistry ; 58(14): 1845-1860, 2019 04 09.
Artigo em Inglês | MEDLINE | ID: mdl-30855138

RESUMO

Class I ribonucleotide reductases (RNRs) share a common mechanism of nucleotide reduction in a catalytic α subunit. All RNRs initiate catalysis with a thiyl radical, generated in class I enzymes by a metallocofactor in a separate ß subunit. Class Id RNRs use a simple mechanism of cofactor activation involving oxidation of a MnII2 cluster by free superoxide to yield a metal-based MnIIIMnIV oxidant. This simple cofactor assembly pathway suggests that class Id RNRs may be representative of the evolutionary precursors to more complex class Ia-c enzymes. X-ray crystal structures of two class Id α proteins from Flavobacterium johnsoniae ( Fj) and Actinobacillus ureae ( Au) reveal that this subunit is distinctly small. The enzyme completely lacks common N-terminal ATP-cone allosteric motifs that regulate overall activity, a process that normally occurs by dATP-induced formation of inhibitory quaternary structures to prevent productive ß subunit association. Class Id RNR activity is insensitive to dATP in the Fj and Au enzymes evaluated here, as expected. However, the class Id α protein from Fj adopts higher-order structures, detected crystallographically and in solution. The Au enzyme does not exhibit these quaternary forms. Our study reveals structural similarity between bacterial class Id and eukaryotic class Ia α subunits in conservation of an internal auxiliary domain. Our findings with the Fj enzyme illustrate that nucleotide-independent higher-order quaternary structures can form in simple RNRs with truncated or missing allosteric motifs.


Assuntos
Domínio Catalítico , Desoxirribonucleotídeos/química , Conformação Proteica , Ribonucleotídeo Redutases/química , Actinobacillus/enzimologia , Actinobacillus/genética , Trifosfato de Adenosina/química , Trifosfato de Adenosina/metabolismo , Regulação Alostérica , Sequência de Aminoácidos , Biocatálise , Cristalografia por Raios X , Desoxirribonucleotídeos/biossíntese , Desoxirribonucleotídeos/genética , Flavobacterium/enzimologia , Flavobacterium/genética , Modelos Moleculares , Filogenia , Ribonucleotídeo Redutases/classificação , Ribonucleotídeo Redutases/genética , Espalhamento a Baixo Ângulo , Homologia de Sequência de Aminoácidos , Difração de Raios X
15.
Radiat Prot Dosimetry ; 183(1-2): 32-35, 2019 May 01.
Artigo em Inglês | MEDLINE | ID: mdl-30753692

RESUMO

To identify the precise molecular processes to induce DNA lesions, we attempt a novel spectroscopy of X-ray induced luminescence (XIL) using soft X-ray synchrotron radiation, which is a non-destructive analysis of the reaction intermediates in the elementary reaction pathway of damage induction and self-organized restoration. Using a liquid micro-jet technique to introduce aqueous samples in a vacuum chamber, we measure UV-visible luminescence from nucleotide solution as a function of the soft X-ray energy from the nitrogen to oxygen K-edge region. The XIL intensities for the nucleotide solutions are significantly enhanced in the soft X-ray region (410-530 eV) which is ascribed to the K-shell excitation/ionization of nitrogen atoms in the nucleobases. Furthermore, the XIL spectra do not show any signature of X-ray absorption near-edge structure (XANES) of the nucleobases. This is because the luminescence intensities collected from the integral area of the micro-jet only reflect the quantum yield of luminescence of the absorbed X-ray into UV-visible light irrespective of the absorption cross sections, i.e. of XANES. Thus the present result is the first evidence of luminescence as a result of X-ray absorption of aqueous nucleotides.


Assuntos
DNA/química , DNA/efeitos da radiação , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/efeitos da radiação , Desenho de Equipamento , Concentração de Íons de Hidrogênio , Luminescência , Nitrogênio/química , Oxigênio/química , Síncrotrons , Água/química , Espectroscopia por Absorção de Raios X
16.
Biochemistry ; 57(26): 3934-3944, 2018 07 03.
Artigo em Inglês | MEDLINE | ID: mdl-29874056

RESUMO

We report high-resolution crystal structures of DNA polymerase (pol) ß in ternary complex with a panel of incoming dNTPs carrying acidity-modified 5'-triphosphate groups. These novel dNTP analogues have a variety of halomethylene substitutions replacing the bridging oxygen between Pß and Pγ of the incoming dNTP, whereas other analogues have alkaline substitutions at the bridging oxygen. Use of these analogues allows the first systematic comparison of effects of 5'-triphosphate acidity modification on active site structures and the rate constant of DNA synthesis. These ternary complex structures with incoming dATP, dTTP, and dCTP analogues reveal the enzyme's active site is not grossly altered by the acidity modifications of the triphosphate group, yet with analogues of all three incoming dNTP bases, subtle structural differences are apparent in interactions around the nascent base pair and at the guanidinium groups of active site arginine residues. These results are important for understanding how acidity modification of the incoming dNTP's 5'-triphosphate can influence DNA polymerase activity and the significance of interactions at arginines 183 and 149 in the active site.


Assuntos
DNA Polimerase beta/química , Desoxirribonucleotídeos/química , Domínio Catalítico , Humanos , Relação Estrutura-Atividade
17.
ACS Synth Biol ; 7(6): 1565-1572, 2018 06 15.
Artigo em Inglês | MEDLINE | ID: mdl-29746092

RESUMO

We report the design and elaboration of a selection protocol for importing a canonical substrate of DNA polymerase, thymidine triphosphate (dTTP) in Escherichia coli. Bacterial strains whose growth depend on dTTP uptake, through the action of an algal plastid transporter expressed from a synthetic gene inserted in the chromosome, were constructed and shown to withstand the simultaneous loss of thymidylate synthase and thymidine kinase. Such thyA tdk dual deletant strains provide an experimental model of tight nutritional containment for preventing dissemination of microbial GMOs. Our strains transported the four canonical dNTPs, in the following order of preference: dCTP > dATP ≥ dGTP > dTTP. Prolonged cultivation under limitation of exogenous dTTP led to the enhancement of dNTP transport by adaptive evolution. We investigated the uptake of dCTP analogues with altered sugar or nucleobase moieties, which were found to cause a loss of cell viability and an increase of mutant frequency, respectively. E. coli strains equipped with nucleoside triphosphate transporters should be instrumental for evolving organisms whose DNA genome is morphed chemically by fully substituting its canonical nucleotide components.


Assuntos
Evolução Molecular Direcionada/métodos , Escherichia coli/genética , Escherichia coli/metabolismo , Nucleotídeos de Timina/metabolismo , Proteínas da Membrana Bacteriana Externa/genética , Decitabina/química , Decitabina/metabolismo , Nucleotídeos de Desoxicitosina/genética , Nucleotídeos de Desoxicitosina/metabolismo , Nucleotídeos de Desoxiguanina/genética , Nucleotídeos de Desoxiguanina/metabolismo , Desoxirribonucleotídeos/química , Desoxirribonucleotídeos/metabolismo , Escherichia coli/crescimento & desenvolvimento , Proteínas de Escherichia coli/genética , Microalgas/genética , Microrganismos Geneticamente Modificados , Taxa de Mutação , Peptídeo Hidrolases/genética , Timidina Quinase/genética , Timidilato Sintase/genética , Nucleotídeos de Timina/genética
18.
Phys Chem Chem Phys ; 20(4): 2890-2903, 2018 Jan 24.
Artigo em Inglês | MEDLINE | ID: mdl-29327000

RESUMO

A modification of the principal component regression model is proposed for obtaining a fixed set of atomic charges (referred to as dipole-derived charges) optimized for reproducing the dipole moment of a conformationally rich molecule, i.e., a molecule with multiple local minima on the potential energy surface. The method does not require any adjustable parameters and requires the geometries of conformers, their dipole moments and atomic polar tensor (APT) charges as the only input data. The fixed atomic charges generated by the method not only reproduce the molecular dipole moment in all the conformers accurately, but are also numerically close to the APT charges, thereby ensuring accurate reproduction of the dipole moment variations caused by small geometrical distortions (e.g., by vibrations) of the conformers. The proposed method has been applied to canonical 2'-deoxyribonucleotides, the model DNA monomers, and the dipole-derived charges have been shown to outperform both the averaged APT and RESP charges in reproducing the dipole moments of large sets of conformers, thus demonstrating a potential usefulness of the dipole-derived charges as a 'reference point' for modeling polarization effects in conformationally rich molecules.


Assuntos
Desoxirribonucleotídeos/química , Modelos Moleculares , Conformação Molecular , Teoria Quântica
19.
Langmuir ; 34(49): 14975-14982, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29228772

RESUMO

Calcium phosphate (CaP) has long been used for DNA delivery, although its fundamental interaction with DNA, especially with single-stranded DNA oligonucleotides, remains to be fully understood. Using fluorescently labeled oligonucleotides, we herein studied DNA adsorption isotherm and the effect of DNA length and sequence. Longer DNAs are adsorbed more strongly, and at neutral pH, poly-C DNAs are adsorbed more than the other three DNA homopolymers. However, at near pH 11, the pH of CaP synthesis, T30 DNA is adsorbed more strongly than C30 or A30. This can explain why T30 and G30 can fully inhibit the growth of CaP, while A30 and C30 only retarded its growth kinetics. DNA adsorption also reduces aggregation of CaP. DNA desorption experiments were carried out using concentrated urea, thymidine, or inorganic phosphate as competitors, and desorption was observed only in the presence of phosphate, suggesting that DNA uses its phosphate backbone to interact with the CaP surface. Desorption was also promoted by raising the NaCl concentration suggesting the electrostatic nature of interaction. Finally, ten different metal phosphate materials were synthesized by co-precipitating each metal ion (Ce3+, Fe3+, Ca2+, Ni2+, Zn2+, Mn2+, Ba2+, Cu2+, Sr2+, Co2+), and DNA adsorption by these phosphate precipitants was found to be related to their surface charge and metal chemistry. This work has revealed fundamental surface science of DNA adsorption by CaP and other metal phosphate salts, and this knowledge might be useful for gene delivery, biomineralization, and DNA-directed assembly of metal phosphate materials.


Assuntos
Fosfatos de Cálcio/química , Desoxirribonucleotídeos/química , Adsorção , Cristalização , Fluorescência , Concentração de Íons de Hidrogênio , Metais Pesados/química , Estrutura Molecular , Poli G/química , Poli T/química
20.
Nucleic Acids Res ; 45(15): 9138-9148, 2017 Sep 06.
Artigo em Inglês | MEDLINE | ID: mdl-28911097

RESUMO

While most DNA polymerases discriminate against ribonucleotide triphosphate (rNTP) incorporation very effectively, the Family X member DNA polymerase µ (Pol µ) incorporates rNTPs almost as efficiently as deoxyribonucleotides. To gain insight into how this occurs, here we have used X-ray crystallography to describe the structures of pre- and post-catalytic complexes of Pol µ with a ribonucleotide bound at the active site. These structures reveal that Pol µ binds and incorporates a rNTP with normal active site geometry and no distortion of the DNA substrate or nucleotide. Moreover, a comparison of rNTP incorporation kinetics by wildtype and mutant Pol µ indicates that rNTP accommodation involves synergistic interactions with multiple active site residues not found in polymerases with greater discrimination. Together, the results are consistent with the hypothesis that rNTP incorporation by Pol µ is advantageous in gap-filling synthesis during DNA double strand break repair by nonhomologous end joining, particularly in nonreplicating cells containing very low deoxyribonucleotide concentrations.


Assuntos
Reparo do DNA por Junção de Extremidades , DNA Polimerase Dirigida por DNA/química , DNA/química , Desoxirribonucleotídeos/química , Ribonucleotídeos/química , Motivos de Aminoácidos , Sequência de Bases , Domínio Catalítico , Clonagem Molecular , Cristalografia por Raios X , DNA/metabolismo , DNA Polimerase Dirigida por DNA/genética , DNA Polimerase Dirigida por DNA/metabolismo , Desoxirribonucleotídeos/metabolismo , Escherichia coli/genética , Escherichia coli/metabolismo , Expressão Gênica , Humanos , Cinética , Modelos Moleculares , Conformação de Ácido Nucleico , Ligação Proteica , Conformação Proteica em alfa-Hélice , Conformação Proteica em Folha beta , Domínios e Motivos de Interação entre Proteínas , Proteínas Recombinantes/química , Proteínas Recombinantes/genética , Proteínas Recombinantes/metabolismo , Ribonucleotídeos/metabolismo , Especificidade por Substrato , Termodinâmica
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...