Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 595
Filtrar
Mais filtros










Base de dados
Intervalo de ano de publicação
1.
Int J Syst Evol Microbiol ; 70(1): 65-70, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31517595

RESUMO

A Gram-stain-negative, strictly aerobic, catalase-positive and oxidase-positive bacterium, designated strain YIM MLB12T, was isolated from estuary sediment sampled at Maliao River where it flows into a plateau lake (Dianchi) in Yunnan, south-west PR China. Cells were non-motile and rod-shaped. Growth was observed at 15-35 °C (optimum, 25-30 °C), pH 6.0-10.0 (optimum, pH 7.0-8.0) and in the presence of 0-7 % (w/v) NaCl (optimum, 0.5-2 %). Results of phylogenetic analysis based on 16S rRNA gene sequences showed that strain YIM MLB12T formed a tight phylogenic lineage with members of the genus Lampropedia and was closely related to 'Lampropedia puyangensis' 2-bin with 98.3 % sequence similarity and had low similarities to the type strains of Lampropediahyalina ATCC 11041T (96 %) and Lampropedia cohaerens CT6T (95.5 %). Average nucleotide identity and in silico DNA-DNA hybridization values between strain YIM MLB12T and 'L. puyangensis' KCTC 32235 were 76.5 and 22.6 %, respectively. Strain YIM MLB12T contained ubiquinone-8 as the major quinone. The predominant cellular fatty acids were summed feature 3 (C16 : 1 ω7c and/or C16 : 1 ω6c), C16 : 0, C10 : 0 3-OH, summed feature 8 (C18 : 1 ω6c and/or C18 : 1 ω7c), C12 : 0 3-OH and C14 : 0. The polar lipid profile of strain YIM MLB12T was composed predominantly of diphosphatidylglycerol, phosphatidylmonomethylethanolamine, phosphatidylethanolamine and phosphatidylglycerol. The major polyamine was spermidine. The genomic DNA G+C content of strain YIM MLB12T was 56.8 mol%. Based on its genotypic and chemotaxonomic features and results of phenotypic analyses, strain YIM MLB12T represents a novel species of the genus Lampropedia, for which the name Lampropediaaestuarii sp. nov. is proposed. The type strain is YIM MLB12T (=KCTC 42886T=CGMCC 1.17071T).


Assuntos
Comamonadaceae/classificação , Estuários , Filogenia , Rios/microbiologia , Microbiologia da Água , Técnicas de Tipagem Bacteriana , Composição de Bases , China , Comamonadaceae/isolamento & purificação , DNA Bacteriano/genética , Ácidos Graxos/química , Sedimentos Geológicos/microbiologia , Hibridização de Ácido Nucleico , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/química , Ubiquinona/química
2.
Int J Syst Evol Microbiol ; 70(1): 522-529, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31596192

RESUMO

A yellow-coloured, Gram-negative, motile, strictly aerobic bacterial strain, designated strain DAC4T, was isolated from a soil sample collected at Ahnmok Beach (Busan, Republic of Korea). The cells of strain DAC4T were rod-shaped and the colonies that formed were round and convex. The results of phylogenetic analysis based on the 16S rRNA gene sequence of strain DAC4T revealed that the bacterium belongs to the genus Sphingomonas, family Sphingomonadaceae, and that it was most closely related to Sphingomonas jaspsi DSM 18422T (98.01 %), Sphingomonas rhizophila KACC 19189T (97.76 %), Sphingomonas mesophila KCTC 62179T(97.30 %), Sphingomonas sedimincola KCTC 12629T (97.16 %) and Sphingomonas oryziterrae KCTC 22476T (97.05 %). The major respiratory quinone was Q-10, and the major cellular fatty acids were summed feature 8 (C18  :  1ω7c) and summed feature 3 (C16  :  1ω7c/C16  :  1ω6c). The whole genome DNA G+C content of strain DAC4T was 62.16 mol%. Phosphatidylethanolamine, diphosphatidylglycerol, sphingoglycolipids, phosphatidylglycerol, phosphatidylcholine, four undefined glycolipids and an undefined lipid were detected in strain DAC4T, and the strain had sym-homospermidine as a major polyamine. The in silico DNA-DNA hybridization and average nucleotide identity values between strain DAC4T and the closely related taxa S. jaspsi and S. mesophila were 75.5/23.5 % and 73.5 /18.5%, respectively. The fluorimetric DNA-DNA hybridization results showed that strain DAC4T and S. rhizophila, S. sediminicola and S. oryziterrae have 37.1, 35.2 and 32.2 % DNA similarity, respectively. Based on phylogenetic, phenotypic and chemotaxonomic distinctiveness, strain DAC4T (=KCTC 62107T=JCM 32377T) is classified as a novel species of the genus Sphingomonas, for which the name Sphingomonas edaphi sp. nov. is proposed.


Assuntos
Praias , Filogenia , Microbiologia do Solo , Sphingomonas/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácidos Graxos/química , Glicolipídeos/química , Hibridização de Ácido Nucleico , Fosfolipídeos/química , RNA Ribossômico 16S/genética , República da Coreia , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/análogos & derivados , Ubiquinona/química
3.
Int J Syst Evol Microbiol ; 70(1): 309-316, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31596696

RESUMO

Strain TLA-22T, isolated from a cold spring in Taiwan, was characterized using a polyphasic taxonomy approach. Cells were Gram-stain-negative, aerobic, poly-ß-hydroxybutyrate-accumulating, motile by means of a single polar flagellum, rod-shaped and formed bright yellow colonies. Optimal growth occurred at 20-25 °C, pH 6-6.5, and in the presence of 0.5 % NaCl. The major fatty acids of TLA-22T were C18 : 1 ω7 c and C17 : 1ω6c. The predominant hydroxy fatty acids were C15 : 0 2-OH and C14 : 0 2-OH. The polar lipid profile consisted of a mixture of phosphatidylethanolamine, phosphatidylglycerol, diphosphatidylglycerol, phosphatidyldimethylethanolamine, sphingoglycolipid, an unidentified aminophospholipid, an unidentified phospholipid and three unidentified lipids. TLA-22T contained spermidine as the major polyamine and putrescine as the minor component. The only isoprenoid quinone was Q-10. The genomic DNA G+C content of TLA-22T was 63.2 mol%. Phylogenetic analyses based on 16S rRNA gene sequences and coding sequences of 92 protein clusters indicated that TLA-22T was a mem,ber of a phylogenetic lineage including members of the genus Sphingobium. TLA-22T was most closely related to Sphingobium aromaticiconvertens RW16T, with a 97.4 % 16S rRNA gene sequence similarity. TLA-22T showed 74.8-75.7 % average nucleotide identity and 20.1-22.0 % digital DNA-DNA hybridization identity with the strains of other species of the genus Sphingobium. On the basis of phenotypic and genotypic properties and phylogenetic inference, strain TLA-22T should be classified as representing a novel species of the genus Sphingobium, for which the name Sphingobium algorifonticola sp. nov. is proposed. The type strain is TLA-22T (=BCRC 81097T =LMG 30309T=KCTC 62189T).


Assuntos
Nascentes Naturais/microbiologia , Filogenia , Sphingomonadaceae/classificação , Microbiologia da Água , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácidos Graxos/química , Hidroxibutiratos , Hibridização de Ácido Nucleico , Fosfolipídeos/química , Pigmentação , Poliésteres , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/química , Sphingomonadaceae/isolamento & purificação , Taiwan , Ubiquinona/análogos & derivados , Ubiquinona/análise
4.
Artigo em Inglês | MEDLINE | ID: mdl-31877428

RESUMO

Lycium barbarum fruit (Goji berry) have been used as a traditional Chinese medicine (TCM) with its outstanding biological and pharmacological activities. Spermidine alkaloids are a major class of bioactive constituents in goji berry, nevertheless, detailed information related to its identification remains scarce. In this study, chemical profiling of spermidines in goji berry was carried out by ultrahigh-performance liquid chromatography-quadrupole time-of-flight mass spectrometry (UPLC-Q-TOF/MS). Four structure types of standards were used to study the comprehensive fragmentation rules of spermidines. Different types of spermidines were identified by distinctive MS/MS fragment ions. Noticeably, it was first proposed that the co-existence of fragment ions at m/z 220 and 222 was the key characteristic for distinguishing spermidine isomers. According to the structural feature of spermidines, a quick, convenient, highly selective strong cation exchange solid-phase extraction (SCX-SPE) combined with RP-LC procedure was developed for selective enrichment and the MS detection compatibility. A total of 41 out of 58 spermidines were tentatively characterized using the established method, of which 26 were reported for the first time from goji berry. This study provides guidelines and references for the identification of spermidines in natural products.


Assuntos
Cromatografia Líquida de Alta Pressão/métodos , Lycium/química , Espermidina , Espectrometria de Massas em Tandem/métodos , Alcaloides/análise , Alcaloides/química , Cromatografia por Troca Iônica/métodos , Extratos Vegetais/química , Extração em Fase Sólida/métodos , Espermidina/análise , Espermidina/química
5.
Int J Syst Evol Microbiol ; 69(12): 3702-3709, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31671048

RESUMO

Strain YZ-8T, isolated from soil sampled at Fildes Peninsula, Antarctica, was found to be a Gram-stain-negative, yellow-pigmented, oxidase- and catalase-positive, non-motile, non-spore-forming, rod-shaped and aerobic bacterium. Strain YZ-8T grewoptimally at pH 7.0 and 20 °C. Tolerance to NaCl was up to 0.3 % (w/v) with optimum growth in the absence of NaCl. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain YZ-8T belonged to the family Sphingomonas. Strain YZ-8T showed the highest sequence similarities to Sphingomonas molluscorum KMM 3882T (94.4 %), Sphingomonas oligophenolica JCM 12082T (94.4 %), Sphingomonas gotjawalisoli SN6-9T (94.3 %) and Sphingomonas aquatica W1-2-1T (94.3 %). The predominant respiratory isoprenoid quinone and polyamine components were identified as ubiquinone Q-10 and sym-homospermidine, respectively. In addition, carotenoid were also found. The polar lipid profile of the strain YZ-8T was found to contain one phosphatidylethanolamine, an unidentified phospholipid, one diphosphatidylglycerol, one phosphatidylglycerol, two sphingophosphonolipids, one phosphatidylcholine and two unidentified alkali-stable lipids. The G+C content of the genomic DNA was determined to be 58.8 mol%. The main fatty acids were summed feature 8 (comprising C18 : 1ω7c and/or C18 : 1ω6c; 35.4 %), summed feature 3 (comprising C16 : 1ω7c and/or C16 : 1ω6c; 32.6 %) and C14 : 0 2-OH (7.7 %). On the basis of the evidence presented in this study, a novel species of the genus Sphingomonas, Sphingomonaspaeninsulae sp. nov., is proposed, with the type strain YZ-8T (=CCTCC AB 2017137T=LMG 31027T).


Assuntos
Filogenia , Microbiologia do Solo , Sphingomonas/classificação , Regiões Antárticas , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácidos Graxos/química , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/análogos & derivados , Ubiquinona/química
6.
Int J Syst Evol Microbiol ; 69(12): 3955-3960, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31665096

RESUMO

A yellow-pigmented bacterial strain, designated T13T, was isolated from the rhizosphere soil of Alhagi sparsifolia collected from Xinjiang, PR China. Cells were rod-shaped, Gram-stain-negative, aerobic and gliding. Strain T13T grew optimally at 25-30 °C and pH 7.0-8.0 with a NaCl tolerance of 0-2 % on Reasoner's 2A agar. Phylogenetic analysis based on the 16S rRNA gene sequence showed that strain T13T belonged to the genus Flavobacterium within the family Flavobacteriaceae and was closely related to Flavobacterium nitrogenifigens KCTC 42884T with a similarity value of 97.4 %. The major polar lipid was phosphatidylethanolamine; the only respiratory quinone was MK-6, and the polyamine profile contained sym-homospermidine as the major polyamine and a trace amount of spermidine. The major fatty acids were iso-C15 : 0, C16 :  1ω7c and summed feature 3 (comprising C16 : 1ω7c or C16 : 1ω6c). The G+C content of the genomic DNA was 34.1 mol%. It is concluded from the phenotypic and genotypic data that strain T13T represents a novel species of the genus Flavobacterium, for which the name Flavobacteriumustbae sp. nov. with the type strain T13T (=KCTC 62874T=ACCC 60126T) is proposed.


Assuntos
Fabaceae/microbiologia , Flavobacterium/classificação , Filogenia , Rizosfera , Microbiologia do Solo , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Flavobacterium/isolamento & purificação , Fosfatidiletanolaminas/química , Fosfolipídeos/química , Pigmentação , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Vitamina K 2/análogos & derivados , Vitamina K 2/química
7.
Int J Syst Evol Microbiol ; 69(11): 3472-3477, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31418668

RESUMO

A Gram-stain-negative, strictly aerobic, motile, yellow, rod-shaped bacterium, designated ZDH117T, was isolated from soilsampled atthe Danxialandformin Guangdong Province, PR China. The 16S rRNA gene sequence of strain ZDH117T had highest similarityvalues to Sphingomonas adhaesivaDSM 7418T (97.5 %), SphingomonasdesiccabilisCP1DT (97.3 %) and Sphingomonas ginsenosidimutans KACC 14949T (97.2 %). However, phylogenetic analyses based on 16S rRNA gene sequences demonstrated that strain ZDH117T clustered with Sphingomonas zeicaulis 541T (96.17 %) and Sphingomonas sanxanigenens DSM 19645T (95.95 %). The genomic average nucleotide identity values of ZDH117T with S. adhaesiva DSM 7418T, S. desiccabilis CP1DTand S. ginsenosidimutans KACC TT were 75.1, 75.2 and 75.0 %, respectively. The G+C content of the genomic DNA was 67.6 mol%. Strain ZDH117T was characterized to have ubiquinone-10 as the predominant respiratory quinone, sym-homospermidine as the major polyamine and summed feature 8 (C18 : 1ω6c and/or C18 : 1ω7c), C14 : 0-2OH, C16 : 0 and summed feature 3 (C16 : 1ω6c and/or C16 : 1ω7c) as the major cellular fatty acids (>5 % of total). The predominant polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, sphingoglycolipid, an unidentified phospholipid and three unidentified lipids. On the basis of its phenotypic, chemotaxonomic and phylogenetic characteristics, strain ZDH117T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas gilva sp. nov. is proposed. The type strain is ZDH117T (=KCTC 62894T=CCTCCAB 2018262T).


Assuntos
Filogenia , Microbiologia do Solo , Sphingomonas/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Fosfolipídeos/química , Pigmentação , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/química
8.
DNA Cell Biol ; 38(10): 1048-1055, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31433200

RESUMO

DNA condensed agents can improve the transfection efficiency of the cationic liposome delivery system. However, various condensed agents have distinct transfection efficiency and cellular cytotoxicity. The object of this study was to screen the optimal agents with the high transfection efficiency and low cytotoxicity from four polymer compressive materials, polyethylenimine (PEI), chitosan, poly-l-lysine (PLL), and spermidine. DNA was precompressed with these four agents and then combined to cationic liposomes. Subsequently, the entrapment and transfection efficiency of the obtained complexes were investigated. Finally, the particle sizes, cytotoxicity, and endocytosis fashion of these copolymers (Lipo-PEI, Lipo-chitosan, Lipo-PLL, and Lipo-spermidine) were examined. It was found that these four copolymers had significantly lower cytotoxicity and higher transfection efficiency (45.5%, 42.4%, 36.8%, and 47.4%, respectively) than those in the control groups. The transfection efficiency of Lipo-PEI and Lipo-spermidine copolymers were better than the other two copolymers. In 293T cells, nystatin significantly inhibited the transfection efficiency of Lipo-PEI-DNA and Lipo-spermidine-DNA (51.88% and 46.05%, respectively), which suggest that the endocytosis pathway of Lipo-spermidine and Lipo-PEI copolymers was probably caveolin dependent. Our study indicated that these dual-degradable copolymers especially liposome-spermidine copolymer could be used as the potential biocompatible gene delivery carriers.


Assuntos
Quitosana/química , Lipossomos/química , Polietilenoimina/química , Polilisina/química , Espermidina/química , Transfecção/métodos , Cátions , Caveolina 1/genética , Caveolina 1/metabolismo , Quitosana/metabolismo , Colesterol/química , Colesterol/metabolismo , Endocitose/efeitos dos fármacos , Endocitose/genética , Ácidos Graxos Monoinsaturados/química , Ácidos Graxos Monoinsaturados/metabolismo , Células HEK293 , Humanos , Lipossomos/metabolismo , Nistatina/farmacologia , Tamanho da Partícula , Plasmídeos/química , Plasmídeos/metabolismo , Polietilenoimina/metabolismo , Polilisina/metabolismo , Compostos de Amônio Quaternário/química , Compostos de Amônio Quaternário/metabolismo , Espermidina/metabolismo
9.
Int J Syst Evol Microbiol ; 69(9): 2936-2941, 2019 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-31310195

RESUMO

A novel Gram-stain-negative, strictly aerobic, non-spore-forming, motile with one polar flagellum and short rod-shaped bacterium, designated strain ZLT-5T, was isolated from procymidone-contaminated soil sampled in Nanjing, Jiangsu, PR China. Growth occurred at 26-37 °C (optimum, 37 °C), at pH 6.0-9.0 (pH 7.0) and in the presence of 0-1.5 % NaCl (0.5 %). Phylogenetic analysis based on the 16S rRNA gene sequences showed that strain ZLT-5T belonged to the genus Sphingomonas, with the highest sequence similarity to Sphingomonas kyeonggiensis THG-DT81T (96.6 %), followed by Sphingomonas dokdonensis DSM 21029T (96.5 %) and Sphingomonas silvisoli RP18T (96.3 %). The G+C content of strain ZLT-5T was 68.0 mol% (draft genome sequence). The average nucleotide identity value of the draft genomes between strain ZLT-5T and S. kyeonggiensis THG-DT81T was 75.4 %. Strain ZLT-5T contained ubiquinone-10 as the predominant isoprenoid quinone and sym-homospermidine as the major polyamine. The major polar lipids consisted of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, phosphoaminolipid and sphingoglycolipid. The main cellular fatty acids (>10 % of the total fatty acids) of strain ZLT-5T were C17 : 1ω6c, summed feature 3 (C16 : 1ω7c and/or C15 : 0 ISO 2-OH) and summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c). Based on phylogenetic analysis and physiological and biochemical characterization, strain ZLT-5T is described as a novel species of the genus Sphingomonas, for which the name Sphingomonas flavalba sp. nov. is proposed. The type strain is ZLT-5T (=CCTCC AB 2018188T=KCTC 62840T).


Assuntos
Compostos Bicíclicos com Pontes , Filogenia , Microbiologia do Solo , Poluentes do Solo , Sphingomonas/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/química
10.
Food Chem ; 297: 125027, 2019 Nov 01.
Artigo em Inglês | MEDLINE | ID: mdl-31253341

RESUMO

The structure and the cation-exchange functional groups of hybrid silica materials were evaluated for the effective detoxification of hydroalcoholic solutions containing eight toxic biogenic amines (BA) usually found in fermented beverages. Results show the effectiveness of the removal is related to the number of amino functions in the extracted molecule, retention by the solid being more effective in the case of multiple amino groups, since retention is stabilized through interaction with the material surface at several points. BA with one amino function (isoamylamine, tyramine, ß-phenylethylamine), in general, showed a weak retention by the solids. For BA with more than two amine groups (spermine, spermidine), the removal rate was close to 100% for all studied materials. For histamine, cadaverine and putrescine, the removal percentages were higher with a lamellar structured sulfonic acid functionalized material and with bifunctional materials (SBA-15 type and macroporous) containing sulfonic/phosphonic acid groups obtained by co-condensation sol-gel route.


Assuntos
Aminas Biogênicas/química , Dióxido de Silício/química , Adsorção , Aminas/química , Aminas Biogênicas/análise , Cadaverina/química , Cromatografia Líquida de Alta Pressão , Géis/química , Histamina/química , Espectrometria de Massas , Porosidade , Putrescina/química , Espermidina/química , Espermina/química , Ácidos Sulfônicos/química , Propriedades de Superfície , Tiramina/química
11.
Int J Syst Evol Microbiol ; 69(8): 2452-2458, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31166165

RESUMO

A Gram-stain-negative, aerobic, yellow-pigmented, oxidase-positive and rod-shaped bacterium, designated PRB40T, was isolated from the Godavari River in India during the course of 'Kumbh Mela', the world's largest mass gathering event. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain PRB40T formed a lineage within the family Sphingomonadaceae and was distinct from the most closely related genera Sphingorhabdus, Novosphingobiumand Sphingomonas with sequence similarity values ≤95.2 %. Growth of strain PRB40T occurred at 10-40 °C (optimum 30 °C), at pH 6.0-9.0 (pH 7.0) and with 0-0.5 % (w/v) NaCl concentration (0 %). The major respiratory quinone was ubiquinone-10 (Q-10). It contained C17 : 1ω6c, C14 : 0 2-OH, summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c) and summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c) as the major cellular fatty acids. The predominant polar lipids were phospholipid, phosphatidylethanolamine and sphingoglycolipid. It took sym-homospermidine as the major polyamine. The DNA G+C content based on its draft genome sequence was 63.7 mol%. The polyphasic taxonomic analyses indicated that strain PRB40T represents a novel species of a novel genus within the family Sphingomonadaceae, for which the name Chakrabartia godavariana gen. nov., sp. nov. is proposed. The type strain of Chakrabartia godavariana is PRB40T (=MCC 3406T=GDMCC 1.1197T=KCTC 52678T=LMG 29985T).


Assuntos
Filogenia , Rios/microbiologia , Sphingomonadaceae/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácidos Graxos/química , Índia , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Microbiologia do Solo , Espermidina/análogos & derivados , Espermidina/química , Sphingomonadaceae/isolamento & purificação , Ubiquinona/química
12.
Environ Sci Pollut Res Int ; 26(22): 22338-22350, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31154641

RESUMO

A pot experiment was performed to assess the useful effects of seed soaking or seedling foliar spray using 0.25 mM spermine (Spm), 0.50 mM spermidine (Spd), or 1 mM putrescine (Put) on heavy metal tolerance in wheat plants irrigated with water contaminated by cadmium (2 mM Cd2+ in CdCl2) or lead (2 mM Pb2+ in PbCl2). Cd2+ or Pb2+ presence in the growth medium resulted in significant reductions in growth and yield characteristics and activities of leaf peroxidase (POD), glutathione reductase (GR), ascorbic acid oxidase (AAO), and polyphenol oxidase (PPO) of wheat plants. In contrast, significant increases were observed for Cd2+ content in roots, leaves and grains, superoxide dismutase (SOD) and catalase (CAT) activities, radical scavenging activity (DPPH), reducing power capacity, and fragmentation in DNA in comparison to controls (without Cd2+ or Pb2+ addition). However, treating the Cd2+- or Pb2+-stressed wheat plants with Spm, Spd, or Put, either by seed soaking or foliar spray, significantly improved growth and yield characteristics and activities of POD, GR, AAO, PPO, SOD, and CAT, DPPH, and reducing power capacity in wheat plants. In contrast, Cd2+ levels in roots, leaves, and yielded grains, and fragmentation in DNA were significantly reduced compared with the stressed (with Cd2+ or Pb2+) controls. Generally, seed soaking treatments were more effective than foliar spray treatments. More specifically, seed priming in Put was the best treatment under heavy metal stress. Results of this study recommend using polyamines, especially Put, as seed soaking to relieve the adverse effects of heavy metals in wheat plants.


Assuntos
Antioxidantes/farmacologia , Inativação Metabólica/efeitos dos fármacos , Oxirredutases/metabolismo , Plântula/efeitos dos fármacos , Espermidina/farmacologia , Espermina/farmacologia , Superóxido Dismutase/metabolismo , Antioxidantes/química , Ácido Ascórbico/farmacologia , Cádmio/química , DNA , Genômica , Glutationa Redutase/metabolismo , Oxirredução , Peroxidases/metabolismo , Folhas de Planta/metabolismo , Poliaminas , Sementes/metabolismo , Espermidina/química , Triticum/crescimento & desenvolvimento
13.
Int J Syst Evol Microbiol ; 69(8): 2459-2464, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31169492

RESUMO

A Gram-stain-negative, strictly aerobic bacterial strain, designated EO9T, was isolated from gasoline-contaminated soil in the Republic of Korea. Cells were non-motile short rods showing catalase- and oxidase-positive reactions. Growth was observed at 10-37 °C (optimum, 30 °C), at pH 6.0-9.0 (pH 6.5) and in the presence of 0-0.5 % (w/v) NaCl (0 %). Ubiquinone-10 (Q-10) and spermidine were identified as the predominant respiratory quinone and polyamine, respectively. Summed feature 8 (comprising C18:1ω7c/C18:1ω6c), summed feature 3 (comprising C16:1ω7c/C16:1ω6c), C16:0 and C14:0 2-OH were identified as major cellular fatty acids. The major polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, sphingoglycolipid, phosphatidylglycerol and an unidentified phospholipid. The G+C content of the genomic DNA was 62.8 mol%. Phylogenetic analyses based on 16S rRNA gene sequences showed that strain EO9T formed a tight phylogenetic lineage with Sphingobium xenophagum NBRC 107872T and Sphingobium hydrophobicum C1T within the genus Sphingobium. Strain EO9T was most closely related to S. xenophagum NBRC 107872T (97.2 %) and S. hydrophobicum C1T (97.2 %), but DNA-DNA relatedness levels between strain EO9T and the type strains of S. xenophagum and S. hydrophobicum were 37.1 and 36.8 % , respectively. Based on its phenotypic, chemotaxonomic and molecular features, strain EO9T clearly represents a novel species of the genus Sphingobium, for which the name Sphingobium terrigena sp. nov. is proposed. The type strain is EO9T (=KACC 19523T=JCM 32762T).


Assuntos
Gasolina , Filogenia , Microbiologia do Solo , Poluentes do Solo , Sphingomonadaceae/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácidos Graxos/química , Poluição por Petróleo , Fosfolipídeos/química , RNA Ribossômico 16S/genética , República da Coreia , Análise de Sequência de DNA , Espermidina/química , Sphingomonadaceae/isolamento & purificação , Ubiquinona/química
14.
Nucleic Acids Res ; 47(12): 6084-6097, 2019 07 09.
Artigo em Inglês | MEDLINE | ID: mdl-31114917

RESUMO

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove - in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.


Assuntos
DNA/química , Desoxirribonucleotídeos/química , Putrescina/química , Espermidina/química , Espermina/química , Simulação de Dinâmica Molecular , Conformação de Ácido Nucleico , Motivos de Nucleotídeos , Eletricidade Estática
15.
Int J Syst Evol Microbiol ; 69(10): 2972-2978, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31140971

RESUMO

A Gram-stain-negative, single polar flagellum bacterium, WZY27T, was isolated from rhizospheric soil of Araceae plants. The results of phylogenetic analysis based on 16S rRNA gene sequences showed that this strain is closely related to Sphingomonas adhaesiva DSM 7418T (97.2 % similarity), Sphingomonaskoreensis KCTC 2883 (97.1 %) and Sphingomonas ginsenosidimutans JCM 17074T (97.0 %). The genomic average nucleotide identity values between strain WZY27T and the above three strains were 75.3, 73.2 and 75.4 %, and the in silico DNA-DNA hybridization values were 19.1 , 20.1 and 20.9 %, respectively. The major fatty acids (>5 %) of strain WZY27T were summed feature 8 (C18 : 1 ω7c/C18 : 1 ω6c), C16 : 0, C14 : 0 2-OH and C18 : 1 ω7c 11-methyl. The predominant respiratory quinone and polyamine were ubiquinone Q-10 and homospermidine, respectively. The polar lipids were diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phospholipids, glycolipids, phosphatidylcholine and sphingoglycolipid. The G+C content of the genomic DNA was 68.4 mol%. Based on the results of genotypic, chemotaxonomic and phenotypic characterization, strain WZY27T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas aracearum sp. nov. is proposed. The type strain is WZY27T (=KCTC 62523T=CCTCC AB 2018056T).


Assuntos
Araceae/microbiologia , Filogenia , Rizosfera , Microbiologia do Solo , Sphingomonas/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Glicolipídeos/química , Hibridização de Ácido Nucleico , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/química
16.
Int J Syst Evol Microbiol ; 69(7): 2070-2075, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31099734

RESUMO

Two slightly beige-pigmented, Gram-stain-negative, rod-shaped bacterial strains, IMT-291T and IMT-297, were isolated from soil in a field located in Malvern, Alabama, USA. The source soil had been amended with humic acid and continuously used for the cultivation of worms used for fish bait. It is still conceivable that the source of the strains is from the humic acid amendment, although all attempts to isolate the novel phenotypes from the humic acid source have failed. The two strains were identical based on morphology, growth rate and subsequently by 16S rRNA gene sequences, but showed differences in genomic fingerprint patterns generated by rep-PCR. Phylogenetic analysis based on the 16S rRNA gene revealed a placement of the strain in a distinct cluster with Xinfangfangia soli (97.2 % 16S rRNA gene sequence similarity) and in close proximity to the genus Falsirhodobacter with highest 16S rRNA gene sequence similarity of 95.3 % to the type strain of Falsirhodobacter deserti. Sequence similarities to all other type strains were below 95.0 %. The chemotaxonomic analysis showed a clear similarity to the genus Xinfangfangia. The main cellular fatty acids of the strain were C18 : 1 ω7c, 11-methly-C18 : 1 ω7c and C16 : 0. The major quinone was ubiquinone Q-10. Phosphatidylethanolamine, phosphatidylmonomethylethanolamine, phosphatidylglycerol and phosphatidylcholine were predominant in the polar lipid profile. The polyamine pattern contained the major compound spermidine and moderate amounts of putrescine and cadaverine. The diamino acid of the peptidoglycan was meso-diaminopimelic acid. Based on phylogenetic, chemotaxonomic and phenotypic analyses we propose a new species of the genus Xinfangfangia, with the name Xinfangfangiahumi sp. nov. and strain IMT-291T (=LMG 30636T=CIP 111625T=CCM 8858T) as type strain.


Assuntos
Substâncias Húmicas/microbiologia , Filogenia , Rhodobacteraceae/classificação , Microbiologia do Solo , Alabama , Técnicas de Tipagem Bacteriana , Composição de Bases , Cadaverina/química , DNA Bacteriano/genética , Ácido Diaminopimélico/química , Ácidos Graxos/química , Fosfolipídeos/química , Putrescina/química , RNA Ribossômico 16S/genética , Rhodobacteraceae/isolamento & purificação , Análise de Sequência de DNA , Espermidina/química , Ubiquinona/análogos & derivados , Ubiquinona/química
17.
Int J Syst Evol Microbiol ; 69(8): 2214-2219, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31066661

RESUMO

A novel slowly growing member of the genus Sphingomonas, designated 1PNM-20T, was isolated from an abandoned lead-zinc mine in Meizhou, Guangdong Province, PR China. A polyphasic taxonomic study was performed to characterize the novel strain. Growth occurred on Reasoner's 2A (R2A) agar and peptone-yeast extract (PYE) agar, but not in liquid R2A or PYE media. Cells were Gram-stain-negative, aerobic, non-spore-forming, rod-shaped and motile with a polar flagellum (monotrichous). 16S rRNA gene sequence comparison showed that it shared the highest similarity with Sphingomonas carriPR0302T (97.2 %), followed by Sphingomonas spermidinifaciens 9NM-10T (97.0 %), Sphingomonas floccifaciens FQM01T (97.0 %) and other species of Sphingomonas (<97 %). Phylogenetic analyses clearly showed that strain 1PNM-20T fell into the cluster of Sphingomonas, and was most closely related to S. carri. The draft genome sequence was 3.76 Mb in length with a DNA G+C content of 69.8 mol%. Major fatty acids were summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c), summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c), C16 : 0 and 11-methyl C18 : 1ω7c, with C14 : 0 2-OH as the main hydroxy fatty acid. Ubiquinone 10 (Q-10) was the predominant respiratory quinone, and sym-homospermidine was displayed as the major polyamine. The polar lipids were composed of sphingoglycolipid, phosphatidylglycerol, diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, an unidentified phospholipid and an unidentified glycolipid. The phenotypic, phylogenetic and chemotaxonomic results supported the hypothesis that strain 1PNM-20T represents a novel species of the genus Sphingomonas, for which the name Sphingomonas lenta sp. nov. is proposed. The type strain is 1PNM-20T (=GDMCC 1.660T=DSM 27572T).


Assuntos
Filogenia , Microbiologia do Solo , Sphingomonas/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Glicolipídeos/química , Chumbo , Mineração , Fosfolipídeos/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/análogos & derivados , Espermidina/química , Sphingomonas/isolamento & purificação , Ubiquinona/química , Zinco
18.
Int J Syst Evol Microbiol ; 69(6): 1737-1743, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30958256

RESUMO

A moderately thermophilic, aerobic, Gram-stain-negative, non-spore-forming, rod-shaped and yellow-pigmented bacterium, designated strain SYSU G00007T, was isolated from a hot spring slurry sample. Optimum growth was observed at 37-45 °C and pH 7. Pairwise comparison of the 16S rRNA gene sequence of strain SYSU G00007T and other Novosphingobium species showed sequence similarities ranging from 93.7 to 97.9 %. Strain SYSU G00007T showed highest sequence identity to Novosphingobium subterraneum DSM 12447T (97.9 %). The average nucleotide identities and digital DNA-DNA hybridization values between strain SYSU G00007T and its closely related phylogenetic neighbours were below 81 and 31 %, respectively, indicating that strain SYSU G00007T represented a novel species of the genus Novosphingobium. The DNA G+C content of strain SYSU G00007T was 64.3 % (genome). The major respiratory quinone was ubiquinone Q-10. The polar lipid profile included diphosphatidylglycerol, phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, two sphingoglycolipids, two unidentified phospholipids, two unidentified aminophospholipids and two unidentified polar lipids. Spermidine was the only polyamine detected. The major fatty acids were C19 : 0cyclo ω8c, summed feature 8 (C18 : 1ω7c and/or C18 : 1ω6c) and C16 : 0. The results obtained from phylogenetic, chemotaxonomic and phenotypic analyses support the conclusion that strain SYSU G00007T represents a novel species of the genus Novosphingobium, for which we proposed the name Novosphingobiummeiothermophilum sp. nov. The type strain is SYSU G00007T (=KCTC 52672T=CCTCC AB2017010T).


Assuntos
Fontes Termais/microbiologia , Filogenia , Sphingomonadaceae/classificação , Técnicas de Tipagem Bacteriana , Composição de Bases , China , DNA Bacteriano/genética , Ácidos Graxos/química , Hibridização de Ácido Nucleico , Fosfolipídeos/química , Pigmentação , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/química , Sphingomonadaceae/isolamento & purificação , Ubiquinona/química
19.
Int J Syst Evol Microbiol ; 69(6): 1682-1688, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30958257

RESUMO

Two slightly orange-pigmented, oxidase-positive bacterial strains (M1-83T and M2-116), isolated from horse blood collected during slaughter in Giessen, Germany, were studied in a polyphasic taxonomic approach. Cells of the isolates were coccoid and stained Gram-negative. The two strains shared identical 16S rRNA gene sequences but their genomic fingerprint patterns differed, indicating the genetic distinctiveness of the two strains. A comparison of the 16S rRNA gene sequence of strain M1-83T with sequences of the type strains of the most closely related Paracoccus species showed highest sequence similarities to Paracoccus acridae (98.2 %) and Paracoccus aerius (98.1 %). 16S rRNA gene sequence similarities to all other Paracoccus species were below 97.6 %. The fatty acid profile of the two strains consisted mainly of the major fatty acids C18 : 1 ω7c and C18:0, which is typical for the genus Paracoccus. The polyamine patterns of strain M1-83T contained major amounts of putrescine and spermidine. The major quinone was ubiquinone Q-10. The diamino acid of the peptidoglycan was meso-diaminopimelic acid. The polar lipid profile was characterized by the major lipids diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylcholine, an unidentified aminolipid and an unidentified glycolipid. DNA-DNA hybridization experiments between M1-83T and the type strains of P. acridae and P. aerius resulted in similarity values of 17 % (reciprocal, 60 %) and 23 % (reciprocal 30 %), respectively. DNA-DNA hybridization results together with the differentiating biochemical and chemotaxonomic properties showed that strain M1-83T represents a novel Paracoccusspecies, for which the name Paracoccus haematequi sp. nov. (type strain M1-83T=LMG 30633T=CIP 111624T=CCM 8857T), is proposed.


Assuntos
Sangue/microbiologia , Cavalos/microbiologia , Paracoccus/classificação , Filogenia , Animais , Técnicas de Tipagem Bacteriana , Composição de Bases , DNA Bacteriano/genética , Ácido Diaminopimélico/química , Ácidos Graxos/química , Alemanha , Cavalos/sangue , Hibridização de Ácido Nucleico , Paracoccus/isolamento & purificação , Fosfatidilcolinas , Fosfolipídeos/química , Pigmentação , Putrescina/química , RNA Ribossômico 16S/genética , Análise de Sequência de DNA , Espermidina/química , Ubiquinona/química
20.
Colloids Surf B Biointerfaces ; 178: 525-529, 2019 Jun 01.
Artigo em Inglês | MEDLINE | ID: mdl-31004839

RESUMO

This work examines the influence of the charge distribution of trivalent cations on their interaction with soft anionic particles, using a combination of experimental measurements and theoretical modelling. In particular, we perform electrophoresis measurements to determine the zeta-potential of anionic liposomes in the presence of spermidine and lanthanum cations. We work in a range of electrolyte concentration where a reversal in the electrophoretic mobility of the liposomes is expected; however, unlike the case of lanthanum cations, spermidine does not induce mobility reversal of liposomes. As a result, the charge distribution within the counterion appears to be a key factor. This conclusion is supported by a theory that accounts for intra-ionic correlations, which has previously been successfully used to describe the colloidal electric double layer. It allows us to model spermidine as rod-like ions and lanthanum cations as point-like ions in order to test the importance of the ionic geometry in the interactions with soft particles such as lipid vesicles.


Assuntos
Íons/química , Lipídeos/química , Cátions/química , Eletroforese , Lantânio , Espermidina/química
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA