Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 478
Filtrar
1.
Graefes Arch Clin Exp Ophthalmol ; 257(7): 1453-1458, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31089872

RESUMO

PURPOSE: To evaluate ophthalmological and molecular findings in eight patients with a clinical diagnosis of neurofibromatosis type 2 (NF2). New pathological mutations are described and variability in the ophthalmic phenotype and NF2 allelic heterogeneity are discussed. METHODS: Eye examination was performed in eight NF2 patients, and it included the measurement of the visual acuity, biomicroscopy, dilated fundus examination, color fundus photography, infrared photography, and spectral domain optical coherence tomography (SD-OCT). Molecular analysis was performed with whole-exome sequencing using DNA derived from peripheral blood mononuclear cells from each individual. RESULTS: Ophthalmological features were present in all patients, ranging from subtle retinal alterations identified only using SD-OCT to severe ocular damage present at birth. Six mutations were observed: two patients with stop codon mutation as shown on table 1 and result section, three patients with frameshift mutation as shown on table 1 and result section. Three novel mutations were found among them. CONCLUSIONS: It is a descriptive study of a rare disease, with poor previous literature. Clinical and genetic data are shown, reviving the need to further studies to clarify the genotype-phenotype correlations in NF2.


Assuntos
DNA/genética , Oftalmopatias/etiologia , Genes da Neurofibromatose 2/fisiologia , Mutação , Neurofibromatose 2/diagnóstico , Retina/patologia , Tomografia de Coerência Óptica/métodos , Adolescente , Adulto , Análise Mutacional de DNA , Oftalmopatias/diagnóstico , Oftalmopatias/metabolismo , Feminino , Testes Genéticos , Humanos , Masculino , Pessoa de Meia-Idade , Neurofibromatose 2/complicações , Neurofibromatose 2/genética , Fenótipo , Retina/metabolismo , Acuidade Visual , Adulto Jovem
2.
Laryngoscope ; 129(4): 967-973, 2019 04.
Artigo em Inglês | MEDLINE | ID: mdl-30325044

RESUMO

OBJECTIVES/HYPOTHESIS: Unilateral vestibular schwannoma (VS) occurs with a lifetime risk of around 1 in 1,000 and is due to inactivation of the NF2 gene, either somatically or from a constitutional mutation. It has been postulated that familial occurrence of unilateral VS occurs more frequently than by chance, but no causal mechanism has been confirmed. STUDY DESIGN: Retrospective database analysis. METHODS: The likelihood of chance occurrence of unilateral VS, or occurring in the context of neurofibromatosis type 2 (NF2), was assessed using national UK audit data and data from the national NF2 database. Families with familial unilateral VS (occurrence in first- and second-degree relatives) were assessed for constitutional NF2 and LZTR1 genetic variants, and where possible the tumor was also analyzed. RESULTS: Approximately 1,000 cases of unilateral VS occurred annually in the United Kingdom between 2013 and 2016. Of these, 2.5 may be expected to have a first-degree relative who had previously developed a unilateral VS. The likelihood of this occurring in NF2 was considered to be as low as 0.05 annually. None of 28 families with familial unilateral VS had a constitutional NF2 intragenic variant, and in nine cases where the VS was analyzed, both mutational events in NF2 were identified and excluded from the germline. Only three variants of uncertain significance were found in LZTR1. CONCLUSIONS: Familial occurrence of unilateral VS is very unlikely to be due to a constitutional NF2 or definitely pathogenic LZTR1 variant. The occurrence of unilateral VS in two or more first-degree relatives is likely due to chance. This phenomenon may well increase in clinical practice with increasing use of cranial magnetic resonance imaging in older patients. LEVEL OF EVIDENCE: 2b Laryngoscope, 129:967-973, 2019.


Assuntos
Genes da Neurofibromatose 2 , Neuroma Acústico/genética , Adolescente , Adulto , Idoso , Criança , Pré-Escolar , Humanos , Pessoa de Meia-Idade , Estudos Retrospectivos , Adulto Jovem
3.
EBioMedicine ; 36: 252-265, 2018 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-30274821

RESUMO

BACKGROUND: The great majority of sporadic vestibular schwannomas (VSs) are due to the mutations of the NF2 gene encoding merlin. Sporadic VSs exhibit variable growth patterns and only a small fraction of the tumours are fast-growing; however, the underlying mechanisms remain undefined. METHODS: DNA sequencing and dosage analysis were used to identify the NF2 mutation status in sporadic schwannomas. The expression and sub-cellular localization of merlin and p53-MDM2 were assessed by immunoblotting, qRT-PCR and immunofluorescence. In vitro and in vivo studies were performed to reveal the effects of Nutlin-3 (a MDM2 inhibitor) and/or MG-132(a proteasome inhibitor) on schwannomas. The proliferation of schwannoma cells was assessed by CCK-8 assay, EdU staining and Flow cytometry analysis. FINDINGS: Double genetic hits of NF2 tended to occur in fast-growing tumours, characterized by the absence of merlin. The deregulation of p53-MDM2 was demonstrated to mediate merlin-deficient tumour growth, characterized by a nuclear accumulation of stabilized MDM2, contributing to a nuclear export of p53 for degradation. Nutlin-3 blocked the proliferation of schwannoma cells via a cooperative recovery of merlin and p53, accompanied by the shuttling of both proteins from the cytoplasm to the nucleus. We further demonstrated a difference in the sensitivity to Nutlin-3 between schwannoma cells with and without merlin expression. Nutlin-3 combined with MG-132 narrowed this between-group difference and triggered stronger inhibitory effects on the growth of schwannomas through coordinated reactivation of p53. INTERPRETATION: These findings present treatment strategies directed on the pathogenesis of sporadic schwannomas. FUND: National Natural Science Foundation of China.


Assuntos
Antineoplásicos/farmacologia , Imidazóis/farmacologia , Neurilemoma/genética , Piperazinas/farmacologia , Proteína Supressora de Tumor p53/genética , Animais , Linhagem Celular Tumoral , Sobrevivência Celular/efeitos dos fármacos , Sobrevivência Celular/genética , Modelos Animais de Doenças , Sinergismo Farmacológico , Regulação Neoplásica da Expressão Gênica , Genes da Neurofibromatose 2 , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Camundongos , Mutação , Neurilemoma/metabolismo , Neurilemoma/patologia , Complexo de Endopeptidases do Proteassoma/metabolismo , Ligação Proteica , Estabilidade Proteica , Proteólise , Proteína Supressora de Tumor p53/metabolismo , Ensaios Antitumorais Modelo de Xenoenxerto
4.
Otol Neurotol ; 39(9): e860-e871, 2018 10.
Artigo em Inglês | MEDLINE | ID: mdl-30106846

RESUMO

OBJECTIVES: 1) Describe the genetic alterations discovered in a series of sporadic vestibular schwannomas (VS). 2) Identify if more clinically aggressive variants possess different genetic alterations compared to more indolent-behaving VS. METHODS: Fresh frozen tumor and matched peripheral blood leukocytes from 23 individuals with sporadic VS were analyzed using whole-exome sequencing, tumor whole transcriptome expression profiling (mRNA-Seq), and tumor mate-pair analysis. Source cases included tumors with fast preoperative growth, giant tumors in young patients, tumors with macrocystic change, recurrent tumors following radiation or microsurgery, and indolent small tumors with minimal or no growth before surgery. Somatic and germ-line alterations of the NF2 gene and beyond the NF2 locus were identified and analyzed using complementing analyses. RESULTS: Biallelic somatic events involving the NF2 gene were discovered in every analyzed tumor specimen with no concurrent NF2 variants identified in matching peripheral blood specimens. Thirteen tumors showed loss of one chromosome 22 (ch22), 4 tumors showed copy-neutral 22q loss of heterozygosity, and 31 unique small variants in the NF2 gene were discovered. Of the latter, 10 were essential splice site, 11 frame shift, 7 stop gain, 2 missense, and 1 in-frame mutation. No other common or recurring NF2 mutations were identified. However, several other notable large chromosomal aberrations were discovered including 2 tumors with loss of a chromosome 21, 3 with loss of an X or Y chromosome, 1 with copy-neutral loss of heterozygosity in chromosome 15, and 1 with loss of 18p and 16q. All of these other major chromosomal abnormalities only occurred in tumors demonstrating a more aggressive phenotype. CONCLUSIONS: To date, few studies have used whole-exome sequencing, mate-pair analysis, and RNA-seq to profile genome-wide alterations in sporadic VS. Using high-throughput deep sequencing, "two-hit" alterations in the NF2 gene were identified in every tumor and were not present in peripheral blood supporting that all events were somatic. Type of NF2 gene alteration and accessory mutations outside the NF2 locus may predict phenotypic expression and clinical course.


Assuntos
Genes da Neurofibromatose 2 , Mutação , Neuroma Acústico/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Transtornos Cromossômicos , Feminino , Perfilação da Expressão Gênica , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia , Neuroma Acústico/patologia , Adulto Jovem
5.
World Neurosurg ; 117: e269-e279, 2018 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-29902598

RESUMO

OBJECTIVE: Vestibular schwannomas (VSs) can cause serious neurological defects including hearing loss and facial paralysis. The aim of this study is to identify whether Hippo signaling could be a potential targetable pathway for clinical treatment in VSs. METHODS: Gene expression profiling was performed in 10 sporadic VSs and 4 normal nerves to identify aberrant genes expression of the Hippo pathway. Western blotting and immunohistochemical staining were used to examine the expression of Hippo core components in 20 VS samples. Neurofibromatosis type 2 (NF2) gene sequencing was also performed in all tumors using sanger sequencing. Verteporfin, inhibitor of yes-associated protein (YAP)-TEA domain family member, was used to assess the effect of proliferation inhibition in human primary VS cells and RT4-D6P2T cell line. RESULTS: We found 51 differentially expressed genes of the Hippo pathway between VSs and healthy controls. Unsupervised analysis identified the 2 molecular variants that significantly related with distinct NF2 mutation status. The phosphorylation levels of large tumor suppressor 1 and YAP were significantly decreased in NF2-mutated VSs compared with wild-type VSs and normal nerves. Immunohistochemical staining showed that increased nuclear YAP expression in VSs was positively correlated with high Ki-67 index and low Merlin expression. Verteporfin reduced viability of primary VS cells and RT4-D6P2T cells. CONCLUSIONS: Our findings implicate that deregulation of the Hippo pathway as a molecular mechanism of pathogenesis in human VSs, and suggest inhibition of this pathway as a potential treatment strategy.


Assuntos
Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Neuroma Acústico/genética , Fosfoproteínas/metabolismo , Proteínas Serina-Treonina Quinases/metabolismo , Proteínas Adaptadoras de Transdução de Sinal/genética , Adulto , Idoso , Proliferação de Células/fisiologia , Regulação para Baixo/fisiologia , Feminino , Expressão Gênica/genética , Perfilação da Expressão Gênica , Genes da Neurofibromatose 2/fisiologia , Humanos , Masculino , Pessoa de Meia-Idade , Fosfoproteínas/genética , Fosforilação/fisiologia , Fármacos Fotossensibilizantes/farmacologia , Porfirinas/farmacologia , Proteínas Serina-Treonina Quinases/genética , Transdução de Sinais/genética , Fatores de Transcrição , Regulação para Cima/fisiologia , Verteporfina , Adulto Jovem
6.
Acta Neuropathol ; 135(6): 955-963, 2018 06.
Artigo em Inglês | MEDLINE | ID: mdl-29627952

RESUMO

Epigenetic patterns on the level of DNA methylation have already been shown to separate clinically relevant subgroups of meningiomas. We here set out to identify potential prognostic implications of epigenetic modification on the level of histones with focus on H3K27 trimethylation (H3K27me3). H3K27me3 was assessed by immunohistochemistry on 232 meningiomas from 232 patients. In 194 cases, trimethylation was detected in tumor cells. In 25 cases, staining was limited to vessels while all tumor cells were negative. Finally, 13 cases yielded equivocal staining patterns. Reduced abundance of H3K27me3 in cases with staining limited to vessels was confirmed by mass spectrometry on a subset of cases. Lack of staining for H3K27me3 in all tumor cells was significantly associated with more rapid progression (p = 0.009). In line, H3K27me3-negative cases were associated with a DNA methylation pattern of the more aggressive types among the recently introduced DNA methylation groups. Also, NF2 and SUFU mutations were enriched among cases with complete lack of H3K27me3 staining in tumor cells (p < 0.0001 and p = 0.029, respectively). H3K27me3 staining pattern added significant prognostic insight into WHO grade II cases and in the compound subset of WHO grade I and II cases (p = 0.04 and p = 0.007, respectively). However, it did not further stratify within WHO grade III cases. Collectively, these data indicate that epigenetic modifications beyond DNA methylation are involved in the aggressiveness of meningioma. It also suggests that H3K27me3 immunohistochemistry might be a useful adjunct in meningioma diagnostics, particularly for cases with WHO grade II histology or at the borderline between WHO grade I and II.


Assuntos
Metilação de DNA , Histonas/metabolismo , Neoplasias Meníngeas/metabolismo , Meningioma/metabolismo , Recidiva Local de Neoplasia/metabolismo , Idoso , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Estudos de Coortes , Epigênese Genética , Feminino , Genes da Neurofibromatose 2 , Histonas/genética , Humanos , Masculino , Neoplasias Meníngeas/genética , Neoplasias Meníngeas/patologia , Meningioma/genética , Meningioma/patologia , Pessoa de Meia-Idade , Mutação , Gradação de Tumores , Recidiva Local de Neoplasia/genética , Recidiva Local de Neoplasia/patologia , Prognóstico , Intervalo Livre de Progressão , Proteínas Repressoras/genética
7.
Arch Dis Child ; 103(5): 463-469, 2018 May.
Artigo em Inglês | MEDLINE | ID: mdl-29535107

RESUMO

OBJECTIVE: Onset of symptoms in severe sporadic neurofibromatosis type 2 (NF2) is typically within childhood; however, there is poor awareness of presenting features in young children, potentially resulting in delayed diagnosis and poorer outcome. We have reviewed presentation of sporadic paediatric NF2 to raise awareness of early features, highlighting those requiring further investigation. DESIGN: Patients diagnosed with NF2 at age ≤16 and seen between 2012 and 2015 were notified via the British Paediatric Neurology Surveillance Unit or identified through the English NF2 service. RESULTS: Epidemiological data estimate that 1 in 110 611 births are affected with childhood-onset NF2. Notes of 32 patients with sporadic NF2 were reviewed. Of those presenting under the age of 5, 89% (17/19) had ocular, 74% (14/19) dermatological and 58% (11/19) neurological signs; in 84% (16/19) features were multisystemic. Sixty-six per cent (21/32) had ≥1 atypical feature, including cerebellar hypoplasia in three cases (9%) and focal cortical dysplasia in five out of seven seizure-related presentations. Five cases presented with a sometimes transient or intermittent cranial nerve mononeuropathy. The mean delay to diagnosis was 3.16 years; in eight cases (25%) this exceeded 6 years. Most significant delay occurred in mononeuropathy, ophthalmological and/or seizure presentations, with a mean delay of 3, 4.5 and 6 years, respectively. Eighty-four per cent (27/32) of cases needed intervention in childhood. CONCLUSIONS: All non-vestibular schwannoma NF2 presentations in childhood had significant diagnostic delay. We emphasise the importance of detailed assessment of skin and eyes in unusual presentations and propose an aide to prompt timely referral to specialist services.


Assuntos
Neurofibromatose 2/diagnóstico , Adolescente , Fatores Etários , Criança , Pré-Escolar , Diagnóstico Tardio , Inglaterra/epidemiologia , Oftalmopatias/epidemiologia , Oftalmopatias/etiologia , Feminino , Genes da Neurofibromatose 2 , Humanos , Lactente , Recém-Nascido , Masculino , Mutação , Doenças do Sistema Nervoso/epidemiologia , Doenças do Sistema Nervoso/etiologia , Neurofibromatose 2/complicações , Neurofibromatose 2/epidemiologia , Neurofibromatose 2/genética , Vigilância da População , Dermatopatias/epidemiologia , Dermatopatias/etiologia
8.
Anticancer Res ; 38(4): 2149-2154, 2018 04.
Artigo em Inglês | MEDLINE | ID: mdl-29599333

RESUMO

BACKGROUND/AIM: Individuals with type 2 Neurofibromatosis are predisposed for the appearance of schwannomas. In the present study we analyzed the loss of heterozygosity and mutations in the NF2 gene in patients with sporadic Schwannoma without Neurofibromatosis type 2. MATERIALS AND METHODS: We analyzed 39 patients with sporadic spinal schwannoma. We quantified the number of alleles by FISH and sequenced the NF2 gene. RESULTS: We identified 16/39 patients with point mutations and/or LOHs in the tumor samples analyzed. The LOHs were found in 7/39 patients. Two homozygous mutations were detected in 4/39 tumors, and the presence of the mutation in heterozygosis was revealed in 3/39 patients. In two tumors, we detected the loss of one allele of the NF2 gene, with no mutation. CONCLUSION: The genetic alterations observed in the NF2 gene indicated that spinal schwannomas are associated with genetic alterations also found in other schwannomas and type 2 Neurofibromatosis, which reinforces the etiological role of this gene.


Assuntos
Genes da Neurofibromatose 2 , Perda de Heterozigosidade , Neurilemoma/epidemiologia , Neurilemoma/genética , Neoplasias da Coluna Vertebral/epidemiologia , Neoplasias da Coluna Vertebral/genética , Adulto , Brasil/epidemiologia , Feminino , Frequência do Gene , Humanos , Incidência , Masculino , Pessoa de Meia-Idade , Neurofibromatose 2/epidemiologia , Neurofibromatose 2/genética
9.
World Neurosurg ; 114: e883-e891, 2018 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-29581016

RESUMO

OBJECTIVE: To investigate 10 candidate single nucleotide polymorphisms (SNPs) in 5 genes (CASP8, XRCC1, WRN, NF2, and BRIP1) to confirm the association between the 5 genes and the meningioma risk in a Chinese population. METHODS: We examined 10 candidate SNPs in 5 genes (CASP8, XRCC1, WRN, NF2, and BRIP1) to confirm the association between the 5 genes and the meningioma risk and tumor-related phenotype in 433 individuals, including 215 patients with meningioma and 218 controls. RESULTS: The polymorphisms rs4968451T>G in BRIP1 were significantly associated with the risk of meningioma (TT vs. TG vs. GG additive, P = 0.005; TT+TG vs. GG dominant, P = 0.015; TT/GT+GG recessive, P = 0.034). The significant association was found only in females for BRIP1 rs4968451T>G (TT+TG vs. GG dominant, P = 0.001; TT/GT+GG recessive, P = 0.044). We observed no significant association between genotypes and the meningioma risk for the other 9 SNPs. Through genotype-phenotype analysis, the genotype of BRIP1 rs4968451T>G was also strongly associated with tumor-related phenotypes, including the tumor grade and tumor subtypes. BRIP1 rs4968451T>G was associated with markedly grade I meningioma risk (TT+TG vs. GG dominant, P = 0.008; TT/GT+GG recessive, P = 0.020). In addition, BRIP1 rs4968451T>G was associated with markedly meningothelial and transitional meningioma risk. Furthermore, the genotype of CAPS8, XRCC1, and NF2 was associated with different subtype of meningioma risk. CONCLUSIONS: This study indicated a role for BRIP1 gene variations in meningioma and may be informative for future genetic or biological studies of meningioma. These findings will assist in further understanding the genetic cause for meningiomas and guide more effective biological interventions to facilitate meningiomas.


Assuntos
Grupo com Ancestrais do Continente Asiático/genética , Proteínas de Grupos de Complementação da Anemia de Fanconi/genética , Predisposição Genética para Doença/genética , Neoplasias Meníngeas/genética , Meningioma/genética , Fenótipo , RNA Helicases/genética , Adolescente , Adulto , Idoso , Estudos de Casos e Controles , Caspase 8/genética , Feminino , Genes da Neurofibromatose 2/fisiologia , Predisposição Genética para Doença/epidemiologia , Humanos , Masculino , Neoplasias Meníngeas/diagnóstico , Neoplasias Meníngeas/epidemiologia , Meningioma/diagnóstico , Meningioma/epidemiologia , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética , Fatores de Risco , Helicase da Síndrome de Werner/genética , Proteína 1 Complementadora Cruzada de Reparo de Raio-X/genética , Adulto Jovem
10.
Genes Chromosomes Cancer ; 57(8): 430-433, 2018 08.
Artigo em Inglês | MEDLINE | ID: mdl-29532557

RESUMO

Tumor genome sequencing has become an invaluable resource in determining targets for new therapies. In this report, we describe the case of a patient with metastatic urothelial carcinoma with sarcomatoid features. Sarcomatoid differentiation is a rare histologic subtype that confers a more aggressive course. The first-line treatment for patients with urothelial carcinoma is platinum-based chemotherapy. Next generation tumor sequencing performed using the FoundationOne assay revealed loss of one NF2 allele and an unbalanced der(22)t(10;22)(p11.22;q12.2) chromosomal rearrangement involving the other NF2 allele, resulting in truncation and predicted loss of function. Fluorescence in situ hybridization (FISH) analysis confirmed the presence of one NF2 signal. NF2 mutations have been found in a variety of cancers and result in activation of the mTOR pathway. As such, the use of mTOR inhibitors, such as everolimus are thought to be particularly effective in the case of NF2 loss. Our patient had a dramatic response to first-line chemotherapy, but unfortunately experienced subsequent progression of his cancer and could not tolerate everolimus. Although our patient's tumor demonstrated unique acquired genetic features including both loss of heterozygosity and truncation of the NF2 locus, he still achieved a meaningful response to platinum-based chemotherapy.


Assuntos
Protocolos de Quimioterapia Combinada Antineoplásica/uso terapêutico , Genes da Neurofibromatose 2 , Neurofibromatose 2/genética , Neoplasias da Bexiga Urinária/tratamento farmacológico , Neoplasias da Bexiga Urinária/genética , Idoso , Biomarcadores Farmacológicos , Aberrações Cromossômicas , Humanos , Masculino , Compostos Organoplatínicos/administração & dosagem
11.
JAMA Dermatol ; 154(3): 341-346, 2018 03 01.
Artigo em Inglês | MEDLINE | ID: mdl-29322178

RESUMO

Importance: Neurofibromatosis type 2 (NF2) is a devastating genetic condition characterized by the development of multiple tumors of the nervous system. An early diagnosis of individuals with NF2 would facilitate treatment and reduction of disease impact because most severe effects of the disease do not usually develop before adolescence. Little attention has traditionally been paid to dermatological signs in NF2. However, skin plaques are commonly seen in patients with NF2, normally appearing either at birth or early childhood, providing an opportunity for early NF2 detection and testing. Objective: To determine the clinical utility of skin plaque identification and characterization in children for reaching an early diagnosis of patients with NF2 and to evaluate their molecular pathogenesis and their use in the genetic diagnostics of NF2. Design, Setting, and Participants: Diagnostic test study by the histological and genetic characterization of skin plaques from patients with NF2. Patients were 7 individuals with NF2 or clinical suspicion of NF2 treated at the Spanish Reference Center on Phakomatoses. Main Outcomes and Measures: Histological evaluation of all skin plaques was performed. Fresh skin plaques were cultured to obtain Schwann cells and the NF2 gene was genetically analyzed. For all 7 patients, NF2 clinical history was reviewed. Results: In all 7 patients (4 male and 3 female), all skin plaques analyzed were histologically characterized as plexiform schwannomas. Genetic analysis of primary Schwann cell cultures derived from them allowed the identification of a constitutional and a somatic NF2 mutation. Genetic testing allowed the early diagnosis of NF2 in a child only exhibiting the presence of skin plaques. Most of the patients with NF2 analyzed had an early presentation of skin plaques and a severe NF2 phenotype. Conclusions and Relevance: This work emphasizes the clinical utility of a careful dermatological inspection and the correct identification of skin plaques in children for an early diagnosis of NF2. We show for the first time that Schwann cells derived from skin plaque plexiform schwannomas bear the double inactivation of the NF2 gene and thus constitute an excellent source of tissue for genetic testing, especially in the context of mosaicism.


Assuntos
Genes da Neurofibromatose 2 , Neurilemoma/genética , Neurofibromatose 2/diagnóstico , Neurofibromatose 2/genética , Neoplasias Cutâneas/genética , Adolescente , Adulto , Pré-Escolar , Feminino , Testes Genéticos , Humanos , Masculino , Mutação , Neurilemoma/patologia , Células de Schwann , Neoplasias Cutâneas/patologia
12.
J Neurosurg ; 128(3): 911-922, 2018 03.
Artigo em Inglês | MEDLINE | ID: mdl-28409725

RESUMO

OBJECTIVE Vestibular schwannoma (VS) is a benign tumor with associated morbidities and reduced quality of life. Except for mutations in NF2, the genetic landscape of VS remains to be elucidated. Little is known about the effect of Gamma Knife radiosurgery (GKRS) on the VS genome. The aim of this study was to characterize mutations occurring in this tumor to identify new genes and signaling pathways important for the development of VS. In addition, the authors sought to evaluate whether GKRS resulted in an increase in the number of mutations. METHODS Forty-six sporadic VSs, including 8 GKRS-treated tumors and corresponding blood samples, were subjected to whole-exome sequencing and tumor-specific DNA variants were called. Pathway analysis was performed using the Ingenuity Pathway Analysis software. In addition, multiplex ligation-dependent probe amplification was performed to characterize copy number variations in the NF2 gene, and microsatellite instability testing was done to investigate for DNA replication error. RESULTS With the exception of a single sample with an aggressive phenotype that harbored a large number of mutations, most samples showed a relatively low number of mutations. A median of 14 tumor-specific mutations in each sample were identified. The GKRS-treated tumors harbored no more mutations than the rest of the group. A clustering of mutations in the cancer-related axonal guidance pathway was identified (25 patients), as well as mutations in the CDC27 (5 patients) and USP8 (3 patients) genes. Thirty-five tumors harbored mutations in NF2 and 16 tumors had 2 mutational hits. The samples without detectable NF2 mutations harbored mutations in genes that could be linked to NF2 or to NF2-related functions. None of the tumors showed microsatellite instability. CONCLUSIONS The genetic landscape of VS seems to be quite heterogeneous; however, most samples had mutations in NF2 or in genes that could be linked to NF2. The results of this study do not link GKRS to an increased number of mutations.


Assuntos
Genes da Neurofibromatose 2 , Mutação , Neuroma Acústico/genética , Adulto , Idoso , Variações do Número de Cópias de DNA , Feminino , Humanos , Masculino , Instabilidade de Microssatélites , Pessoa de Meia-Idade , Neuroma Acústico/patologia , Transdução de Sinais/genética
13.
Neurochirurgie ; 64(1): 22-28, 2018 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-25245924

RESUMO

New advances have recently been made in the field of molecular genetics and mouse modeling of meningiomas, opening new perspectives for future treatments. Recent genome-wide genotyping and exome sequencing studies have confirmed the pivotal role of NF2 in meningioma tumorigenesis, concerning roughly half of the tumors, and unraveled new mutations in non-NF2 meningiomas concerning AKT1, SMO, KLF4 and TRAF7. The molecular mechanisms underlying tumorigenesis of high histological grades have been progressively deciphered with the recent discovery of TERT promoter mutations in progressing tumors. A better understanding of the genetics and clinical behavior of high-grade meningiomas is mandatory in order to better design future clinical trials. New genetically engineered mouse models of benign and histologically aggressive meningioma represent a substantial resource for the establishment of relevant pre-clinical trials. By studying the mechanisms underlying these new tumorigenesis pathways and the corresponding mouse models, we should be able to offer personalized chemotherapy to patients with surgery- and radiation-refractory meningiomas in the near future.


Assuntos
Genes da Neurofibromatose 2 , Neoplasias Meníngeas/genética , Meningioma/genética , Animais , Genótipo , Humanos , Mutação , Medicina de Precisão
14.
Neurochirurgie ; 64(5): 335-341, 2018 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-26073919

RESUMO

OBJECTIVE: Neurofibromatosis type 2 (NF2) affects about one in 25,000 to 40,000 people. Most NF2 patients have private loss-of-function mutations scattered along the NF2 gene. Here, we present our NF2 investigation strategy. MATERIAL AND METHODS: We report a comprehensive NF2 mutation analysis of 221 NF2 French patients: 134 unrelated typical NF2 patients fulfilling the Manchester criteria and 87 unrelated patients presenting symptoms that partially fulfilled the Manchester criteria. RESULTS: A NF2 mutation was identified in 56 of the 221 patients, giving a global mutation detection rate of 25%. This rate reached 37% (49/134) for typical NF2 patients fulfilling the Manchester criteria and only 8% (7/87) for patients presenting symptoms suggestive of NF2. Six of these seven patients were under 25 of age. Our approach showed that 77% of NF2 identified variants were detected by coding exons sequencing. Multiplex ligation-dependent probe amplification allowed the identification of restricted rearrangements (23% of NF2 identified variants corresponding to complete deletion or partial deletion/duplication of NF2). CONCLUSION: High mutation detection rate can be achieved if well phenotyped NF2 patients are studied with multiple complementary and optimized techniques. NF2 somatic mosaicism detection was improved by frozen tumor samples molecular analysis.


Assuntos
Genes da Neurofibromatose 2/fisiologia , Mutação/genética , Neoplasias/diagnóstico , Neurofibromatose 2/genética , Neurofibromatose 2/metabolismo , Adulto , Estudos de Coortes , Análise Mutacional de DNA/métodos , Feminino , Humanos , Masculino , Neoplasias/genética , Neoplasias/metabolismo , Neurofibromatose 2/diagnóstico , Patologia Molecular
15.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 34(5): 637-641, 2017 Oct 10.
Artigo em Chinês | MEDLINE | ID: mdl-28981922

RESUMO

OBJECTIVE: To explore the correlation between intraspinal Schwannomas and mutations of the NF2 gene. METHODS: Samples from 20 patients with sporadic intraspinal Schwannomas were collected and subjected NF2 gene mutation detection by PCR amplification and Sanger sequencing. RESULTS: Four de novo frameshifting mutations of the NF2 gene were discovered in the tumor tissues, which included c.1213_1231delTGAGCAGGAAATGCAGCGC, c.752delC, c.519_556delATAAATCTGTACAGATGACTCCGGAAATGTGGGAGGA and c.255delT. The same mutations were not found in the peripheral blood samples of the corresponding patients. The mutations have resulted in alteration of primary structure of the protein. No significant difference was found in the age [(60.25± 7.37) vs. (52.44 ± 10.16), P > 0.05] or diameters of tumor [(2.83 ± 0.31) cm vs. (2.31 ± 0.32) cm, P> 0.05] between patients with or without the mutations. CONCLUSION: The occurrance and evolvement of sporadic intraspinal Schwannomas have a close relationship with mutations of the NF2 gene. The latters may result in structural change and functional loss of the encoded protein and lead to the disease phenotype in the patients.


Assuntos
Genes da Neurofibromatose 2 , Mutação , Neurilemoma/genética , Neoplasias da Medula Espinal/genética , Adulto , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-Idade
16.
J Biol Chem ; 292(47): 19179-19197, 2017 11 24.
Artigo em Inglês | MEDLINE | ID: mdl-28972170

RESUMO

Cell adhesion to the extracellular matrix or to surrounding cells plays a key role in cell proliferation and differentiation and is critical for proper tissue homeostasis. An important pathway in adhesion-dependent cell proliferation is the Hippo signaling cascade, which is coregulated by the transcription factors Yes-associated protein 1 (YAP1) and transcriptional coactivator with PDZ-binding motif (TAZ). However, how cells integrate extracellular information at the molecular level to regulate YAP1's nuclear localization is still puzzling. Herein, we investigated the role of ß1 integrins in regulating this process. We found that ß1 integrin-dependent cell adhesion is critical for supporting cell proliferation in mesenchymal cells both in vivo and in vitro ß1 integrin-dependent cell adhesion relied on the relocation of YAP1 to the nucleus after the down-regulation of its phosphorylated state mediated by large tumor suppressor gene 1 and 2 (LATS1/2). We also found that this phenotype relies on ß1 integrin-dependent local activation of the small GTPase RAC1 at the plasma membrane to control the activity of P21 (RAC1)-activated kinase (PAK) of group 1. We further report that the regulatory protein merlin (neurofibromin 2, NF2) interacts with both YAP1 and LATS1/2 via its C-terminal moiety and FERM domain, respectively. PAK1-mediated merlin phosphorylation on Ser-518 reduced merlin's interactions with both LATS1/2 and YAP1, resulting in YAP1 dephosphorylation and nuclear shuttling. Our results highlight RAC/PAK1 as major players in YAP1 regulation triggered by cell adhesion.


Assuntos
Proteínas Adaptadoras de Transdução de Sinal/metabolismo , Genes da Neurofibromatose 2/fisiologia , Integrina beta1/fisiologia , Neurofibromina 2/metabolismo , Fosfoproteínas/metabolismo , Quinases Ativadas por p21/metabolismo , Proteínas rac1 de Ligação ao GTP/metabolismo , Proteínas Adaptadoras de Transdução de Sinal/genética , Animais , Adesão Celular , Proteínas de Ciclo Celular , Proliferação de Células , Células Cultivadas , Embrião de Mamíferos/citologia , Embrião de Mamíferos/metabolismo , Fibroblastos/citologia , Fibroblastos/metabolismo , Camundongos , Camundongos Knockout , Neurofibromina 2/genética , Fosfoproteínas/genética , Proteínas Serina-Treonina Quinases/genética , Proteínas Serina-Treonina Quinases/metabolismo , Proteínas Supressoras de Tumor/genética , Proteínas Supressoras de Tumor/metabolismo , Quinases Ativadas por p21/genética , Proteínas rac1 de Ligação ao GTP/genética
17.
J Neurol Sci ; 380: 112-121, 2017 Sep 15.
Artigo em Inglês | MEDLINE | ID: mdl-28870549

RESUMO

E-Cadherin has been suggested to be involved in meningioma progression but is also known as a key player of epithelial to mesenchymal transition (EMT). We wondered whether the adherens junction protein E-Cadherin, the tight junction protein Zo-1, and transcription factors suppressing E-Cadherin expression (Slug, Snail, Twist, Zeb-1) are differentially expressed between histopathological subtypes of meningioma, and if the expression of these factors is related to biological features of meningiomas. Analyzing 85 meningiomas of various histopathological subtypes and grades of malignancy by immunohistochemistry and 50 of them in addition by real-Time-PCR, we observed significantly reduced expression of Zeb-1, Twist and Slug, together with slightly increased expression levels for E-Cadherin and Zo- 1 in fibroblastic WHO-grade I tumors compared to meningothelial WHO grade I tumors, contradicting the hypothesis of EMT in the fibroblastic meningiomas characterized by mesenchymal appearance. However, comparing aggressive WHO grade II or III meningiomas with WHO-grade I tumors, we observed altered expression levels (loss of E-Cadherin and Zo-1, increased expression of Zeb-1 and Slug) indicating molecular features of EMT in aggressive meningiomas. This was supported by reduced E-Cadherin and increased Slug levels in recurrent compared to non-recurrent meningiomas. The expression levels of E-cadherin and Zo-1 were positively correlated with expression of NF2 mRNA. In primary meningioma cultures and IOMM-Lee meningioma cells, EMT induction by TGF-ß resulted in altered morphology and increased expression of EMT associated transcription factors. Meningioma cells with allelic losses of NF2 showed generally higher levels of various EMT relevant proteins, but were unresponsive to TGF-ß treatment. Our data indicate that aggressive meningiomas of WHO grade II/III are characterized by molecular alterations indicating partial EMT. This might contribute to the aggressive biology of these tumors.


Assuntos
Caderinas/metabolismo , Transição Epitelial-Mesenquimal/fisiologia , Neoplasias Meníngeas/metabolismo , Meningioma/metabolismo , Fatores de Transcrição/metabolismo , Adulto , Idoso , Idoso de 80 Anos ou mais , Antígenos CD , Células Cultivadas , Feminino , Regulação Neoplásica da Expressão Gênica , Genes da Neurofibromatose 2 , Humanos , Masculino , Neoplasias Meníngeas/patologia , Meningioma/patologia , Pessoa de Meia-Idade , Gradação de Tumores , RNA Mensageiro/metabolismo , Fator de Crescimento Transformador beta/administração & dosagem , Fator de Crescimento Transformador beta/metabolismo , Adulto Jovem , Proteína da Zônula de Oclusão-1/metabolismo
18.
Nat Commun ; 8(1): 186, 2017 08 04.
Artigo em Inglês | MEDLINE | ID: mdl-28775249

RESUMO

Cranial radiotherapy improves survival of the most common childhood cancers, including brain tumors and leukemia. Unfortunately, long-term survivors are faced with consequences of secondary neoplasia, including radiation-induced meningiomas (RIMs). We characterized 31 RIMs with exome/NF2 intronic sequencing, RNA sequencing and methylation profiling, and found NF2 gene rearrangements in 12/31 of RIMs, an observation previously unreported in sporadic meningioma (SM). Additionally, known recurrent mutations characteristic of SM, including AKT1, KLF4, TRAF7 and SMO, were not observed in RIMs. Combined losses of chromosomes 1p and 22q were common in RIMs (16/18 cases) and overall, chromosomal aberrations were more complex than that observed in SM. Patterns of DNA methylation profiling supported similar cell of origin between RIMs and SMs. The findings indicate that the mutational landscape of RIMs is distinct from SMs, and have significant therapeutic implications for survivors of childhood cranial radiation and the elucidation of the molecular pathogenesis of meningiomas.Radiation-induced meningiomas are often more aggressive than sporadic ones. In this study, the authors perform an exome, methylation and RNA-seq analysis of 31 cases of radiation-induced meningioma and show NF2 rearrangement, an observation previously unreported in the sporadic tumors.


Assuntos
Irradiação Craniana/efeitos adversos , Rearranjo Gênico/genética , Genes da Neurofibromatose 2 , Neoplasias Meníngeas/genética , Meningioma/genética , Neoplasias Induzidas por Radiação/genética , Adulto , Idoso , Sobreviventes de Câncer , Estudos de Casos e Controles , Neoplasias Cerebelares/radioterapia , Metilação de DNA , Feminino , Humanos , Leucemia/radioterapia , Masculino , Meduloblastoma/radioterapia , Neoplasias Meníngeas/etiologia , Meningioma/etiologia , Pessoa de Meia-Idade , Mutação , Neoplasias Induzidas por Radiação/etiologia , Análise de Sequência de DNA , Análise de Sequência de RNA , Adulto Jovem
19.
J Med Genet ; 54(10): 657-664, 2017 10.
Artigo em Inglês | MEDLINE | ID: mdl-28848060

RESUMO

​BACKGROUND: The clinical severity of disease in neurofibromatosis type 2 (NF2) is variable. Patients affected with a constitutional truncating NF2 mutation have severe disease, while missense mutations or mosaic mutations present with a milder attenuated phenotype. Genotype-derived natural history data are important to inform discussions on prognosis and management. METHODS: We have assessed NF2 clinical phenotype in 142 patients in relation to the UK NF2 Genetic Severity Score to validate its use as a clinical and research tool. RESULTS: The Genetic Severity Score showed significant correlations across 10 measures, including mean age at diagnosis, proportion of patients with bilateral vestibular schwannomas, presence of intracranial meningioma, spinal meningioma and spinal schwannoma, NF2 eye features, hearing grade, age at first radiotherapy, age at first surgery and age starting bevacizumab. In addition there was moderate but significant correlation with age at loss of useful hearing, and weak but significant correlations for mean age at death, quality of life, last optimum Speech Discrimination Score and total number of major interventions. Patients with severe disease presented at a younger age had a higher disease burden and greater requirement of intervention than patients with mild and moderate disease. CONCLUSIONS: This study validates the UK NF2 Genetic Severity Score to stratify patients with NF2 for both clinical use and natural history studies.


Assuntos
Neurofibromatose 2/genética , Neurofibromatose 2/fisiopatologia , Fatores Etários , Feminino , Genes da Neurofibromatose 2 , Perda Auditiva , Humanos , Masculino , Mutação , Neurofibromatose 2/diagnóstico , Neurofibromatose 2/terapia , Fenótipo , Qualidade de Vida , Índice de Gravidade de Doença
20.
Nat Rev Cancer ; 17(8): 475-488, 2017 07 25.
Artigo em Inglês | MEDLINE | ID: mdl-28740119

RESUMO

Malignant mesothelioma is a universally lethal cancer that is increasing in incidence worldwide. There is a dearth of effective therapies, with only one treatment (pemetrexed and cisplatin combination chemotherapy) approved in the past 13 years. However, the past 5 years have witnessed an exponential growth in our understanding of mesothelioma pathobiology, which is set to revolutionize therapeutic strategies. From a genomic standpoint, mesothelioma is characterized by a preponderance of tumour suppressor alterations, for which novel therapies are currently in development. Other promising antitumour agents include inhibitors against angiogenesis, mesothelin and immune checkpoints, which are at various phases of clinical trial testing.


Assuntos
Antineoplásicos/uso terapêutico , Genes Supressores de Tumor , Imunoterapia , Mesotelioma/genética , Mesotelioma/terapia , Neovascularização Patológica/prevenção & controle , Animais , Anticorpos Monoclonais/farmacologia , Antineoplásicos/farmacologia , Proteínas Ligadas por GPI/antagonistas & inibidores , Genes da Neurofibromatose 2 , Genes p16 , Humanos , Mesotelioma/metabolismo , Proteína-Arginina N-Metiltransferases/antagonistas & inibidores , Proteínas Proto-Oncogênicas c-akt , Serina-Treonina Quinases TOR/antagonistas & inibidores , Microambiente Tumoral , Proteínas Supressoras de Tumor/genética , Ubiquitina Tiolesterase/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA