Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.018
Filtrar
1.
PLoS One ; 15(9): e0235588, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32946457

RESUMO

Data on the historical change of the Transbaikalian malacofauna in the Neopleistocene and Holocene is presented. Aquatic mollusc shells from archaeological excavations of the ancient settlements dating from the Neolithic period to Medieval and also from a drill hole of the Neopleistocene alluvial deposits were collected. In total eight species of bivalve molluscs from the families Margaritiferidae, Unionidae, Lymnocardiidae, Glycymerididae [marine], and two gastropod species from families Viviparidae and Planorbidae were identified. These species were aged using radiocarbon dating. It was found that the species ranged in age from more than 50.000 to 2.080-1.210 years BP. Five species inhabited the Transbaikal region which are locally extirpated today. Their disjunctive ranges in the past included southern Europe and Western and Eastern Siberia to Transbaikalia and in the east to Far East and Primorye Territory of Russia. A remarkable finding is that of the bivalve genus Monodacna, which was found very far from its native range, the Ponto-Caspian region. The time of existence and extirpation of the thermophilic species of genera Monodacna, Planorbis, Lanceolaria and Amuropaludina corresponds to cycles of the warming and cooling in Pleistocene and Holocene according to regional climate chronological scales. These species can be used as palaeoclimate indicators. Change of the regional malacofaunal species composition is connected with the natural climatochron cycles in the Pleistocene and Holocene resulting in evidence for succession. In the course of this succession, these stenothermal species became extirpated on a regional level, decreasing their global ranges.


Assuntos
Distribuição Animal , Organismos Aquáticos/fisiologia , Biodiversidade , Ecologia/métodos , Moluscos/fisiologia , Exoesqueleto/química , Animais , Organismos Aquáticos/química , Organismos Aquáticos/classificação , Arqueologia , Europa (Continente) , Extremo Oriente , Fósseis , Água Doce , Geografia , História Antiga , Moluscos/química , Moluscos/classificação , Datação Radiométrica , Sibéria
2.
Biomolecules ; 10(7)2020 07 07.
Artigo em Inglês | MEDLINE | ID: mdl-32645994

RESUMO

Oceans cover more than 70 percent of the surface of our planet and are characterized by huge taxonomic and chemical diversity of marine organisms. Several studies have shown that marine organisms produce a variety of compounds, derived from primary or secondary metabolism, which may have antiviral activities. In particular, certain marine metabolites are active towards a plethora of viruses. Multiple mechanisms of action have been found, as well as different targets. This review gives an overview of the marine-derived compounds discovered in the last 10 years. Even if marine organisms produce a wide variety of different compounds, there is only one compound available on the market, Ara-A, and only another one is in phase I clinical trials, named Griffithsin. The recent pandemic emergency caused by SARS-CoV-2, also known as COVID-19, highlights the need to further invest in this field, in order to shed light on marine compound potentiality and discover new drugs from the sea.


Assuntos
Antivirais/química , Organismos Aquáticos/química , Produtos Biológicos/química , Antivirais/farmacologia , Organismos Aquáticos/classificação , Produtos Biológicos/farmacologia , Coronaviridae/efeitos dos fármacos
3.
Mar Drugs ; 18(7)2020 Jun 28.
Artigo em Inglês | MEDLINE | ID: mdl-32605149

RESUMO

Four new indolyl diketopiperazines, aspamides A-E (1-4) and two new diketopiperazines, aspamides F-G (5-6), along with 11 known diketopiperazines and intermediates were isolated from the solid culture of Aspergillus versicolor, which is an endophyte with the sea crab (Chiromantes haematocheir). Further chiral high-performance liquid chromatography resolution gave enantiomers (+)- and (-)-4, respectively. The structures and absolute configurations of compounds 1-6 were determined by the comprehensive analyses of nuclear magnetic resonance (NMR), high-resolution mass spectrometry (HR-MS), and electronic circular dichroism (ECD) calculation. All isolated compounds were selected for the virtual screening on the coronavirus 3-chymoretpsin-like protease (Mpro) of Severe Acute Respiratory Syndrome Coronavirus 2 (SARS-CoV-2), and the docking scores of compounds 1-2, 5, 6, 8 and 17 were top among all screened molecules, may be helpful in fighting with Corona Virus Disease-19 (COVID-19) after further studies.


Assuntos
Antivirais , Organismos Aquáticos/química , Aspergillus/química , Cisteína Endopeptidases/metabolismo , Dicetopiperazinas/química , Dicetopiperazinas/metabolismo , Proteínas não Estruturais Virais/metabolismo , Antivirais/química , Antivirais/metabolismo , Betacoronavirus/metabolismo , Cromatografia Líquida de Alta Pressão , Cisteína Endopeptidases/química , Avaliação Pré-Clínica de Medicamentos , Espectroscopia de Ressonância Magnética , Espectrometria de Massas , Simulação de Acoplamento Molecular , Estereoisomerismo , Interface Usuário-Computador , Proteínas não Estruturais Virais/química
4.
J Chromatogr A ; 1622: 461132, 2020 Jul 05.
Artigo em Inglês | MEDLINE | ID: mdl-32402494

RESUMO

A novel and simple derivatization method using a series of amide acetals as derivatization reagents, along with gas chromatography tandem mass spectrometry (GC-MS/MS) analysis, were developed and validated for simultaneous determination of 9 perfluoroalkyl carboxylic acids (PFCAs) in this study. The structures and fragmentation pathway of PFCAs derivatives were deduced and verified. The derivatization method developed in this study improved the sensitivity of the detection of PFCAs by GC. The applicability of 6 amide acetals for the derivatization of PFCAs was demonstrated. Derivatization conditions for 9 PFCAs were optimized with addition of 20 µL of derivatization reagent and reaction at 35 °C for 30 min. 9 PFCAs derivatives were confirmed to be stable over 15 days. The instrument detection limits (IDLs) were lower than 0.01 pg/µL. The intra and inter-day precisions were below 4.06% and 5.48%, respectively. To demonstrate the utility of the derivatization method, the level of PFCAs in the marine products were detected. The alkaline digestion followed by solid-phase extraction (SPE) cleanup method was used for pretreatment. The method detection limits (MDLs) ranged from 0.04 to 0.10 ng/g, and the spiked recoveries ranged between 54.72% and 107.29%, with relative standard deviation (RSD) of 1.53%-11.89%. Five PFCAs were detected in the range of 0.66 to 499.03 ng/g dry weight.


Assuntos
Acetais/química , Amidas/química , Ácidos Carboxílicos/análise , Fluorcarbonetos/análise , Cromatografia Gasosa-Espectrometria de Massas/métodos , Espectrometria de Massas em Tandem/métodos , Organismos Aquáticos/química , Dimetilformamida/química , Limite de Detecção , Padrões de Referência
5.
Exp Hematol ; 86: 67-77.e2, 2020 06.
Artigo em Inglês | MEDLINE | ID: mdl-32422231

RESUMO

There exists an urgent need for the development of new drugs for the treatment of lymphoid neoplasms. The aim of this study was to evaluate the cytotoxic effect of the marine plastoquinone 9'-hydroxysargaquinone (9'-HSQ), focusing on investigation of the mechanism by which it causes death in lymphoid neoplastic cells. This particular plastoquinone reduced the cell viability of different hematological tumor cell lines in a time-dependent and concentration-dependent manner. Intrinsic apoptosis occurred with time-dependent reduction of mitochondrial membrane potential (42.3 ± 1.1% of Daudi cells and 18.6 ± 5.6% of Jurkat cells maintained mitochondrial membrane integrity) and apoptosis-inducing factor release (Daudi: 133.3 ± 8.1%, Jurkat: 125.7 ± 6.9%). Extrinsic apoptosis also occurred, as reflected by increased FasR expression (Daudi: 139.5 ± 7.1%, Jurkat: 126.0 ± 1.0%). Decreases were observed in the expression of Ki-67 proliferation marker (Daudi: 67.5 ± 2.5%, Jurkat: 84.3 ± 3.8%), survivin (Daudi: 66.0 ± 9.9%, Jurkat: 63.1 ± 6.0%), and NF-κB (0.7 ± 0.04% in Jurkat cells). Finally, 9'-HSQ was cytotoxic to neoplastic cells from patients with different lymphoid neoplasms (IC50: 4.9 ± 0.6 to 34.2 ± 0.4 µmol/L). These results provide new information on the apoptotic mechanisms of 9'-HSQ and suggest that it might be a promising alternative for the treatment of lymphoid neoplasms.


Assuntos
Antineoplásicos/farmacologia , Apoptose/efeitos dos fármacos , Organismos Aquáticos/química , Neoplasias Hematológicas/tratamento farmacológico , Transtornos Linfoproliferativos/tratamento farmacológico , Feófitas/química , Plastoquinona/farmacologia , Antineoplásicos/química , Ensaios de Seleção de Medicamentos Antitumorais , Neoplasias Hematológicas/metabolismo , Neoplasias Hematológicas/patologia , Humanos , Células Jurkat , Células K562 , Transtornos Linfoproliferativos/metabolismo , Transtornos Linfoproliferativos/patologia , Plastoquinona/química
6.
Arch Environ Contam Toxicol ; 79(1): 131-146, 2020 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-32285161

RESUMO

Former nuclear weapons material production at the U.S. Department of Energy's Savannah River Site (SRS) has resulted in contamination of certain terrestrial and aquatic ecosystems on site with legacy wastes such as radiocesium (137Cs), tritium (3H), and metals. We collected fish and invertebrates from five beaver ponds (sites) above, adjacent, and downgradient of three SRS facilities (H-, F-, and C-Areas) to evaluate whether the accumulation of metals and radionuclides in biota were associated with specific facility operations and if the measured levels could pose risks to aquatic organisms. We compared concentrations of various metals, 137Cs, and 3H in fish, as well as in water (3H only), among sites along the stream gradient. Fish collected from sites adjacent to H-Area had significantly higher 137Cs concentrations compared to fish from other sites. Both biota and water samples indicated significantly greater levels of 3H in sites adjacent to and downstream of C-Area. Concentrations of zinc (Zn), copper (Cu), and mercury (Hg) in some samples exceeded effects levels reported for fish and may pose a risk to fish populations. This study reported fish tissue concentrations of 137Cs and 3H, which have not been documented extensively in ecotoxicological studies. Our results suggested that industrial operations such as nuclear material production at SRS could have long-lasting impact on the aquatic ecosystem via the release of radionuclides and metals, and long-term monitoring of physiological effects and population level impact in biota exposed to these contaminants are recommended.


Assuntos
Organismos Aquáticos/química , Armas Nucleares , Monitoramento de Radiação/métodos , Rios/química , Poluentes Radioativos da Água/análise , Animais , Organismos Aquáticos/efeitos dos fármacos , Radioisótopos de Césio/análise , Peixes/metabolismo , Invertebrados/química , Invertebrados/efeitos dos fármacos , Metais Pesados/análise , Tanques/química , South Carolina , Trítio/análise
7.
Drug Discov Today ; 25(6): 956-958, 2020 06.
Artigo em Inglês | MEDLINE | ID: mdl-32325124

RESUMO

This article examines three aspects of antivirals, such as hydroxychloroquine, chloroquine, and remdesvir, as they might relate to the treatment of a viral infection such as COVID-19: (i) the use of vaporization for the delivery of antivirals, with the bulk constituents having mild antiviral efficacy; (ii) the application of a marine natural product extract as opposed to a single molecule as an antiviral agent; and (iii) a counter intuitive approach to formulation that is, in part, based on delivering multiple species that fall into three categories: building blocks for the virus to accelerate replication; an energy source for the infected cell to boost its immune response; and the species that antagonize or provide toxicity to the virus.


Assuntos
Antivirais/administração & dosagem , Antivirais/química , Organismos Aquáticos/química , Produtos Biológicos/administração & dosagem , Produtos Biológicos/química , Monofosfato de Adenosina/administração & dosagem , Monofosfato de Adenosina/análogos & derivados , Monofosfato de Adenosina/química , Alanina/administração & dosagem , Alanina/análogos & derivados , Alanina/química , Cloroquina/administração & dosagem , Cloroquina/química , Infecções por Coronavirus/tratamento farmacológico , Composição de Medicamentos , Humanos , Hidroxicloroquina/administração & dosagem , Hidroxicloroquina/química , Modelos Moleculares , Pandemias , Pneumonia Viral/tratamento farmacológico , Volatilização
8.
J Bone Miner Metab ; 38(5): 639-647, 2020 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-32303916

RESUMO

INTRODUCTION: Collagen from marine esponges has been used as a promising material for tissue engineering proposals. Similarly, photobiomodulation (PBM) is able of modulating inflammatory processes after an injury, accelerating soft and hard tissue healing and stimulating neoangiogenesis. However, the effects of the associated treatments on bone tissue healing have not been studied yet. In this context, the present study aimed to evaluate the biological temporal modifications (using two experimental periods) of marine sponge collagen or sponging (SPG) based scaffold and PBM on newly formed bone using a calvaria bone defect model. MATERIAL AND METHODS: Wistar rats were distributed into two groups: SPG or SPG/PBM and euthanized into two different experimental periods (15 and 45 days post-surgery). A cranial critical bone defect was used to evaluate the effects of the treatments. Histology, histomorfometry and immunohistological analysis were performed. RESULTS: Histological findings demonstrated that SPG/PBM-treated animals, 45 days post-surgery, demonstrated a higher amount of connective and newly formed bone tissue at the region of the defect compared to CG. Notwithstanding, no difference among groups were observed in the histomorphometry. Interestingly, for both anti-transforming growth factor-beta (TGF-ß) and anti-vascular endothelial growth factor (VEGF) immunostaining, higher values for SPG/PBM, at 45 days post-surgery could be observed. CONCLUSION: It can be concluded that the associated treatment can be considered as a promising therapeutical intervention.


Assuntos
Organismos Aquáticos/química , Colágeno/farmacologia , Terapia com Luz de Baixa Intensidade , Crânio/patologia , Tecidos Suporte/química , Cicatrização/efeitos dos fármacos , Animais , Modelos Animais de Doenças , Masculino , Ratos Wistar , Crânio/efeitos dos fármacos , Fator de Crescimento Transformador beta/metabolismo , Fator A de Crescimento do Endotélio Vascular/metabolismo
9.
Bull Environ Contam Toxicol ; 104(4): 423-431, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32080748

RESUMO

Microplastic (MP) contamination in marine organisms is a growing field of research internationally. However not much is known about MP presence in invertebrates in southern Africa. The aim of this study was to determine whether MPs occurs in mussels prevalent in Cape Town, South Africa. Mussels (Mytilus galloprovincialis, Choromytilus meridionalis and Aulacomya ater) were sampled at 27 sites in October 2018 and MPs were recorded in 98% of mussels analysed. Most MPs were filaments, dark in colour and the size ranged between 50 and 1000 µm. There were no significant differences in MPs between the mussel species, with an average of 2.33 (standard error ± 0.2) MP particles/g and 4.27 (standard error ± 0.5) particles/individual being recorded for all sites combined. This is the first record of MPs in mussels in the region and provides a baseline for further investigations and monitoring of MPs.


Assuntos
Organismos Aquáticos/química , Monitoramento Biológico/métodos , Microplásticos/análise , Mytilus/química , Poluentes Químicos da Água/análise , Animais , Alimentos Marinhos/análise , África do Sul
10.
Mar Drugs ; 18(1)2020 Jan 07.
Artigo em Inglês | MEDLINE | ID: mdl-31936139

RESUMO

Mycosporine-like amino acids (MAAs), maximally absorbed in the wavelength region of 310-360 nm, are widely distributed in algae, phytoplankton and microorganisms, as a class of possible multi-functional compounds. In this work, based on the Web of Science, Springer, Google Scholar, and China national knowledge infrastructure (CNKI), we have summarized and analyzed the studies related to MAAs in marine macroalgae over the past 30 years (1990-2019), mainly focused on MAAs distribution, contents, and types. It was confirmed that 572 species marine macroalgae contained MAAs, namely in 45 species of Chlorophytes, 41 species of Phaeophytes, and 486 species of Rhodophytes, and they respectively belonged to 28 orders. On this basis, we established an open online database to quickly retrieve MAAs in 501 species of marine macroalgae. Furthermore, research concerning MAAs in marine macroalgae were analyzed using CiteSpace. It could easily be seen that the preparation and purification of MAAs in marine macroalgae have not been intensively studied during the past 10 years, and therefore it is necessary to strengthen the research in the preparation and purification of MAA purified standards from marine macroalgae in the future. We agreed that this process is not only interesting, but important due to the potential use of MAAs as food and cosmetics, as well as within the medicine industry.


Assuntos
Aminoácidos/química , Organismos Aquáticos/química , Bases de Dados de Compostos Químicos , Alga Marinha/química , Aminoácidos/classificação
11.
Mar Drugs ; 18(1)2020 Jan 11.
Artigo em Inglês | MEDLINE | ID: mdl-31940851

RESUMO

ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.


Assuntos
Antineoplásicos/farmacologia , Produtos Biológicos/farmacologia , Quadruplex G , Peptídeos/farmacologia , Organismos Aquáticos/química , Produtos Biológicos/química , Humanos , Ligantes , Peptídeos/química , Ligação Proteica/efeitos dos fármacos
12.
Mar Drugs ; 18(1)2020 Jan 14.
Artigo em Inglês | MEDLINE | ID: mdl-31947564

RESUMO

Nitrogen heterocycles have drawn considerable attention due to of their significant biological activities. The marine fungi residing in extreme environments are among the richest sources of these basic nitrogen-containing secondary metabolites. As one of the most well-known universal groups of filamentous fungi, marine-derived Aspergillus species produce a large number of structurally unique heterocyclic alkaloids. This review attempts to provide a comprehensive summary of the structural diversity and biological activities of heterocyclic alkaloids that are produced by marine-derived Aspergillus species. Herein, a total of 130 such structures that were reported from the beginning of 2014 through the end of 2018 are included, and 75 references are cited in this review, which will benefit future drug development and innovation.


Assuntos
Alcaloides/química , Organismos Aquáticos/química , Aspergillus/química , Produtos Biológicos/química , Humanos , Água do Mar/química , Água do Mar/microbiologia
13.
J Basic Microbiol ; 60(4): 351-361, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-31960981

RESUMO

For the first time, native proteorhodopsins of the marine dinoflagellate Oxyrrhis marina were isolated. Total cell membrane fractions were minced in a bead beater and solubilized with the detergent Triton X-100. Subsequent sucrose density gradient centrifugation resulted in three or four red-colored bands. Nonsolubilized, but still red colored, membranes sedimented at the bottom. For each of these bands, absorbance maxima were registered at approximately 514-516 nm with shoulders toward shorter wavelengths (470-490 nm). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis revealed that the uppermost band represented free retinal chromophore, as it contained no protein. The other bands were almost pure proteorhodopsin fractions as the banding patterns showed one major protein of 25 kDa. Tryptic, in-gel digestion of the 25 kDa proteins and of faint protein bands above and below 25 kDa was followed by mass spectrometry, confirming these protein bands to consist, nearly exclusively, proteorhodopsins. Only single peptides of few other proteins were detected. In total, at least seven predicted proteorhodopsin protein sequences were experimentally verified.


Assuntos
Organismos Aquáticos/química , Membrana Celular/química , Fracionamento Químico/métodos , Dinoflagelados/química , Rodopsinas Microbianas/isolamento & purificação , Eletroforese em Gel de Poliacrilamida , Espectrometria de Massas , Octoxinol , Filogenia
14.
Mar Drugs ; 18(1)2020 Jan 16.
Artigo em Inglês | MEDLINE | ID: mdl-31963113

RESUMO

Treatment of acute myeloid leukemia (AML) remains inefficient due to drug resistance and relapse, particularly in patients with FMS-like tyrosine kinase 3 (FLT3)-internal tandem duplication (ITD). Marine-derived natural products have recently been used for drug development against AML. We show in this study that petromurin C, which was isolated from the culture extract of the marine-derived fungus Aspergillus candidus KUFA0062, isolated from the marine sponge Epipolasis sp., induces early autophagy followed by apoptotic cell death via activation of the intrinsic cell death pathway concomitant with mitochondrial stress and downregulation of Mcl-1 in FLT3-ITD mutated MV4-11 cells. Moreover, petromurin C synergized with the clinically-used FLT3 inhibitor gilteritinib at sub-toxic concentrations. Altogether, our results provide preliminary indications that petromurin C provides anti-leukemic effects alone or in combination with gilteritinib.


Assuntos
Compostos de Anilina/farmacologia , Protocolos de Quimioterapia Combinada Antineoplásica/farmacologia , Apoptose/efeitos dos fármacos , Produtos Biológicos/farmacologia , Leucemia Mieloide Aguda/tratamento farmacológico , Pirazinas/farmacologia , Tirosina Quinase 3 Semelhante a fms/metabolismo , Compostos de Anilina/administração & dosagem , Animais , Organismos Aquáticos/química , Autofagia/efeitos dos fármacos , Produtos Biológicos/administração & dosagem , Linhagem Celular Tumoral , Regulação para Baixo/efeitos dos fármacos , Resistencia a Medicamentos Antineoplásicos , Sinergismo Farmacológico , Humanos , Leucemia Mieloide Aguda/genética , Leucemia Mieloide Aguda/metabolismo , Leucemia Mieloide Aguda/patologia , Pirazinas/administração & dosagem , Transdução de Sinais/efeitos dos fármacos , Células U937 , Peixe-Zebra , Tirosina Quinase 3 Semelhante a fms/genética
15.
Mar Drugs ; 18(1)2020 Jan 16.
Artigo em Inglês | MEDLINE | ID: mdl-31963310

RESUMO

Mexico is one of the three areas of the world with the greatest terrestrial and cultural biological diversity. The diversity of Mexican medicinal flora has been studied for a long time and several bioactive compounds have been isolated. The investigation of marine resources, and particularly the potential of Mexican marine resources, has not been intensively investigated, even though the Yucatan Peninsula occupies 17.4% of the total of the Mexican coast, with great biological diversity in its coasts and the ocean. There are very few studies on the chemistry of natural products from marine organisms that were collected along the coasts of the Yucatan Peninsula and most of them are limited to the evaluation of the biological activity of their organic extracts. The investigations carried out on marine species from the Yucatan Peninsula resulted in the identification of a wide structural variety of natural products that include polyketides, terpenoids, nitrogen compounds, and biopolymers with cytotoxic, antibacterial, antifouling, and neurotoxic activities. This review describes the literature of bioprospecting and the exploration of the natural product diversity of marine organisms from the coasts of the Yucatan Peninsula up to mid-2019.


Assuntos
Organismos Aquáticos/química , Produtos Biológicos/química , Animais , Biodiversidade , Humanos , México
16.
Mar Drugs ; 18(2)2020 Jan 23.
Artigo em Inglês | MEDLINE | ID: mdl-31979231

RESUMO

Three new polyketides, ketidocillinones A-C (1-3), were discovered from the extract of an Antarctica sponge-derived fungus Penicillium sp. HDN151272. All the structures were deduced by spectroscopic data, including NMR and HRESIMS. The absolute configuration of compound 3 was established by using ECD calculation. Compounds 1-3 can be slowly oxidized to quinone form when exposed to air. Ketidocillinones B and C (2 and 3) exhibited potent antibacterial activity against Pseudomonas aeurigenosa, Mycobacterium phlei, and MRCNS (methicillin-resistant coagulase-negative staphylococci) with MIC values ranging from 1.56 to 25.00 µg/mL.


Assuntos
Antibacterianos/farmacologia , Organismos Aquáticos/química , Penicillium/química , Policetídeos/farmacologia , Poríferos/microbiologia , Animais , Regiões Antárticas , Antibacterianos/química , Antibacterianos/isolamento & purificação , Espectroscopia de Ressonância Magnética , Staphylococcus aureus Resistente à Meticilina/efeitos dos fármacos , Testes de Sensibilidade Microbiana , Estrutura Molecular , Mycobacterium phlei/efeitos dos fármacos , Policetídeos/química , Policetídeos/isolamento & purificação , Pseudomonas aeruginosa/efeitos dos fármacos
17.
J Chromatogr A ; 1618: 460852, 2020 May 10.
Artigo em Inglês | MEDLINE | ID: mdl-31948723

RESUMO

This paper describes the development and validation of a new procedure for the determination of phthalates in marine invertebrates, based on biocompatible solid-phase microextraction (BioSPME) followed by liquid chromatography coupled to mass spectrometry. The importance of this application relies on the current use of marine organisms as bioindicators for microplastic contamination through the detection of phthalates in their tissues. Challenges originate from the availability and/or possible restriction on the use of the biological materials, the need for user- friendly procedures for simplifying and speeding up operations in the marine environments, and the ubiquitous presence of phthalates in the laboratory environments that may cause background contamination. BioSPME served as an effective solution to all these issues, owing to the extreme minimization of the sample manipulation. Sampling operations were limited to the direct transfer of small amounts of the biological materials (150 mg) inside glass vials capped with aluminium lids; extractions were carried out by ultrasonication in acetone followed by dilution in ultrapure water and BioSPME clean-up; Electrospray (ESI) LC-MS/MS was employed for the final analytical determinations on the purified extracts. Tests were carried out on samples belonging to three different phyla, namely Cnidaria, Porifera, and Mollusca obtained from Maldivian coral reef environments and used for a current microplastic contamination biomonitoring project. Overall, very good sensitivity and repeatability, with negligible back contamination of the blanks were observed. The limits of detections were between 0.2 and 2.1 ng/g and precision, calculated as relative standard deviation (RSD), was below 14% for all the tested phthalates.


Assuntos
Organismos Aquáticos/química , Materiais Biocompatíveis/química , Invertebrados/química , Ácidos Ftálicos/análise , Microextração em Fase Sólida/métodos , Espectrometria de Massas em Tandem/métodos , Animais , Cromatografia Líquida , Monitoramento Ambiental , Cinética , Limite de Detecção , Solventes , Poluentes Químicos da Água/análise
18.
Toxicon ; 176: 30-33, 2020 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-31975690

RESUMO

Tetrodotoxin (TTX) is a potent neurotoxin frequently occurring in marine organisms along with its numerous analogues. To determine the total TTX content, we developed an enzyme-linked immunosorbent assay (ELISA) technique utilizing polyclonal antibodies against TTX. The technique was tested using extracts of marine worms of the phylum Nemertea and confirmed by HPLC-MS/MS. It proved to be suitable for a preliminary assessment of the toxicity of marine organisms.


Assuntos
Organismos Aquáticos/química , Tetrodotoxina/toxicidade , Animais , Cromatografia Líquida de Alta Pressão , Ensaio de Imunoadsorção Enzimática/métodos , Espectrometria de Massas em Tandem/métodos
19.
Mar Drugs ; 18(1)2020 Jan 02.
Artigo em Inglês | MEDLINE | ID: mdl-31906518

RESUMO

Macrophages play a fundamental role in the immune system. Depending on the microenvironment stimuli, macrophages can acquire distinct phenotypes characterized with different sets of the markers of their functional activities. Polarization of macrophages towards M1 type (classical activation) is involved in inflammation and the related progression of diseases, while, in contrast, alternatively activated M2 macrophages are associated with the anti-inflammatory mechanisms. Reprogramming macrophages to switch their phenotypes could provide a new therapeutic strategy, and targeting the M1/M2 macrophage balance is a promising current trend in pharmacology. Marine invertebrates are a vast source of the variety of structurally diverse compounds with potent pharmacological activities. For years, a large number of studies concerning the immunomodulatory properties of the marine substances have been run with using some intracellular markers of immune stimulation or suppression irrespective of the possible application of marine compounds in reprogramming of macrophage activation, and only few reports clearly demonstrated the macrophage-polarizing activities of some marine compounds during the last decade. In this review, the data on the immunomodulating effects of the extracts and pure compounds of a variety of chemical structure from species of different classes of marine invertebrates are described with focus on their potential in shifting M1/M2 macrophage balance towards M1 or M2 phenotype.


Assuntos
Organismos Aquáticos/química , Produtos Biológicos/farmacologia , Fatores Imunológicos/farmacologia , Invertebrados/química , Ativação de Macrófagos/efeitos dos fármacos , Animais , Anti-Inflamatórios/farmacologia , Humanos , Ativação de Macrófagos/imunologia , Macrófagos/efeitos dos fármacos , Macrófagos/imunologia
20.
Arch Physiol Biochem ; 126(2): 116-128, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-30269604

RESUMO

Chronic hepatitis C virus (HCV) infection is a significant public health problem, with a worldwide prevalence of approximately 170 million. Current therapy for HCV infection includes the prolonged administration of a combination of ribavirin and PEGylated interferon-α, for over a decade. This regimen is expensive and often associated with a poor antiviral response and unwanted side effects. A highly effective combination treatment is likely required for the future management of HCV infections and entry inhibitors could play an important role. Currently, no entry inhibitor has been licensed for the prophylactic treatment of hepatitis C. Therefore, additional agents that combat HCV infection are urgently needed and must be developed. Many phytochemical constituents have been identified that display considerable inhibition of HCV at some stage of the life cycle. This review will summarise the current state of knowledge on natural products and their possible activities in the context of HCV infection.


Assuntos
Antivirais/uso terapêutico , Produtos Biológicos/uso terapêutico , Flavonoides/uso terapêutico , Hepacivirus/efeitos dos fármacos , Hepatite C Crônica/tratamento farmacológico , Antivirais/química , Antivirais/isolamento & purificação , Organismos Aquáticos/química , Produtos Biológicos/química , Produtos Biológicos/isolamento & purificação , Ensaios Clínicos como Assunto , Quimioterapia Combinada , Flavonoides/isolamento & purificação , Hepacivirus/genética , Hepacivirus/crescimento & desenvolvimento , Hepacivirus/metabolismo , Hepatite C Crônica/patologia , Hepatite C Crônica/virologia , Humanos , Interferon-alfa/uso terapêutico , Extratos Vegetais/química , Ribavirina/uso terapêutico
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA