Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 2.767
Filtrar
1.
Bratisl Lek Listy ; 120(9): 699-702, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31475558

RESUMO

OBJECTIVES: The aim of our study is to demonstrate a causal link between two distinct diagnoses, the hereditary hearing loss, and the sudden sensorineural hearing loss. BACKGROUND: Sudden sensorineural hearing loss is an emergency condition in otolaryngology and a rare diagnosis in childhood. Most often it only affects one ear and its cause remains unknown. METHODS: We present a clinical study of a 10-year-old female patient presenting with bilateral sudden sensorineural hearing loss analyzed by Sanger sequencing of the GJB2 gene. RESULTS: The subject was referred to the hospital for bilateral sudden hearing loss which developed 3 days before the admission. Audiometric testing confirmed bilateral asymmetric sensorineural hearing loss. All routine diagnostic procedures including MRI and CT imaging showed normal results. She was treated with intravenous and intratympanic corticosteroids followed by hyperbaric oxygen therapy with partial hearing recovery in one ear. DNA analysis of the GJB2 gene identified biallelic c.35delG deletion. The subject had no other affected family members and her auditory development to that time was normal. CONCLUSION: Our finding extends the knowledge on phenotype variability in GJB2 variants. We suggest considering genetic testing in pediatric cases of bilateral sudden sensorineural hearing loss (Tab. 1, Fig. 4, Ref. 24).


Assuntos
Perda Auditiva Neurossensorial/genética , Perda Auditiva Súbita/genética , Criança , Conexinas/genética , Análise Mutacional de DNA , Feminino , Humanos , Deleção de Sequência
2.
Artigo em Chinês | MEDLINE | ID: mdl-31446694

RESUMO

Summary Mitochondrial DNA(mtDNA) deletion is a rare occurrence that results in defects to oxidative phosphorylation. The common clinical presentations of mtDNA deletion vary but include mitochondrial myopathy, Pearson syndrome, Kearns-Sayre syndrome, and progressive external ophthalmoplegia. However, in clinical practice, some cases cannot be classified as any typical syndrome due to the absence or overlap of phenotypes. Here, we report one case of a 5-year-old girl who presented with progressive deterioration of her clinical status, which included systemic electrolyte disturbance, Fanconi syndrome and sensorineural hearing loss. Through a combination of systematic examinations and molecular analyses, mitochondrial disease was confirmed. A novel 6991-base pair deletion(deletion of mtDNA nt 7808-14798) was identified which confirmed molecular pathogeny of patient. Following treatment, the patient was stabilized and her hearing loss improved by hearing aid. This paper provided an important reference for the diagnosis and treatment of similar patients in clinical practice.


Assuntos
DNA Mitocondrial/genética , Perda Auditiva Neurossensorial/genética , Doenças Mitocondriais/genética , Deleção de Sequência , Pré-Escolar , Síndrome de Fanconi/genética , Feminino , Auxiliares de Audição , Perda Auditiva Neurossensorial/terapia , Humanos
3.
J Laryngol Otol ; 133(8): 650-657, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31358070

RESUMO

OBJECTIVE: This review summarises the current literature on the role of microRNAs in presbyacusis (age-related hearing loss) and sudden sensorineural hearing loss. METHODS: Medline, PubMed, Web of Science and Embase databases were searched for primary English-language studies, published between 2000 and 2017, which investigated the role of microRNAs in the pathogenesis of presbyacusis or sudden sensorineural hearing loss. Quality of evidence was assessed using the National Institutes of Health quality assessment tool. RESULTS: Nine of 207 identified articles, 6 of good quality, satisfied the review's inclusion criteria. In presbyacusis, microRNAs in pro-apoptotic and autophagy pathways are upregulated, while microRNAs in proliferative and differentiation pathways are downregulated. Evidence for microRNAs having an aetiological role in sudden hearing loss is limited. CONCLUSION: A shift in microRNA expression, leading to reduced cellular activity and impaired inner-ear homeostasis, may contribute to the pathogenesis of presbyacusis.


Assuntos
Perda Auditiva Neurossensorial/genética , MicroRNAs/genética , Presbiacusia/genética , Idoso , Animais , Apoptose , Humanos
4.
Genet Test Mol Biomarkers ; 23(6): 423-427, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-31063410

RESUMO

Aim: The aim of this study was to report a novel POU Class 3 Homeobox 4 (POU3F4) variant and to provide further guidance on genetic counseling for incomplete partition (IP) type III families in the Korean population by showing two new contrasting cases in terms of genotypes and inheritance. Materials and Methods: Two consecutively recruited hearing-impaired probands with seemingly nonsyndromic features and their biological mothers were included in this study. Sanger sequencing and quantitative polymerase chain reaction (PCR) assays were performed for POU3F4. Results: A novel frameshift variant of POU3F4, c.852delC (p.Ile285Serfs*3), was identified in one of the patients. This mutation is predicted to truncate the protein within the POU homeodomain, resulting in the complete loss of the last nucleus localization signal. The proband's biological mother was also shown to be a carrier of this c.852delC (p.Ile285Serfs*3) mutant allele. A de novo genomic deletion on chromosome Xq21.2 was confirmed in another subject via quantitative PCR. This subject's biological mother, however, was not a carrier of this deletion. This indicates that the large upstream deletion of POU3F4 in the second proband occurred de novo. This finding is compatible with the previously proposed tendency for a high de novo rate of large genomic deletions involving the X-linked deafness-2 (DFNX2) locus. Conclusion: This study adds a novel, probably pathogenic POU3F4 truncation variant to the literature and provides guidance toward effective genetic counseling for IP III subjects based on more frequent de novo occurrence of POU3F4 deletions than POU3F4 point variants.


Assuntos
Doenças Genéticas Ligadas ao Cromossomo X/genética , Perda Auditiva Neurossensorial/genética , Fatores do Domínio POU/genética , Adulto , Criança , Surdez/genética , Família , Feminino , Mutação da Fase de Leitura/genética , Aconselhamento Genético/métodos , Doenças Genéticas Ligadas ao Cromossomo X/metabolismo , Genótipo , Perda Auditiva/genética , Perda Auditiva Neurossensorial/metabolismo , Humanos , Masculino , Mutação , Linhagem , República da Coreia
5.
BMC Med Genet ; 20(1): 76, 2019 05 07.
Artigo em Inglês | MEDLINE | ID: mdl-31064337

RESUMO

BACKGROUND: Brown-Vialetto-Van Laere Syndrome (BVVLS), a rare neurological disorder characterized by motor, sensory, and cranial neuronopathies, is mainly associated with defective riboflavin transporters encoded by SLC52A2 and SLC52A3 genes. Clinical outcomes have been shown to be improved significantly by high-dose riboflavin supplementation. The aim of this study was to identify genetic causes and further evaluate the clinical course and response to riboflavin in a Chinese pedigree with BVVLS. CASE PRESENTATION: We report the novel compound heterozygous variants c.1328G>A p.(Cys443Tyr) and c.1022_1023insC p. (Leu341Profs*103) of SLC52A2 gene in a female proband who presented in our out-patient clinic at the age of one-year-old with progressive mental and motor regression, breath holding, and brain stem dysfunction including facial weakness, hearing loss, dysphagia. Following high-dose riboflavin supplementation, the respiratory insufficiency and mental, motor, and bulbar function improved. However, sensorineural hearing loss was not improved. The missense variant site was highly conserved. Both variants were not found in the population database gnomAD. The two variants were inherited from her mother and father, respectively. Both variants were predicted to be deleterious by Polyphen2, Mutation taster, and SIFT and were classified as likely pathogenic according to the ACMG guideline. CONCLUSIONS: Two novel pathogenic variations of SLC52A2 gene were firstly found from a Chinese pedigree with BVVLS. Clinical outcomes could be improved by early diagnosis and riboflavin supplementation.


Assuntos
Paralisia Bulbar Progressiva/genética , Perda Auditiva Neurossensorial/genética , Mutação , Receptores Acoplados a Proteínas-G/genética , Sequência de Aminoácidos , China , Feminino , Humanos , Lactente , Masculino , Linhagem , Receptores Acoplados a Proteínas-G/química , Homologia de Sequência de Aminoácidos
6.
Zhonghua Er Ke Za Zhi ; 57(4): 286-290, 2019 Apr 02.
Artigo em Chinês | MEDLINE | ID: mdl-30934202

RESUMO

Objective: To summarize the clinical data and molecular characteristics of two siblings with Fechtner syndrome. Methods: A retrospective analysis was made on the clinical data, laboratory tests and genetic test results of two siblings with Fechtner syndrome in a family who were followed up in the Department of Nephrology, Children's Hospital Affiliated to Nanjing Medical University from April 2018 to August 2018. Results: Both siblings showed proteinuria, microscopic hematuria and thrombocytopenia. Giant platelets and leucocyte inclusions were easily seen in peripheral blood smears and bone marrow cells, but the results of renal function, hearing and ophthalmologic examinations were normal. The father of the siblings presented with proteinuria, thrombocytopenia, and hearing loss. At the age of 26 years, he developed uremia and now requires hemodialysis. The renal biopsy of the elder sister suggested focal segmental glomerulosclerosis. Gene analysis showed that the siblings and their father MYH9 gene 25 exon c.3195_c.3215 delCGAGCTCCAGCCCAGATCGC (p.A1065_A1072 del) deletion mutation. The elder sister was treated with benazepril hydrochloride for 4 months and the proteinuria was improved. Her younger brother was given tacrolimus for 3 months, but the proteinuria did not improve significantly, then benazepril hydrochloride was given for 1 month and proteinuria improved. Conclusions: Fechtner syndrome is characterized by nephritis, thrombocytopenia, giant platelets and leucocyte inclusions. The variant of MYH9 gene is the cause of Fechtner syndrome. The deletion mutation of p.A1065_A1072del is the second international report. Angiotensin-converting enzyme inhibitors may be effective in reducing proteinuria in patients with Fechtner syndrome.


Assuntos
Perda Auditiva Neurossensorial/genética , Proteínas Motores Moleculares/genética , Cadeias Pesadas de Miosina/genética , Irmãos , Trombocitopenia/congênito , Criança , Feminino , Variação Genética , Humanos , Masculino , Estudos Retrospectivos , Trombocitopenia/genética
7.
Int J Pediatr Otorhinolaryngol ; 122: 27-34, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30933841

RESUMO

OBJECTIVES: To identify the average age of identification (AOI) and characteristics of Saudi children with sensorineural hearing loss (SNHL). METHODS: Two cross-sectional studies were undertaken. Study A: the medical records of 1166 children aged 0-10 years old who visited the audiology clinics in four hospitals in Riyadh and Dammam during 2015 were reviewed. Study B: 174 carers of children aged 0-12 years who visited the audiology clinics in four hospitals in Riyadh during a three-month period were surveyed. RESULTS: The mean AOI with SNHL in children was 3.2 years (SD = 2.5 years) and 3.1 years (SD = 2.6 years) with 14% and 16% not identified until after primary school age for Studies A and B, respectively. The presence of SNHL was positively associated with parental consanguinity, positive family history of SNHL, history of chemotherapy treatment, brain pathology and prior parental concern regarding their child's hearing. CONCLUSION: AOI of SNHL among Saudi children is deemed high in relation to the likely age of onset, with about 15 in 100 children identified after school age. Childhood hearing screening programmes (at birth and at school entry) should be considered in order to intervene earlier.


Assuntos
Perda Auditiva Neurossensorial/diagnóstico , Perda Auditiva Neurossensorial/epidemiologia , Fatores Etários , Encefalopatias/epidemiologia , Criança , Pré-Escolar , Consanguinidade , Estudos Transversais , Feminino , Perda Auditiva Neurossensorial/genética , Humanos , Lactente , Recém-Nascido , Masculino , Pais , Fatores de Risco , Arábia Saudita/epidemiologia , Inquéritos e Questionários
8.
Artigo em Chinês | MEDLINE | ID: mdl-30970410

RESUMO

Objective:To analogize the distribution of nonsyndromic deafness gene SLC26A4 mutation and to characterize clinical profiles in patients with SLC26A4 mutation in order to understand their hereditary etiologies and provide evidence for deafness screening and accurate genetic counseling. Method: SLC26A4 gene was first analized by MALDI-TOF-MS technology to detect the hot mutation c.919-2A>G in 57 cases. There were 3 cases with homozygous mutation and 7cases with heterozygous mutation. Then 54 cases except for 3 cases with homozygous mutation were analyzed by targeted genomic capturing and next generation sequencing technologies(targeted DNA-Hiseq), 81 non-syndromic deafness genes and the chondiogene was designed to all their exons and their flanking intron(±10 bp) sequences. Sanger sequencing was used to confirm the variant by analyzing the DNAs sequences. Result: The carrying rates of SLC26A4 gene in the deafness were 26.32%, but SLC26A4 homozygous genes and compound heterozygous genes were 19.30%. They included 3 cases with c.919-2A>G and 1 case with c.754T>C pathogenic homozygous mutations. While in 7 cases with compound heterozygous there were 6 cases with two pathogenic mutation, there was 1 case with c.2168A>G pathogenic mutation the other likely pathogenic mutation c.1545-1546insC. The 11 cases all were diagnosed large vestibular aqueduct syndrome(LVAS). There were 4 cases with heterozygous that were not found large vestibular aqueduct. Conclusion: Pathogenic mutation of SLC26A4 is closely related to clinical phenotype of LVAS. The hot pathogenic mutation was c.919-2A>G of SLC26A4 gene. The next generation sequencing technology is available for the diagnosis of inherited hearing loss especially for LVAS.


Assuntos
Surdez , Perda Auditiva Neurossensorial , Proteínas de Membrana Transportadoras , Mutação , Transportadores de Sulfato , Aqueduto Vestibular , Conexinas , Surdez/genética , Perda Auditiva Neurossensorial/genética , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Humanos , Transportadores de Sulfato/genética
9.
Medicina (Kaunas) ; 55(3)2019 Mar 25.
Artigo em Inglês | MEDLINE | ID: mdl-30934652

RESUMO

The term congenital hypopigmentary disorders refers to a wide group of heterogeneous hereditary diseases, clinically characterized by inborn pigmentary defects of the iris, hair, and/or skin. They include Gray Hair Syndromes (GHSs), a rare group of autosomal recessive genodermatosis hallmarked by inborn silvery gray hair. GHSs encompass Griscelli, Chediak⁻Higashi, Elejalde, and Cross syndromes, which are all characterized by a broad spectrum of severe multisystem disorders, including neurological, ocular, skeletal, and immune system impairment. In this manuscript, we describe in detail the clinical, trichoscopic, and genetic features of a rare case of Griscelli syndrome; moreover, we provide an overview of all the GHSs known to date. Our report highlights how an accurate clinical examination with noninvasive methods, like trichoscopy, may play a crucial rule in diagnosis of rare and potentially lethal genetic syndromes such as Griscelli syndrome, in which timely diagnosis and therapy may modify the clinical course, quality of life, and likelihood of survival.


Assuntos
Transtornos da Pigmentação/diagnóstico , Transtornos da Pigmentação/genética , Doenças Raras/diagnóstico , Doenças Raras/genética , Anormalidades Múltiplas/diagnóstico , Anormalidades Múltiplas/genética , Anormalidades Múltiplas/imunologia , Anormalidades Múltiplas/patologia , Adulto , Síndrome de Chediak-Higashi/diagnóstico , Síndrome de Chediak-Higashi/genética , Síndrome de Chediak-Higashi/imunologia , Síndrome de Chediak-Higashi/patologia , Pré-Escolar , Anormalidades Craniofaciais/diagnóstico , Anormalidades Craniofaciais/genética , Anormalidades Craniofaciais/imunologia , Anormalidades Craniofaciais/patologia , Diagnóstico Diferencial , Feminino , Cabelo/anormalidades , Perda Auditiva Neurossensorial/diagnóstico , Perda Auditiva Neurossensorial/genética , Perda Auditiva Neurossensorial/imunologia , Perda Auditiva Neurossensorial/patologia , Humanos , Hipertricose/induzido quimicamente , Iris/anormalidades , Masculino , Mutação , Síndromes Neurocutâneas/diagnóstico , Síndromes Neurocutâneas/genética , Síndromes Neurocutâneas/imunologia , Síndromes Neurocutâneas/patologia , Piebaldismo/diagnóstico , Piebaldismo/genética , Piebaldismo/imunologia , Piebaldismo/patologia , Transtornos da Pigmentação/imunologia , Transtornos da Pigmentação/patologia , Qualidade de Vida , Doenças Raras/imunologia , Doenças Raras/patologia , Anormalidades da Pele , Proteínas rab27 de Ligação ao GTP/genética
10.
BMC Med Genet ; 20(1): 57, 2019 04 01.
Artigo em Inglês | MEDLINE | ID: mdl-30935366

RESUMO

BACKGROUND: Many mutations in the α-tectorin gene (TECTA) have been reported to cause non-syndromic hearing loss (NSHL) in either a dominant or recessive inheritance pattern. Among the identified TECTA mutations, H1400Y has been associated with NSHL in two independent studies. However, its exact role in contributing to genetic hearing loss remains elusive. CASE PRESENTATION: We herein report the whole-exome sequencing of a proband presenting with prelingual, non-progressive, mild-to-moderate hearing loss in a simplex family. By using trio-based whole-exome sequencing, we found two heterozygous mutations of R1890C and H1400Y in the ZP and ZA domains of TECTA, respectively. R1890C, previously reported as a pathogenic autosomal dominant mutation of genetic hearing loss, was found to be inherited in a de novo pattern, causing hearing loss in the proband. By contrast, H1400Y was not segregated in this family, and one family member with normal hearing also carried the H1400Y mutation. CONCLUSION: According to the hearing loss-specific American College of Medical Genetics and Genomics (ACMG) guidelines, we conclude that H1400Y should be disqualified as a cause of genetic hearing loss. True pathogenic variants causing genetic hearing loss should be more deliberately reported in accordance with ACMG guidelines.


Assuntos
Proteínas da Matriz Extracelular/genética , Perda Auditiva Neurossensorial/genética , Mutação , Pré-Escolar , Feminino , Proteínas Ligadas por GPI/genética , Genes Dominantes , Sequenciamento de Nucleotídeos em Larga Escala , Humanos
11.
ScientificWorldJournal ; 2019: 5198931, 2019.
Artigo em Inglês | MEDLINE | ID: mdl-31015822

RESUMO

In silico predictive software allows assessing the effect of amino acid substitutions on the structure or function of a protein without conducting functional studies. The accuracy of in silico pathogenicity prediction tools has not been previously assessed for variants associated with autosomal recessive deafness 1A (DFNB1A). Here, we identify in silico tools with the most accurate clinical significance predictions for missense variants of the GJB2 (Cx26), GJB6 (Cx30), and GJB3 (Cx31) connexin genes associated with DFNB1A. To evaluate accuracy of selected in silico tools (SIFT, FATHMM, MutationAssessor, PolyPhen-2, CONDEL, MutationTaster, MutPred, Align GVGD, and PROVEAN), we tested nine missense variants with previously confirmed clinical significance in a large cohort of deaf patients and control groups from the Sakha Republic (Eastern Siberia, Russia): Сх26: p.Val27Ile, p.Met34Thr, p.Val37Ile, p.Leu90Pro, p.Glu114Gly, p.Thr123Asn, and p.Val153Ile; Cx30: p.Glu101Lys; Cx31: p.Ala194Thr. We compared the performance of the in silico tools (accuracy, sensitivity, and specificity) by using the missense variants in GJB2 (Cx26), GJB6 (Cx30), and GJB3 (Cx31) genes associated with DFNB1A. The correlation coefficient (r) and coefficient of the area under the Receiver Operating Characteristic (ROC) curve as alternative quality indicators of the tested programs were used. The resulting ROC curves demonstrated that the largest coefficient of the area under the curve was provided by three programs: SIFT (AUC = 0.833, p = 0.046), PROVEAN (AUC = 0.833, p = 0.046), and MutationAssessor (AUC = 0.833, p = 0.002). The most accurate predictions were given by two tested programs: SIFT and PROVEAN (Ac = 89%, Se = 67%, Sp = 100%, r = 0.75, AUC = 0.833). The results of this study may be applicable for analysis of novel missense variants of the GJB2 (Cx26), GJB6 (Cx30), and GJB3 (Cx31) connexin genes.


Assuntos
Conexina 30/genética , Conexinas/genética , Perda Auditiva Neurossensorial/genética , Mutação de Sentido Incorreto , Software , Substituição de Aminoácidos , Simulação por Computador , Estudos de Associação Genética , Modelos Moleculares
12.
Int J Pediatr Otorhinolaryngol ; 121: 143-149, 2019 Jun.
Artigo em Inglês | MEDLINE | ID: mdl-30909120

RESUMO

OBJECTIVES: Although hearing loss is a well-known symptom of mitochondria-related disorders, it is not clear how often it is a congenital and cochlear impairment. The Newborn Hearing Screening Program (NHSP) enables to distinguish congenital cochlear deafness from an acquired hearing deficit. The initial aim of the study was to research the frequency of the congenital cochlear hearing loss among patients with various gene defects resulting in mitochondrial disorders. The research process brought on an additional gain: basing on our preliminary study group of 80 patients, in 12 patients altogether we identified two defected genes responsible for mitochondrial disorders, whose carriers did not pass the NHSP. Finally, these patients were diagnosed with the congenital cochlear deafness. MATERIAL AND METHODS: The results of the NHSP in the patients with mitochondrial disorders diagnosed in our tertiary reference center were analyzed. Only the cases with confirmed mutations were qualified for the study group. The NHSP database included 80 patients with mutations in 31 different genes: 25 nuclear-encoded and 6 mtDNA-encoded. We searched the literature for the presence of a congenital hearing impairment (CHI) in mitochondrial disorders caused by changes in 278 already known genes. RESULTS: For 68 patients from the study group the NHSP test indicated a proper cochlear function and thus suggested normal hearing. For 12 mitochondrial patients, the NHSP test indicated the requirement for the further audiological diagnosis, and finally CHI was confirmed in 8 of them. This latter subset included patients with pathogenic variants in RRM2B and SERAC1, known as "deafness-causing genes". Contrary to our initial expectations, the patients carrying mutations in other "deafness-causing genes": MPV17, POLG, COX10, as well as other mitochondria-related genes, all reported in literature, did not indicate any CHI following the NHSP test. CONCLUSION: Our study indicates that the cochlear CHI is a phenotypic feature of the RRM2B and SERAC1 related defects. The diagnosis of the CHI following the NHSP allows to early distinguish those defects from other mitochondria-related disorders in which the NHSP test result is correct. Wider studies are needed to assess the significance of this observation.


Assuntos
Hidrolases de Éster Carboxílico/genética , Proteínas de Ciclo Celular/genética , Surdez/genética , Perda Auditiva Neurossensorial/genética , Doenças Mitocondriais/genética , Ribonucleotídeo Redutases/genética , Adolescente , Criança , Pré-Escolar , DNA Mitocondrial , Surdez/congênito , Feminino , Perda Auditiva Neurossensorial/congênito , Testes Auditivos , Heterozigoto , Hospitais , Humanos , Lactente , Recém-Nascido , Masculino , Doenças Mitocondriais/complicações , Doenças Mitocondriais/diagnóstico , Mutação , Triagem Neonatal , Polônia
13.
Mol Genet Genomic Med ; 7(5): e639, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30924321

RESUMO

BACKGROUND: Warsaw Breakage Syndrome (WABS) is an ultra rare cohesinopathy caused by biallelic mutation of DDX11 gene. It is clinically characterized by pre and postnatal growth delay, microcephaly, hearing loss with cochlear hypoplasia, skin color abnormalities, and dysmorphisms. METHODS: Mutational screening and functional analyses (protein expression and 3D-modeling) were performed in order to investigate the presence and pathogenicity of DDX11 variant identified in our patients. RESULTS: We report the clinical history of two sisters affected by WABS with a pathological mytomicin C test carrying compound heterozygous mutations (c.2507T > C / c.907_920del) of the DDX11 gene. The pathogenicity of this variant was confirmed in the light of a bioinformatic study and protein three-dimensional modeling, as well as expression analysis. CONCLUSION: These findings further extend the clinical and molecular knowledge about the WABS showing a possible mild phenotype without major malformations or intellectual disability.


Assuntos
Anormalidades Múltiplas/genética , Manchas Café com Leite/genética , RNA Helicases DEAD-box/genética , DNA Helicases/genética , Perda Auditiva Neurossensorial/genética , Fenótipo , Anormalidades Múltiplas/patologia , Manchas Café com Leite/patologia , Linhagem Celular , Células Cultivadas , Criança , Pré-Escolar , Feminino , Perda Auditiva Neurossensorial/patologia , Humanos , Mutação , Síndrome
14.
Eur Arch Otorhinolaryngol ; 276(5): 1251-1262, 2019 May.
Artigo em Inglês | MEDLINE | ID: mdl-30806805

RESUMO

BACKGROUND AND OBJECTIVES: The Pro51Ser (P51S) COCH mutation is characterized by a late-onset bilateral sensorineural hearing loss (SNHL) and progressive vestibular deterioration. The aim of this study was to carry out a systematic review of all reported hearing and vestibular function data in P51S COCH mutation carriers and its correlation with age. MATERIALS AND METHODS: Scientific databases including Medline, Cochrane Database of Systematic Reviews, Cochrane Central Register of Controlled Trials, ISI Web of Knowledge, and Web of Science were searched to accumulate information about hearing outcome and vestibular function. Eleven genotype-phenotype correlation studies of the P51S COCH variant were identified and analyzed. RESULTS: The SNHL starts at the age of 32.8 years. The Annual Threshold Deterioration is 3 decibel hearing loss (dB HL) per year (1-24 dB HL/year). Profound SNHL was observed at 76 years on average (60-84 years). 136 individual vestibular measurements were collected from 86 carriers. The onset of the vestibular dysfunction was estimated around 34 years (34-40 years), and vestibular deterioration rates were higher than those of the SNHL, with complete bilateral loss observed between 49 and 60 years. CONCLUSION: Both audiometric and vestibular data were processed with much different methodologies and pre-symptomatic P51S carriers were systematically underrepresented. Further delineation of this correlation would benefit cross-sectional and longitudinal study involving all (pre-symptomatic and symptomatic) P51S carriers.


Assuntos
Proteínas da Matriz Extracelular/genética , Perda Auditiva Neurossensorial/genética , Heterozigoto , Mutação , Vestíbulo do Labirinto/fisiopatologia , Adulto , Fatores Etários , Idoso , Idoso de 80 Anos ou mais , Audiometria , Feminino , Audição/genética , Perda Auditiva Neurossensorial/fisiopatologia , Humanos , Masculino , Pessoa de Meia-Idade
15.
Int J Pediatr Otorhinolaryngol ; 120: 15-19, 2019 May.
Artigo em Inglês | MEDLINE | ID: mdl-30743189

RESUMO

INTRODUCTION: Aminoglycosides are a well-known clinically relevant antibiotic family used to treat bacterial infections in humans and animals and can produce toxic side effects. Aminoglycoside-induced hearing loss (HL) has been shown to have a genetic susceptibility. Mitochondrial DNA mutations have been implicated in inherited and acquired hearing impairment. OBJECTIVE: Literature review of genetic mutations associated with aminoglycoside-induced ototoxicity. METHODS: PubMed was accessed from 1993 to 2017 using the search terms "aminoglycoside, genetic, ototoxicity, hearing loss". Exclusion criteria consisted of a literature in a language other than English, uncompleted or ongoing studies, literature with non-hearing related diseases, literature on ototoxicity due to cisplatin/carboplatin based chemotherapy, literature on ototoxicity from loop diuretics, animal studies, literature studying oto-protective agents, and literature without documented aminoglycoside exposure. RESULTS: 108 articles were originally identified, and 25 articles were included in our review. Mitochondrial 12S rRNA mutations were identified in all 25 studies in a total of 220 patients. Eight studies identified A1555G mutation as primary genetic factor underlying HL in cases of aminoglycoside-induced ototoxicity. The next most common mutation identified was C1494T. DISCUSSION: Mitochondrial 12s rRNA mutation A1555G was present in American, Chinese, Arab-Israeli, Spanish and Mongolian ethnicities. All mutations leading to aminoglycoside ototoxicity were mitochondrial mutations. CONCLUSIONS: Consideration of preexisting genetic defects may be valuable in treatments involving aminoglycosides. In particular populations such as those of Chinese origin, clinicians should continue to consider the increased susceptibility to aminoglycosides.


Assuntos
Aminoglicosídeos/efeitos adversos , Antibacterianos/efeitos adversos , Perda Auditiva Neurossensorial/induzido quimicamente , Feminino , Predisposição Genética para Doença , Perda Auditiva Neurossensorial/genética , Humanos , Masculino , Mutação , RNA Ribossômico/genética
16.
BMC Med Genet ; 20(1): 30, 2019 02 13.
Artigo em Inglês | MEDLINE | ID: mdl-30760222

RESUMO

BACKGROUND: Deafness, autosomal recessive 77 (DFNB77) is a rare non-syndromic hearing loss (NSHL) worldwide, which is caused by deleterious variants within lipoxygenase homology domains 1 (LOXHD1). Here we identified that a novel missense variant of LOXHD1 was associated with NSHL in a Chinese family under consanguineous marriage. CASE PRESENTATION: A 28-year-old woman suffered a bilateral profound NSHL. Impedance audiometry, temporal bone computerized tomography (TBCT) scans and magnetic resonance imaging-inner ear hydrography (MRI-IEH) did not find any obvious abnormality of middle or inner ear. Routine genetic detection did not find pathogenic variants in common HL-associated genes. Therefore, we performed a whole-exome sequencing (WES) in this family. By trio-WES, co-segregation validation and bioinformatics analysis, we revealed that a novel homozygous variant in this patient, LOXHD1: c.5948C > T (p.S1983F), might be the pathogenic factor. Her parents (heterozygotes) and brother (wild-type) were asymptomatic. CONCLUSIONS: We successfully identified a novel variant of LOXHD1 associated with a rare NSHL from a Chinese family. Our finds highlight the effectiveness of trio-WES for molecular diagnosis of rare NHSL, and expand the genotypic spectrum of DFNB77.


Assuntos
Grupo com Ancestrais do Continente Asiático/etnologia , Proteínas de Transporte/genética , Perda Auditiva Neurossensorial/genética , Mutação de Sentido Incorreto , Sequenciamento Completo do Exoma/métodos , Adulto , Grupo com Ancestrais do Continente Asiático/genética , Consanguinidade , Feminino , Perda Auditiva Neurossensorial/etnologia , Humanos , Masculino , Linhagem , Polimorfismo de Nucleotídeo Único
17.
Genet Test Mol Biomarkers ; 23(3): 204-208, 2019 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30758234

RESUMO

AIMS: Autosomal recessive nonsyndromic hearing loss (ARNSHL) is the most common form of hereditary deafness. Despite its frequency, the diagnosis of this disorder continues to be a challenging task given its extreme genetic heterogeneity. The purpose of this study was to identify the causative mutation in a consanguineous United Arab Emirates (UAE) family with ARNSHL. MATERIALS AND METHODS: Clinical exome sequencing (CES) followed by segregation analysis via Sanger sequencing was used to identify the causative mutation. In addition, 109 deaf individuals and 50 deafness-free controls from the UAE population were screened for the identified mutation. RESULTS AND DISCUSSION: CES identified the STRC frameshift mutation c.4510del (p.Glu1504Argfs*32) as the causative mutation in this family. Moreover, segregation analysis confirmed the above finding. In addition, the absence of this variant in 109 unrelated deaf individuals and 50 healthy controls indicates that it is rare in the UAE population. CONCLUSION: The present study represents the first STRC mutation reported in the UAE population. It also reinforces the power of next-generation sequencing in the diagnosis of heterogenous disorders such as nonsyndromic hearing loss.


Assuntos
Surdez/genética , Proteínas de Membrana/genética , Adulto , Exoma/genética , Feminino , Mutação da Fase de Leitura/genética , Genes Recessivos/genética , Perda Auditiva Neurossensorial/genética , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Humanos , Masculino , Proteínas de Membrana/fisiologia , Mutação , Linhagem , Emirados Árabes Unidos , Sequenciamento Completo do Exoma
18.
J Hum Genet ; 64(4): 341-346, 2019 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-30692597

RESUMO

The genetic causes of combined pituitary hormone deficiency remain elusive in most patients. Recently, incompletely penetrant heterozygous mutations in ROBO1 have been described in patients with pituitary stalk interruption syndrome. Herein, we identified a novel homozygous slice site mutation in ROBO1 (c.1342+1G>A) using a trio whole-exome sequencing strategy in a 5-year-old Japanese boy who had combined pituitary hormone deficiency, psychomotor developmental delay, severe intellectual disability, sensorineural hearing loss, strabismus, and characteristic facial features, including a broad forehead, micrognathia, and arched eyebrows. Magnetic resonance imaging delineated anterior pituitary hypoplasia, ectopic posterior pituitary, invisible pituitary stalk, thinning of the corpus callosum, and hypoplasia of the pons and midbrain. The phenotypically normal parents (first cousins) were heterozygous for the mutation. The results provide further evidence of ROBO1 being involved in the development of the pituitary gland. A recessive mutation of ROBO1 is a potential novel cause of a syndromic disorder associated with combined pituitary hormone deficiency.


Assuntos
Perda Auditiva Neurossensorial/genética , Hipopituitarismo/genética , Deficiência Intelectual/genética , Proteínas do Tecido Nervoso/genética , Receptores Imunológicos/genética , Pré-Escolar , Corpo Caloso/diagnóstico por imagem , Corpo Caloso/fisiopatologia , Perda Auditiva Neurossensorial/complicações , Perda Auditiva Neurossensorial/diagnóstico por imagem , Perda Auditiva Neurossensorial/fisiopatologia , Humanos , Hipopituitarismo/complicações , Hipopituitarismo/diagnóstico por imagem , Hipopituitarismo/fisiopatologia , Deficiência Intelectual/complicações , Deficiência Intelectual/diagnóstico por imagem , Deficiência Intelectual/fisiopatologia , Imagem por Ressonância Magnética , Masculino , Mutação , Sítios de Splice de RNA/genética , Sequenciamento Completo do Exoma
19.
Nat Commun ; 10(1): 427, 2019 01 25.
Artigo em Inglês | MEDLINE | ID: mdl-30683875

RESUMO

Adeno-associated virus (AAV) has been successfully used to deliver gene therapy to improve auditory function in mouse models of hereditary hearing loss. Many forms of hereditary hearing loss have mutations which affect the cochlear hair cells, the mechanosensory cells which allow for sound detection and processing. While most conventional AAVs infect inner hair cells (IHCs) with various efficiencies, they infect outer hair cells (OHCs) and supporting cells at lower levels in the cochlea. Here we examine the infection patterns of two synthetic AAVs (AAV2.7m8 and AAV8BP2) in the mouse inner ear. AAV2.7m8 infects both IHCs and OHCs with high efficiency. In addition, AAV2.7m8 infects inner pillar cells and inner phalangeal cells with high efficiency. Our results suggest that AAV2.7m8 is an excellent viral vector for inner ear gene therapy targeting cochlear hair cells and supporting cells, and it will likely greatly expand the potential applications for inner ear gene therapy.


Assuntos
Dependovirus/genética , Terapia Genética/métodos , Vetores Genéticos/metabolismo , Células Ciliadas Auditivas Internas/metabolismo , Perda Auditiva Neurossensorial/terapia , Miosinas/genética , Animais , Animais Recém-Nascidos , Dependovirus/metabolismo , Modelos Animais de Doenças , Expressão Gênica , Genes Reporter , Vetores Genéticos/química , Proteínas de Fluorescência Verde/genética , Proteínas de Fluorescência Verde/metabolismo , Células Ciliadas Auditivas Internas/patologia , Células Ciliadas Auditivas Externas/metabolismo , Células Ciliadas Auditivas Externas/patologia , Audição/genética , Perda Auditiva Neurossensorial/genética , Perda Auditiva Neurossensorial/metabolismo , Perda Auditiva Neurossensorial/patologia , Camundongos , Miosinas/metabolismo
20.
Can J Vet Res ; 83(1): 11-16, 2019 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-30670897

RESUMO

The objective of this study was to evaluate any otopathologic changes in temporal bone specimens from dogs with deafness related to cochleosaccular (Scheibe) dysplasia (CSD). We used the canine temporal bone collections of the Otopathology Laboratory at the University of Minnesota and of the Massachusetts Eye and Ear Infirmary at Harvard University in Boston. Our morphometric analysis included measuring the areas of the stria vascularis and the spiral ligament and counting the number of spiral ganglion cells. In addition, we noted the presence of the organ of Corti and cochlear hair cells, assessed the location of Reissner's membrane and the saccular membrane, and counted the number of both Type I and Type II vestibular hair cells in the macule of the saccule and vestibular ganglion cells. In the group of specimens from dogs with cochleosaccular dysplasia, we observed generalized degeneration in the cochlea and a significantly decreased number of Type I and Type II vestibular hair cells and vestibular ganglion cells. As hereditary deafness is presently untreatable with known therapeutic methods, dogs with cochleosaccular dysplasia should not be considered for breeding. Future therapeutic approaches, such as stem cell therapies, should be designed to target all the elements of the cochlea in addition to the saccule as it was found that both are affected in dogs with CSD.


Assuntos
Cóclea/patologia , Doenças do Cão/patologia , Perda Auditiva Neurossensorial/veterinária , Osso Temporal/patologia , Animais , Doenças do Cão/genética , Cães , Perda Auditiva Neurossensorial/genética , Perda Auditiva Neurossensorial/patologia , Células Ganglionares da Retina
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA