Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 1.350
Filtrar
1.
Eur J Endocrinol ; 183(6): K7-K12, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-33105102

RESUMO

A monoallelic germline alteration of ARMC5 causes primary bilateral macronodular adrenal hyperplasia (PBMAH) with Cushing's syndrome via its subsequent somatic alteration on the other allele as the second hit. PBMAH is sometimes complicated with meningioma. Dependency of such a multi-organ disease on the second hit mechanism was reported before, but this finding has not been confirmed yet. We describe a case of a 65-year-old female with PBMAH, carrying a heterozygous germline alteration of ARMC5, p.R267*, complicated with meningioma associated with somatic loss of heterozygosity (LOH) of the unaffected allele. Pathogenic alterations of ARMC5 may also contribute to the development of meningioma by the two-hit mechanism.


Assuntos
Proteínas do Domínio Armadillo/genética , Síndrome de Cushing/genética , Neoplasias Meníngeas/genética , Meningioma/genética , Idoso , Alelos , Feminino , Mutação em Linhagem Germinativa/genética , Humanos , Perda de Heterozigosidade/genética
2.
Anticancer Res ; 40(11): 6355-6366, 2020 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-33109573

RESUMO

BACKGROUND/AIM: p16 and PTEN are tumor suppressor genes. Loss of these molecules in oral squamous cell carcinoma (OSCC) has been studied worldwide. In this study, we explored whether p16 cooperates with inactive PTEN during the pathogenesis of OSCC, especially in regard to tumor aggressiveness and proliferation. MATERIALS AND METHODS: Immunocytochemistry and western blot analysis were used to examine the levels of p16 and PTEN. Sequencing analysis was performed to identify mutations in the PTEN gene and HPV infection. Fluorescence in situ hybridization was used to examine the presence of the PTEN locus. RESULTS: PTEN analysis showed high positivity in T4 samples. HPV-positive tumors correlated with tabagism, tumor size 3 and 4, disease stages 3 and 4, presence of lymph node metastasis (N1) and poor differentiation. Immunoexpression of p16 was strongly correlated with the presence of HPV. CONCLUSION: PTEN demonstrated a higher reactivity in advanced disease stages and p16 was strongly associated with HPV. Viral presence decreases tumor aggressiveness. Patients with advanced stage lesions demonstrated lower survival rate.


Assuntos
Carcinoma de Células Escamosas/genética , Inibidor p16 de Quinase Dependente de Ciclina/genética , Neoplasias Bucais/genética , PTEN Fosfo-Hidrolase/genética , Adulto , Biomarcadores Tumorais/genética , Carcinoma de Células Escamosas/patologia , Carcinoma de Células Escamosas/virologia , Feminino , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Hibridização in Situ Fluorescente , Perda de Heterozigosidade/genética , Metástase Linfática , Masculino , Pessoa de Meia-Idade , Neoplasias Bucais/patologia , Neoplasias Bucais/virologia , Papillomaviridae/patogenicidade , Infecções por Papillomavirus/genética , Infecções por Papillomavirus/patologia , Infecções por Papillomavirus/virologia
3.
Proc Natl Acad Sci U S A ; 117(40): 24947-24956, 2020 10 06.
Artigo em Inglês | MEDLINE | ID: mdl-32968016

RESUMO

The acquisition of mutations plays critical roles in adaptation, evolution, senescence, and tumorigenesis. Massive genome sequencing has allowed extraction of specific features of many mutational landscapes but it remains difficult to retrospectively determine the mechanistic origin(s), selective forces, and trajectories of transient or persistent mutations and genome rearrangements. Here, we conducted a prospective reciprocal approach to inactivate 13 single or multiple evolutionary conserved genes involved in distinct genome maintenance processes and characterize de novo mutations in 274 diploid Saccharomyces cerevisiae mutation accumulation lines. This approach revealed the diversity, complexity, and ultimate uniqueness of mutational landscapes, differently composed of base substitutions, small insertions/deletions (InDels), structural variants, and/or ploidy variations. Several landscapes parallel the repertoire of mutational signatures in human cancers while others are either novel or composites of subsignatures resulting from distinct DNA damage lesions. Notably, the increase of base substitutions in the homologous recombination-deficient Rad51 mutant, specifically dependent on the Polζ translesion polymerase, yields COSMIC signature 3 observed in BRCA1/BRCA2-mutant breast cancer tumors. Furthermore, "mutome" analyses in highly polymorphic diploids and single-cell bottleneck lineages revealed a diverse spectrum of loss-of-heterozygosity (LOH) signatures characterized by interstitial and terminal chromosomal events resulting from interhomolog mitotic cross-overs. Following the appearance of heterozygous mutations, the strong stimulation of LOHs in the rad27/FEN1 and tsa1/PRDX1 backgrounds leads to fixation of homozygous mutations or their loss along the lineage. Overall, these mutomes and their trajectories provide a mechanistic framework to understand the origin and dynamics of genome variations that accumulate during clonal evolution.


Assuntos
Neoplasias da Mama/genética , Carcinogênese/genética , Mutação/genética , Saccharomyces cerevisiae/genética , Acetiltransferases/genética , Proteína BRCA1/genética , Proteína BRCA2/genética , Neoplasias da Mama/patologia , Dano ao DNA/genética , DNA Polimerase Dirigida por DNA , Diploide , Feminino , Endonucleases Flap/genética , Genoma Fúngico/genética , Humanos , Perda de Heterozigosidade/genética , Proteínas de Membrana/genética , Peroxirredoxinas/genética , Rad51 Recombinase/genética , Proteínas de Saccharomyces cerevisiae/genética , Sequenciamento Completo do Genoma
4.
Am J Hum Genet ; 107(3): 514-526, 2020 09 03.
Artigo em Inglês | MEDLINE | ID: mdl-32791035

RESUMO

Multiple morphological abnormalities of the sperm flagella (MMAF) is a severe form of asthenoteratozoospermia. Although recent studies have revealed several MMAF-associated genes and demonstrated MMAF to be a genetically heterogeneous disease, at least one-third of the cases are still not well understood for their etiology. Here, we identified bi-allelic loss-of-function variants in CFAP58 by using whole-exome sequencing in five (5.6%) unrelated individuals from a cohort of 90 MMAF-affected Chinese men. Each of the men harboring bi-allelic CFAP58 variants presented typical MMAF phenotypes. Transmission electron microscopy demonstrated striking flagellar defects with axonemal and mitochondrial sheath malformations. CFAP58 is predominantly expressed in the testis and encodes a cilia- and flagella-associated protein. Immunofluorescence assays showed that CFAP58 localized at the entire flagella of control sperm and predominantly concentrated in the mid-piece. Immunoblotting and immunofluorescence assays showed that the abundances of axoneme ultrastructure markers SPAG6 and SPEF2 and a mitochondrial sheath protein, HSP60, were significantly reduced in the spermatozoa from men harboring bi-allelic CFAP58 variants. We generated Cfap58-knockout mice via CRISPR/Cas9 technology. The male mice were infertile and presented with severe flagellar defects, consistent with the sperm phenotypes in MMAF-affected men. Overall, our findings in humans and mice strongly suggest that CFAP58 plays a vital role in sperm flagellogenesis and demonstrate that bi-allelic loss-of-function variants in CFAP58 can cause axoneme and peri-axoneme malformations leading to male infertility. This study provides crucial insights for understanding and counseling of MMAF-associated asthenoteratozoospermia.


Assuntos
Anormalidades Múltiplas/genética , Astenozoospermia/genética , Axonema/genética , Infertilidade Masculina/genética , Peptídeos e Proteínas de Sinalização Intercelular/genética , Anormalidades Múltiplas/patologia , Alelos , Animais , Astenozoospermia/fisiopatologia , Axonema/patologia , Sistemas CRISPR-Cas/genética , Proteínas de Ciclo Celular/genética , Homozigoto , Humanos , Infertilidade Masculina/patologia , Mutação com Perda de Função/genética , Perda de Heterozigosidade/genética , Masculino , Camundongos , Camundongos Knockout , Proteínas dos Microtúbulos/genética , Mitocôndrias/genética , Cauda do Espermatozoide/metabolismo , Cauda do Espermatozoide/patologia , Testículo/metabolismo , Testículo/patologia , Sequenciamento Completo do Exoma
5.
Cytogenet Genome Res ; 160(6): 309-315, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32599602

RESUMO

Warburg micro syndrome (WARBM) is a rare autosomal recessive disorder characterized by microcephaly, cortical dysplasia, intellectual disability, ocular abnormalities, spastic diplegia, and microgenitalia. WARBM has 4 subtypes arising from pathogenic variants in 4 genes (RAB18, RAB3GAP1, RAB3GAP2, and TBC1D20). Here, we report on a patient with a homozygous pathogenic c.665delC (p.Pro222HisfsTer30) variant in the RAB3GAP1 gene identified by whole-exome sequencing (WES) analyses. Only his father was a heterozygous carrier, and homozygosity mapping analysis of the WES data revealed large loss-of-heterozygosity regions in both arms of chromosome 2, interpreted as uniparental isodisomy. This uniparental disomy pattern could be due to paternal meiosis I nondisjunction because of the preserved heterozygosity in the pericentromeric region. This report provides novel insights, including a rare form of UPD, usage of homozygosity mapping analysis for the evaluation of isodisomy, and the first reported case of WARBM1 as a result of uniparental isodisomy.


Assuntos
Anormalidades Múltiplas/genética , Catarata/congênito , Cromossomos Humanos Par 2/genética , Córnea/anormalidades , Homozigoto , Hipogonadismo/genética , Deficiência Intelectual/genética , Microcefalia/genética , Atrofia Óptica/genética , Dissomia Uniparental/genética , Sequenciamento Completo do Exoma , Adolescente , Adulto , Catarata/genética , Feminino , Humanos , Lactente , Perda de Heterozigosidade/genética , Masculino , Pais , Polimorfismo de Nucleotídeo Único/genética , Proteínas rab3 de Ligação ao GTP/genética
6.
Int J Hematol ; 112(3): 361-368, 2020 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-32535855

RESUMO

Genomic characterization of patients with myeloproliferative neoplasms (MPN) may lead to better diagnostic classification, prognostic assessment, and treatment decisions. These goals are particularly important in myelofibrosis (MF). We performed target Next Generation Sequencing for a panel of 255 genes and Chromosome Microarray Analysis (CMA) in 27 patients with MF. Patients were classified according to genomic findings and we compared the performance of a personalized prognostication system with IPSS, MIPSS70 and MIPSS70 + v2. Twenty-six patients presented mutations: 11.1% had single driver mutations in either JAK2, CALR or MPL; 85.2% had mutations in non-restricted genes (median: 2 per patient). CMA was abnormal in 91.7% of the 24 cases with available data. Copy-Number-Neutral Loss-of-Heterozygosity was the most common finding (66.7%). Del13q was the most frequent copy number variation, and we could define a 2.4 Mb minimally affected region encompassing RB1, SUCLA2 and CLLS2 loci. The largest genomic subgroup consisted of patients with mutations in genes involved with chromatin organization and splicing control (40.7%) and the personalized system showed better concordance and accuracy than the other prognostic systems. Comprehensive genomic characterization reveals the striking genetic complexity of MF and, when combined with clinical data, led, in our cohort, to better prognostication performance.


Assuntos
Variações do Número de Cópias de DNA , Genômica , Transtornos Mieloproliferativos/genética , Mielofibrose Primária/genética , Adulto , Idoso , Idoso de 80 Anos ou mais , Brasil , Proteínas de Ligação ao Cálcio/genética , Calreticulina/genética , Moléculas de Adesão Celular/genética , Estudos de Coortes , Feminino , Sequenciamento de Nucleotídeos em Larga Escala/métodos , Humanos , Janus Quinase 2/genética , Perda de Heterozigosidade/genética , Masculino , Análise em Microsséries/métodos , Pessoa de Meia-Idade , Mutação , Transtornos Mieloproliferativos/classificação , Mielofibrose Primária/classificação , Prognóstico
7.
Nature ; 584(7819): 136-141, 2020 08.
Artigo em Inglês | MEDLINE | ID: mdl-32581363

RESUMO

Clonally expanded blood cells that contain somatic mutations (clonal haematopoiesis) are commonly acquired with age and increase the risk of blood cancer1-9. The blood clones identified so far contain diverse large-scale mosaic chromosomal alterations (deletions, duplications and copy-neutral loss of heterozygosity (CN-LOH)) on all chromosomes1,2,5,6,9, but the sources of selective advantage that drive the expansion of most clones remain unknown. Here, to identify genes, mutations and biological processes that give selective advantage to mutant clones, we analysed genotyping data from the blood-derived DNA of 482,789 participants from the UK Biobank10. We identified 19,632 autosomal mosaic chromosomal alterations and analysed these for relationships to inherited genetic variation. We found 52 inherited, rare, large-effect coding or splice variants in 7 genes that were associated with greatly increased vulnerability to clonal haematopoiesis with specific acquired CN-LOH mutations. Acquired mutations systematically replaced the inherited risk alleles (at MPL) or duplicated them to the homologous chromosome (at FH, NBN, MRE11, ATM, SH2B3 and TM2D3). Three of the genes (MRE11, NBN and ATM) encode components of the MRN-ATM pathway, which limits cell division after DNA damage and telomere attrition11-13; another two (MPL and SH2B3) encode proteins that regulate the self-renewal of stem cells14-16. In addition, we found that CN-LOH mutations across the genome tended to cause chromosomal segments with alleles that promote the expansion of haematopoietic cells to replace their homologous (allelic) counterparts, increasing polygenic drive for blood-cell proliferation traits. Readily acquired mutations that replace chromosomal segments with their homologous counterparts seem to interact with pervasive inherited variation to create a challenge for lifelong cytopoiesis.


Assuntos
Evolução Clonal/genética , Células Clonais/metabolismo , Hematopoese/genética , Herança Multifatorial/genética , Adulto , Idoso , Alelos , Doenças Cardiovasculares/genética , Doenças Cardiovasculares/patologia , Divisão Celular/genética , Aberrações Cromossômicas , Células Clonais/citologia , Células Clonais/patologia , Feminino , Predisposição Genética para Doença , Neoplasias Hematológicas/genética , Neoplasias Hematológicas/patologia , Humanos , Perda de Heterozigosidade/genética , Masculino , Pessoa de Meia-Idade , Mosaicismo , Reino Unido
8.
Biochem Biophys Res Commun ; 526(4): 880-888, 2020 06 11.
Artigo em Inglês | MEDLINE | ID: mdl-32279996

RESUMO

Pancreatic cancer is associated with high mortality, and pancreatic ductal adenocarcinoma (PDAC) is its most common subtype. The rapid growth of PDAC is dependent on the non-canonical pathway of glutamine (Gln) utilization, and loss of heterozygosity for KrasG12D (KrasG12D-LOH) frequently observed in PDAC is associated with an aggressive and invasive phenotype. However, it remains unclear whether KrasG12D-LOH contributes to non-canonical Gln metabolism in PDAC. Here, we showed that KrasG12D-LOH leads to a substantial increase in non-canonical Gln metabolism in PDAC cells. Importantly, we observed elevated expression of regulated in DNA damage and development 1 (REDD1), which is activated in response to hypoxia and nutrient deprivation, in KrasG12D-LOH PDAC, and that REDD1 knockdown efficiently repressed KrasG12D-LOH-regulated Gln metabolism and suppressed proliferation, migration, and invasion of KrasG12D-LOH PDAC cells. These data provide evidence that REDD1 is a downstream target of KrasG12D-LOH and is involved in promoting non-canonical Gln metabolism in PDAC.


Assuntos
Adenocarcinoma/genética , Carcinoma Ductal Pancreático/genética , Glutamina/metabolismo , Perda de Heterozigosidade/genética , Mutação/genética , Neoplasias Pancreáticas/genética , Proteínas Proto-Oncogênicas p21(ras)/genética , Fatores de Transcrição/metabolismo , Adenocarcinoma/metabolismo , Apoptose/genética , Carcinoma Ductal Pancreático/metabolismo , Ciclo Celular/genética , Hipóxia Celular , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Progressão da Doença , Técnicas de Silenciamento de Genes , Humanos , Invasividade Neoplásica , Neoplasias Pancreáticas/metabolismo
9.
Br J Surg ; 107(1): 14-19, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31763684

RESUMO

A subset of patients with early gastric cancer demonstrate early recurrence and poor survival despite margin-negative resection. This study used an extremes-of-survivorship approach to identify an association between TP53 hotspot mutations co-occurring with loss of heterozygosity and unexpectedly poor survival in early gastric cancer. This distinct genomic profile may be a novel biomarker of poor survival in patients with completely resected early gastric cancer, and warrants large-scale validation. Promising, validation needed.


Assuntos
Mutação/genética , Neoplasias Gástricas/cirurgia , Proteína Supressora de Tumor p53/genética , Idoso , Biomarcadores Tumorais/genética , Feminino , Marcadores Genéticos/genética , Genômica , Humanos , Perda de Heterozigosidade/genética , Masculino , Pessoa de Meia-Idade , Recidiva Local de Neoplasia/genética , Recidiva Local de Neoplasia/mortalidade , Neoplasias Gástricas/genética , Neoplasias Gástricas/mortalidade , Sequenciamento Completo do Genoma
10.
Exp Mol Pathol ; 112: 104341, 2020 02.
Artigo em Inglês | MEDLINE | ID: mdl-31730755

RESUMO

INTRODUCTION: Oral epithelial dysplasia (OED) is a risk factor for developing subsequent oral squamous cell carcinoma (OSCC). Loss of heterozygosity (LOH) profiles have been validated as risk predictors of malignant transformation of OED. It is still unclear if Phosphatase and tensin homologue deleted on chromosome 10 (PTEN) allelic loss also occurs in initial stage malignant lesions and if the allelic loss is involved as one of the mechanisms of oral carcinogenesis. Thus, this study objective investigate LOH of PTEN gene and the immunohistochemical expression of the protein in OED and OSCC samples. MATERIAL AND METHODS: Formalin-fixed paraffin-embedded samples of 19 OEDs and 16 OSCCs were included to immunohistochemistry and LOH analysis. Two polymorphic microsatellite markers (AFMA086WG9 and D10S1765) located in chromosome 10 were used in this study for LOH analysis. For immunohistochemical analysis, 5 random fields with 400× magnification were evaluated quantitatively and qualitatively in epithelial and neoplastic cells. RESULTS: AFMA086WG9 marker only demonstrated LOH in OEDs cases (10.5%). D10S1765 marker demonstrated LOH in 57.2% of OEDs and 50% of OSCCs. Higher nuclear immunostaining was detected in cases of OSCCs when compared to OEDs (p < .001) and there was strong cytoplasmic immunoexpression in OSCCs (p < .045). CONCLUSIONS: We provide evidence that the allelic loss of PTEN is present in premalignant oral lesions and OSCCs, however the LOH of PTEN does not seems to influence its protein expression.


Assuntos
Carcinoma de Células Escamosas/genética , Perda de Heterozigosidade/genética , Neoplasias Bucais/genética , PTEN Fosfo-Hidrolase/genética , Carcinoma in Situ/genética , Carcinoma in Situ/patologia , Carcinoma de Células Escamosas/patologia , Transformação Celular Neoplásica/genética , Feminino , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Imuno-Histoquímica/métodos , Masculino , Repetições de Microssatélites/genética , Mucosa Bucal/patologia , Neoplasias Bucais/patologia , Lesões Pré-Cancerosas/genética , Lesões Pré-Cancerosas/patologia , Fatores de Risco
11.
Nucleic Acids Res ; 48(3): 1271-1284, 2020 02 20.
Artigo em Inglês | MEDLINE | ID: mdl-31828313

RESUMO

The healing of broken chromosomes by de novo telomere addition, while a normal developmental process in some organisms, has the potential to cause extensive loss of heterozygosity, genetic disease, or cell death. However, it is unclear how de novo telomere addition (dnTA) is regulated at DNA double-strand breaks (DSBs). Here, using a non-essential minichromosome in fission yeast, we identify roles for the HR factors Rqh1 helicase, in concert with Rad55, in suppressing dnTA at or near a DSB. We find the frequency of dnTA in rqh1Δ rad55Δ cells is reduced following loss of Exo1, Swi5 or Rad51. Strikingly, in the absence of the distal homologous chromosome arm dnTA is further increased, with nearly half of the breaks being healed in rqh1Δ rad55Δ or rqh1Δ exo1Δ cells. These findings provide new insights into the genetic context of highly efficient dnTA within HR intermediates, and how such events are normally suppressed to maintain genome stability.


Assuntos
DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Reparo de DNA por Recombinação/genética , Proteínas de Schizosaccharomyces pombe/genética , Telômero/genética , Cromossomos Fúngicos/genética , Quebras de DNA de Cadeia Dupla , Exodesoxirribonucleases/genética , Regulação Fúngica da Expressão Gênica/genética , Genoma Fúngico/genética , Instabilidade Genômica/genética , Perda de Heterozigosidade/genética , Rad51 Recombinase/genética , Schizosaccharomyces/genética
12.
J Assist Reprod Genet ; 36(12): 2515-2523, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31758512

RESUMO

PURPOSE: To investigate the validity, accuracy, and clinical outcomes of Karyomapping in preimplantation genetic testing (PGT) for ß-thalassemia combined with human leukocyte antigen (HLA) matching. METHODS: A total of 128 cycles from January 2014 to December 2017 were identified, and 1205 embryos were biopsied. The case group included 88 cycles using Karyomapping for PGT-HLA, compared with 40 cycles using polymerase chain reaction-short tandem repeat (PCR-STR) as the control group. RESULTS: There were significant differences in the HLA matching rate (21.34 vs. 14.37%), the matched transferable embryo rate (9.79 vs. 14.07%), the clinical pregnancy rate (65.08 vs. 41.86%), and the spontaneous miscarriage rate (2.44 vs. 22.22%) between the case and control groups. In the case group, nearly 1/3 (33.37%) of the embryos showed aneuploidy. According to the results of single nucleotide polymorphism (SNP) haplotype analysis, the recombination rates of HBB (hemoglobin subunit beta) and HLA were 11.46% and 5.61% respectively. HLA gene recombination was mostly distributed between HLA-A and HLA-B and the downstream region of HLA-DQB1. In addition, STR analysis could be considered in the case of copy-neutral loss of heterozygosity (LOH) in the region where the HLA gene is located. CONCLUSION: Karyomapping contributes to accurate selection of matched embryos, along with aneuploidy screening. However, STRs assist identification in cases of LOH in the target region.


Assuntos
Antígenos HLA-A/genética , Antígenos HLA-B/genética , Cariotipagem/métodos , Diagnóstico Pré-Implantação , Talassemia beta/diagnóstico , Adulto , Biópsia , Transferência Embrionária , Feminino , Cadeias beta de HLA-DQ/genética , Subunidades de Hemoglobina/genética , Humanos , Perda de Heterozigosidade/genética , Gravidez , Taxa de Gravidez , Talassemia beta/genética , Talassemia beta/patologia
13.
Am J Hum Genet ; 105(5): 894-906, 2019 11 07.
Artigo em Inglês | MEDLINE | ID: mdl-31630786

RESUMO

Hereditary hemorrhagic telangiectasia (HHT) is a Mendelian disease characterized by vascular malformations (VMs) including visceral arteriovenous malformations and mucosal telangiectasia. HHT is caused by loss-of-function (LoF) mutations in one of three genes, ENG, ACVRL1, or SMAD4, and is inherited as an autosomal-dominant condition. Intriguingly, the constitutional mutation causing HHT is present throughout the body, yet the multiple VMs in individuals with HHT occur focally, rather than manifesting as a systemic vascular defect. This disconnect between genotype and phenotype suggests that a local event is necessary for the development of VMs. We investigated the hypothesis that local somatic mutations seed the formation HHT-related telangiectasia in a genetic two-hit mechanism. We identified low-frequency somatic mutations in 9/19 telangiectasia through the use of next-generation sequencing. We established phase for seven of nine samples, which confirms that the germline and somatic mutations in all seven samples exist in trans configuration; this is consistent with a genetic two-hit mechanism. These combined data suggest that bi-allelic loss of ENG or ACVRL1 may be a required event in the development of telangiectasia, and that rather than haploinsufficiency, VMs in HHT are caused by a Knudsonian two-hit mechanism.


Assuntos
Receptores de Activinas Tipo II/genética , Endoglina/genética , Mutação/genética , Proteína Smad4/genética , Telangiectasia Hemorrágica Hereditária/genética , Malformações Vasculares/genética , Idoso , Alelos , Malformações Arteriovenosas/genética , Feminino , Genótipo , Humanos , Perda de Heterozigosidade/genética , Masculino , Fenótipo
14.
Int J Colorectal Dis ; 34(11): 1999-2002, 2019 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-31655866

RESUMO

BACKGROUND: Lynch syndrome (LS) is associated with germline mutations in one of the mismatch repair genes or EPCAM. The majority of the causative alterations are point mutations. Large genomic rearrangements represent only 5-20%. Hypothetically, the allelic imbalance, like the loss of heterozygosity, may be another high penetrance risk factor. CASE PRESENTATION: We describe the case of a patient who developed 5 tumors during her lifetime and with a family history characterized by a high frequency of tumors associated with LS. The proband was tested for mutations and copy number alterations with a panel of hereditary cancer genes and by SNP array. She showed a 187 Kb duplication including EPCAM and the first 7 exons of MSH2, plus two loss of heterozygosity (LOHs) in chromosome 20 and one in chromosome X which include many tumor suppressor genes. CONCLUSION: We found a novel large EPCAM-MSH2 duplication associated with LS and the presence of LOHs in regions containing numerous tumor suppressors, raising the hypothesis that these alterations could contribute to cancer susceptibility. Our results underline the importance to deepen the knowledge of molecular mechanisms in order to determine the role in cancer predisposition of novel genetic alterations.


Assuntos
Cromossomos Humanos Par 20/genética , Cromossomos Humanos X/genética , Neoplasias Colorretais Hereditárias sem Polipose/genética , Molécula de Adesão da Célula Epitelial/genética , Duplicação Gênica , Perda de Heterozigosidade/genética , Proteína 2 Homóloga a MutS/genética , Adulto , Idoso , Feminino , Humanos , Masculino , Pessoa de Meia-Idade , Linhagem
15.
G3 (Bethesda) ; 9(12): 4019-4027, 2019 12 03.
Artigo em Inglês | MEDLINE | ID: mdl-31585926

RESUMO

Organismal ploidy and environmental stress impact the rates and types of mutational events. The opportunistic fungal pathogen Candida albicans, serves as a clinically relevant model for studying the interaction between eukaryotic ploidy and drug-induced mutagenesis. In this study, we compared the rates and types of genome perturbations in diploid and tetraploid C. albicans following exposure to two different classes of antifungal drugs; azoles and echinocandins. We measured mutations at three different scales: point mutation, loss-of-heterozygosity (LOH), and total DNA content for cells exposed to fluconazole and caspofungin. We found that caspofungin induced higher mutation rates than fluconazole, although this is likely an indirect consequence of stress-associated cell wall perturbations, rather than an inherent genotoxicity. Surprisingly, we found that antifungal drugs disproportionately elevated genome and ploidy instability in tetraploid C. albicans compared to diploids. Taken together, our results suggest that the magnitude of stress-induced mutagenesis results from an interaction between ploidy and antifungal drugs. These findings have both clinical and evolutionary implications for how fungal pathogens generate mutations in response to antifungal drug stress and how these mutations may facilitate the emergence of drug resistance.


Assuntos
Antifúngicos/farmacologia , Candida albicans/genética , Candida albicans/fisiologia , Genoma Fúngico , Instabilidade Genômica , Ploidias , Estresse Fisiológico/genética , Candida albicans/efeitos dos fármacos , DNA Fúngico/genética , Tamanho do Genoma , Instabilidade Genômica/efeitos dos fármacos , Perda de Heterozigosidade/genética , Testes de Sensibilidade Microbiana , Viabilidade Microbiana/efeitos dos fármacos , Viabilidade Microbiana/genética , Estresse Fisiológico/efeitos dos fármacos
16.
Artigo em Inglês | MEDLINE | ID: mdl-31604778

RESUMO

Patients harboring germline pathogenic biallelic variants in genes involved in the recognition and repair of DNA damage are known to have a substantially increased cancer risk. Emerging evidence suggests that individuals harboring heterozygous variants in these same genes may also be at heightened, albeit lesser, risk for cancer. Herein, we sought to determine whether heterozygous variants in RECQL4, the gene encoding an essential DNA helicase that is defective in children with the autosomal recessive cancer-predisposing condition Rothmund-Thomson syndrome (RTS), are associated with increased risk for childhood cancer. To address this question, we interrogated germline sequence data from 4435 pediatric cancer patients at St. Jude Children's Research Hospital and 1127 from the National Cancer Institute Therapeutically Applicable Research to Generate Effective Treatment (TARGET) database and identified 24 (0.43%) who harbored loss-of-function (LOF) RECQL4 variants, including five of 249 (2.0%) with osteosarcoma (OS). These RECQL4 variants were significantly overrepresented in children with OS, the cancer most frequently observed in patients with RTS, as compared to 134,187 noncancer controls in the Genome Aggregation Database (gnomAD v2.1; P = 0.00087, odds ratio [OR] = 7.1, 95% CI, 2.9-17). Nine of the 24 (38%) individuals possessed the same c.1573delT (p.Cys525Alafs) variant located in the highly conserved DNA helicase domain, suggesting that disruption of this domain is central to oncogenesis. Altogether these data expand our understanding of the genetic factors predisposing to childhood cancer and reveal a novel association between heterozygous RECQL4 LOF variants and development of pediatric OS.


Assuntos
Osteossarcoma/genética , RecQ Helicases/genética , Adolescente , Criança , Feminino , Células Germinativas , Humanos , Mutação com Perda de Função/genética , Perda de Heterozigosidade/genética , Masculino , Mutação , Osteossarcoma/metabolismo , Linhagem , RecQ Helicases/metabolismo
17.
Genome Res ; 29(10): 1685-1692, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31548357

RESUMO

With two genomes in the same organism, interspecific hybrids have unique fitness opportunities and costs. In both plants and yeasts, wild, pathogenic, and domesticated hybrids may eliminate portions of one parental genome, a phenomenon known as loss of heterozygosity (LOH). Laboratory evolution of hybrid yeast recapitulates these results, with LOH occurring in just a few hundred generations of propagation. In this study, we systematically looked for alleles that are beneficial when lost in order to determine how prevalent this mode of adaptation may be and to determine candidate loci that might underlie the benefits of larger-scale chromosome rearrangements. These aims were accomplished by mating Saccharomyces uvarum with the S. cerevisiae deletion collection to create hybrids such that each nonessential S. cerevisiae allele is deleted. Competitive fitness assays of these pooled, barcoded, hemizygous strains, and accompanying controls, revealed a large number of loci for which LOH is beneficial. We found that the fitness effects of hemizygosity are dependent on the species context, the selective environment, and the species origin of the deleted allele. Further, we found that hybrids have a wider distribution of fitness consequences versus matched S. cerevisiae hemizygous diploids. Our results suggest that LOH can be a successful strategy for adaptation of hybrids to new environments, and we identify candidate loci that drive the chromosomal rearrangements observed in evolution of yeast hybrids.


Assuntos
Aptidão Genética/genética , Genoma Fúngico/genética , Hibridização Genética/fisiologia , Perda de Heterozigosidade/genética , Aptidão Genética/fisiologia , Saccharomyces/genética , Saccharomyces/fisiologia , Saccharomyces cerevisiae/genética
18.
Genetics ; 213(2): 665-683, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31371407

RESUMO

Loss of heterozygosity (LOH) is observed during vegetative growth and reproduction of diploid genotypes through mitotic crossovers, aneuploidy caused by nondisjunction, and gene conversion. We aimed to test the role that LOH plays during adaptation of two highly heterozygous Saccharomyces cerevisiae genotypes to multiple environments over a short time span in the laboratory. We hypothesized that adaptation would be observed through parallel LOH events across replicate populations. Using genome resequencing of 70 clones, we found that LOH was widespread with 5.2 LOH events per clone after ∼500 generations. The most common mode of LOH was gene conversion (51%) followed by crossing over consistent with either break-induced replication or double Holliday junction resolution. There was no evidence that LOH involved nondisjunction of whole chromosomes. We observed parallel LOH in both an environment-specific and environment-independent manner. LOH largely involved recombining existing variation between the parental genotypes, but also was observed after de novo, presumably beneficial, mutations occurred in the presence of canavanine, a toxic analog of arginine. One highly parallel LOH event involved the ENA salt efflux pump locus on chromosome IV, which showed repeated LOH to the allele from the European parent, an allele originally derived by introgression from S. paradoxus Using CRISPR-engineered LOH we showed that the fitness advantage provided by this single LOH event was 27%. Overall, we found extensive evidence that LOH could be adaptive and is likely to be a greater source of initial variation than de novo mutation for rapid evolution of diploid genotypes.


Assuntos
Cromossomos Fúngicos/genética , Evolução Clonal/genética , Perda de Heterozigosidade/genética , Saccharomyces cerevisiae/genética , Adaptação Fisiológica/genética , Alelos , Aneuploidia , Reparo do DNA/genética , Diploide , Conversão Gênica/genética , Heterozigoto , Recombinação Genética
19.
Clin Cancer Res ; 25(21): 6524-6531, 2019 11 01.
Artigo em Inglês | MEDLINE | ID: mdl-31375516

RESUMO

PURPOSE: Uniparental disomy (UPD) is a way cancer cells duplicate a mutated gene, causing loss of heterozygosity (LOH). Patients with cytogenetically normal acute myeloid leukemia (CN-AML) do not have microscopically detectable chromosome abnormalities, but can harbor UPDs. We examined the prognostic significance of UPDs and frequency of LOH in patients with CN-AML.Experimental Design: We examined the frequency and prognostic significance of UPDs in a set of 425 adult patients with de novo CN-AML who were previously sequenced for 81 genes typically mutated in cancer. Associations of UPDs with outcome were analyzed in the 315 patients with CN-AML younger than 60 years. RESULTS: We detected 127 UPDs in 109 patients. Most UPDs were large and typically encompassed all or most of the affected chromosome arm. The most common UPDs occurred on chromosome arms 13q (7.5% of patients), 6p (2.8%), and 11p (2.8%). Many UPDs significantly cooccurred with mutations in genes they encompassed, including 13q UPD with FLT3-internal tandem duplication (FLT3-ITD; P < 0.001), and 11p UPD with WT1 mutations (P = 0.02). Among patients younger than 60 years, UPD of 11p was associated with longer overall survival (OS) and 13q UPD with shorter disease-free survival (DFS) and OS. In multivariable models that accounted for known prognostic markers, including FLT3-ITD and WT1 mutations, UPD of 13q maintained association with shorter DFS, and UPD of 11p maintained association with longer OS. CONCLUSIONS: LOH mediated by UPD is a recurrent feature of CN-AML. Detection of UPDs of 13q and 11p might be useful for genetic risk stratification of patients with CN-AML.


Assuntos
Leucemia Mieloide Aguda/genética , Perda de Heterozigosidade/genética , Prognóstico , Dissomia Uniparental/genética , Adolescente , Adulto , Idoso , Citogenética/métodos , Intervalo Livre de Doença , Feminino , Humanos , Leucemia Mieloide Aguda/epidemiologia , Leucemia Mieloide Aguda/patologia , Masculino , Pessoa de Meia-Idade , Mutação , Proteínas Nucleares/genética , Dissomia Uniparental/patologia , Adulto Jovem
20.
Hum Genomics ; 13(1): 38, 2019 08 23.
Artigo em Inglês | MEDLINE | ID: mdl-31443742

RESUMO

BACKGROUND: Ataxia-telangiectasia (AT) is a rare autosomal recessive disorder that causes deficiency or dysfunction of the ataxia-telangiectasia mutated (ATM) protein. Not only AT patients, but also certain ATM heterozygous mutation carriers show a significantly reduced life expectancy due to cancer and ischemic heart disease; in particular, female carriers having particular alleles have an increased risk of breast cancer. The frequency of such risk heterozygotes at a population level remains to be fully determined, and evidence-based preventive medical guidelines have not yet been established. METHODS: Using the 3.5KJPNv2 allele frequency panel of Japanese Multi Omics Reference Panel v201902, which shows single-nucleotide variant (SNV) and insertion/deletion (INDEL) allele frequencies from 3552 Japanese healthy individuals, we investigated the diversity of ATM gene variants. RESULTS: We detected 2845 (2370 SNV and 475 INDEL) variants in the ATM gene, including 1338 (1160 SNV and 178 INDEL) novel variants. Also, we found a stop-gained SNV (NC_000008.11:g.108115650G > A (p.Trp266*)) and a disruptive-inframe-deletion (NC_000008.11:g. 108181014AAGAAAAGTATGGATGATCAAG/A (p.Ala1945_Phe1952delinsVal) and two frameshift INDELs (NC_000008.11:g.108119714CAA/C (p.Glu376fs) and NC_000008.11:g.108203577CTTATA/C (p.Ile2629fs)), which would be novel variants predicted to lead to loss of ATM functionality. CONCLUSION: The combination of population-based biobanking and human genomics provided a novel insight of diversity of ATM gene variants at a population level. For the advancement of precision medicine, such approach will be useful to predict novel pathogenic/likely pathogenic variants in the ATM gene and to establish preventive medical guidelines for certain ATM heterozygotes pertaining to their risk of particular diseases.


Assuntos
Proteínas Mutadas de Ataxia Telangiectasia/genética , Predisposição Genética para Doença , Variação Genética/genética , Genoma Humano/genética , Análise de Dados , Feminino , Frequência do Gene , Genética Populacional , Heterozigoto , Humanos , Perda de Heterozigosidade/genética , Pessoa de Meia-Idade , Polimorfismo de Nucleotídeo Único/genética , Medicina de Precisão
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA