Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 615
Filtrar
1.
Am J Orthod Dentofacial Orthop ; 158(6): e151-e160, 2020 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-33139146

RESUMO

INTRODUCTION: The Wnt signaling pathway acts as a key regulator of skeletal development and its homeostasis. However, the potential role of Wnt1 in the mechanotransduction machinery of orthodontic tooth movement-initiated bone remodeling is still unclear. Hence, this study focused on the regulatory dynamics of the Wnt1 expression in both the periodontal ligament (PDL) and osteocytes in vivo and in vitro. METHODS: The Wnt1 expression in the orthodontically moved maxillary first molar in mice was assessed at 0, 1, and 5 days, on both the compression and tension sides. Primary isolated human PDL (hPDL) fibroblasts, as well as murine long-bone osteocyte-Y4 (MLO-Y4) cells, were exposed to continuous compressive force and static tensile force. RESULTS: The relative quantification of immunodetection showed that orthodontic tooth movement significantly stimulated the Wnt1 expression in both the PDL and alveolar osteocytes on the tension side on day 5, whereas the expression on the compression side did not change. This increase in the Wnt1 expression, shown in vivo, was also noted after the application of 12% static tensile force in isolated hPDL fibroblasts and 20% in MLO-Y4 cells. In contrast, a compressive force led to the attenuation of the Wnt1 gene expression in both hPDL fibroblasts and MLO-Y4 cells in a force-dependent manner. In the osteocyte-PDL coculture system, recombinant sclerostin attenuated Wnt1 in PDL, whereas the antisclerostin antibody upregulated its gene expression, indicating that mechanically-driven Wnt1 signaling in PDL might be regulated by osteocytic sclerostin. CONCLUSIONS: Our findings provide that Wnt1 signaling plays a vital role in tooth movement-initiated bone remodeling via innovative mechanotransduction approaches.


Assuntos
Mecanotransdução Celular , Técnicas de Movimentação Dentária , Animais , Remodelação Óssea , Humanos , Camundongos , Osteócitos , Ligamento Periodontal , Estresse Mecânico , Proteína Wnt1/genética
2.
Mol Carcinog ; 59(10): 1159-1173, 2020 10.
Artigo em Inglês | MEDLINE | ID: mdl-32794610

RESUMO

Sex-determining region Y box (SOXs) are expressed in various cells and control cell fate and differentiation in a multitude of physiologic processes. SOX6, a main representative of SOXs, is involved in the regulation of carcinogenesis in various human malignancies. However, the role of SOX6 in clear cell renal cell carcinoma (ccRCC) remains unclear. In this study, SOX6 expression in ccRCC and its clinical significance were investigated. In vitro and in vivo assays were used to explore the tumor-related function and the underlying molecular mechanism of SOX6 in ccRCC. We confirmed that SOX6 was frequently downregulated in ccRCC tissues and cell lines. Besides, downregulation of SOX6 was significantly associated with larger tumor sizes, advanced tumor stage, higher Fuhrman grades, and its expression could act as an independent prognostic factor for ccRCC (hazards ratio = 0.590, P = .026). Gain/loss-of-function experiments demonstrated that SOX6 could remarkably inhibit tumor cell growth and foci formation in vitro and xenograft tumorigenesis in vivo, respectively. Mechanistically, SOX6 could influence cell cycle by regulating the G1/the S phase transition and had an inhibitory effect on Wnt/ß-catenin signaling as well as its target genes, c-Myc and cyclin D1. Interesting, the tumor-suppressive function of SOX6 was proved to be dependent on its specific high-mobility-group (HMG) domain. In general, our findings indicated that SOX6 was a novel tumor suppressor and prognostic biomarker in ccRCC. SOX6 could inhibit tumor growth by negatively regulating the Wnt/ß-catenin signaling pathway in an HMG domain-dependent manner in ccRCC, which might provide a novel therapeutic approach for ccRCC.


Assuntos
Biomarcadores Tumorais/metabolismo , Carcinoma de Células Renais/patologia , Domínios HMG-Box , Neoplasias Renais/patologia , Fatores de Transcrição SOXD/metabolismo , Proteína Wnt1/metabolismo , beta Catenina/metabolismo , Animais , Apoptose , Biomarcadores Tumorais/genética , Carcinoma de Células Renais/genética , Carcinoma de Células Renais/metabolismo , Proliferação de Células , Transformação Celular Neoplásica , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Renais/genética , Neoplasias Renais/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos BALB C , Camundongos Nus , Pessoa de Meia-Idade , Prognóstico , Fatores de Transcrição SOXD/genética , Taxa de Sobrevida , Células Tumorais Cultivadas , Proteína Wnt1/genética , Ensaios Antitumorais Modelo de Xenoenxerto , beta Catenina/genética
3.
Mol Carcinog ; 59(9): 1041-1051, 2020 09.
Artigo em Inglês | MEDLINE | ID: mdl-32537818

RESUMO

Triple-negative breast cancer (TNBC) is a very aggressive subtype with high recurrence rate and no molecular targets for therapies. This subtype is characterized by high expression/secretion of the proinvasive/metastatic interleukin-6 (IL-6) cytokine. In the present study, we have shown that tocilizumab inhibits the IL-6/STAT3 signaling and suppresses the cancer/inflammatory epigenetic IL-6/STAT3/NF-κB positive feedback loop. Furthermore, tocilizumab inhibited the proliferative and the migratory/invasiveness capacities as well as the epithelial-to-mesenchymal transition (EMT) process in TNBC cells. Importantly, tocilizumab suppressed the stemness-related characteristics of TNBC cells, through the inhibition of the Wnt/ß-catenin breast cancer stem cell-related pathway. Additionally, we have shown that tocilizumab suppresses the paracrine activation of normal breast stromal fibroblasts to myofibroblats. Moreover, tocilizumab sensitized TNBC cells to the cytotoxic effect of cisplatin in vitro. Furthermore, pharmacological inhibition of IL-6 by tocilizumab had great inhibitory effect on tumor growth and the EMT process in humanized orthotopic breast tumors in mice. In addition, tocilizumab potentiated the proapoptotic effect of cisplatin in humanized breast tumors. Together, these findings indicate that tocilizumab can suppress the prometastatic capacity of TNBC cells and enhances the cytotoxic effect of cisplatin against these cells. Therefore, tocilizumab could be of great therapeutic value for these hard-to-treat TNBC patients.


Assuntos
Anticorpos Monoclonais Humanizados/farmacologia , Antineoplásicos/farmacologia , Cisplatino/farmacologia , Sinergismo Farmacológico , Transição Epitelial-Mesenquimal , Regulação Neoplásica da Expressão Gênica/efeitos dos fármacos , Neoplasias de Mama Triplo Negativas/tratamento farmacológico , Animais , Apoptose , Biomarcadores Tumorais/genética , Biomarcadores Tumorais/metabolismo , Movimento Celular , Proliferação de Células , Feminino , Humanos , Interleucina-6/genética , Interleucina-6/metabolismo , Camundongos , Camundongos Endogâmicos NOD , Camundongos SCID , NF-kappa B/genética , NF-kappa B/metabolismo , Invasividade Neoplásica , Células-Tronco Neoplásicas/efeitos dos fármacos , Células-Tronco Neoplásicas/metabolismo , Células-Tronco Neoplásicas/patologia , Fator de Transcrição STAT3/genética , Fator de Transcrição STAT3/metabolismo , Neoplasias de Mama Triplo Negativas/metabolismo , Neoplasias de Mama Triplo Negativas/patologia , Células Tumorais Cultivadas , Proteína Wnt1/genética , Proteína Wnt1/metabolismo , Ensaios Antitumorais Modelo de Xenoenxerto , beta Catenina/genética , beta Catenina/metabolismo
4.
Breast Cancer Res ; 22(1): 59, 2020 06 03.
Artigo em Inglês | MEDLINE | ID: mdl-32493400

RESUMO

BACKGROUND: Breast cancer is a heterogeneous disease. Hence, stratification of patients based on the subtype of breast cancer is key to its successful treatment. Among all the breast cancer subtypes, basal-like breast cancer is the most aggressive subtype with limited treatment options. Interestingly, we found focal adhesion kinase (FAK), a cytoplasmic tyrosine kinase, is highly overexpressed and activated in basal-like breast cancer. METHODS: To understand the role of FAK in this subtype, we generated mice with conditional deletion of FAK and a knock-in mutation in its kinase domain in MMTV-Wnt1-driven basal-like mammary tumors. Tumor initiation, growth, and metastasis were characterized for these mice cohorts. Immunohistochemical and transcriptomic analysis of Wnt1-driven tumors were also performed to elucidate the mechanisms underlying FAK-dependent phenotypes. Pharmacological inhibition of FAK and mTOR in human basal-like breast cancer cell lines was also tested. RESULTS: We found that in the absence of FAK or its kinase function, growth and metastasis of the tumors were significantly suppressed. Furthermore, immunohistochemical analyses of cleaved caspase 3 revealed that loss of FAK results in increased tumor cell apoptosis. To further investigate the mechanism by which FAK regulates survival of the Wnt1-driven tumor cells, we prepared an isogenic pair of mammary tumor cells with and without FAK and found that FAK ablation increased their sensitivity to ER stress-induced cell death, as well as reduced tumor cell migration and tumor sphere formation. Comparative transcriptomic profiling of the pair of tumor cells and gene set enrichment analysis suggested mTOR pathway to be downregulated upon loss of FAK. Immunoblot analyses further confirmed that absence of FAK results in reduction of AKT and downstream mTOR pathways. We also found that inhibition of FAK and mTOR pathways both induces apoptosis, indicating the importance of these pathways in regulating cell survival. CONCLUSIONS: In summary, our studies show that in a basal-like tumor model, FAK is required for survival of the tumor cells and can serve as a potential therapeutic target.


Assuntos
Carcinoma Basocelular/metabolismo , Proteína-Tirosina Quinases de Adesão Focal/metabolismo , Neoplasias Mamárias Experimentais/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Serina-Treonina Quinases TOR/metabolismo , Proteína Wnt1/metabolismo , Animais , Neoplasias da Mama/genética , Neoplasias da Mama/metabolismo , Neoplasias da Mama/patologia , Carcinoma Basocelular/genética , Carcinoma Basocelular/patologia , Movimento Celular/fisiologia , Proliferação de Células/fisiologia , Transformação Celular Neoplásica , Modelos Animais de Doenças , Progressão da Doença , Feminino , Proteína-Tirosina Quinases de Adesão Focal/antagonistas & inibidores , Proteína-Tirosina Quinases de Adesão Focal/genética , Humanos , Neoplasias Mamárias Experimentais/genética , Neoplasias Mamárias Experimentais/patologia , Vírus do Tumor Mamário do Camundongo/genética , Camundongos Transgênicos , Proteínas Proto-Oncogênicas c-akt/genética , Transdução de Sinais , Serina-Treonina Quinases TOR/genética , Células Tumorais Cultivadas , Proteína Wnt1/genética
5.
Gene ; 744: 144564, 2020 Jun 20.
Artigo em Inglês | MEDLINE | ID: mdl-32165291

RESUMO

OBJECTIVES: The molocular mechanism underlying human bone marrow mesenchymal stem cells (hBMSCs) differentiation remains to be further elucidated. DLX2 has been confirmed to accelerate osteogenic differentiation which is one member of Distal-less family genes. However, how DLX2 regulates in osteogenic differentiation is still unclear. METHODS: The hBMSCs were isolated and identified by the antigen CD29, CD4, CD90 through flow cytometry. DLX2 expression level, molecules related signaling pathways and transcriptional markers in osteogenesis were examined by western blot and real time-PCR. Osteogenic state was weighed by the ALP Detection Kit and Alizarin red S staining. The combination between DLX2 and WNT1 was detected by Chromatin immunoprecipitation (CHIP) assay. RESULTS: The results showed that in the process of osteoblast differentiation, DLX2 was up-regulated accompanied with osteogenic transcriptional factor. DLX2 elevated cellular alkaline phosphatase activity, accelerated BMSC mineralization along with up-regulation of osteogenic-related gene expression. Besides, DLX2 is a transcription factor of WNT1, which activated the Wnt/ß-Catenin signaling pathway resulting in osteogenic differentiation. Whereas, the inhibitor of ß-Catenin FH535 restrained enhanced osteogenic capability induced by DLX2. CONCLUSIONS: Taken together, these results suggest that by up-regulation of Wnt/ß-Catenin signaling, DLX2 accelerated human osteogenic differentiation.


Assuntos
Proteínas de Homeodomínio/metabolismo , Células-Tronco Mesenquimais/metabolismo , Osteogênese , Fatores de Transcrição/metabolismo , Ativação Transcricional , Via de Sinalização Wnt , Proteína Wnt1/metabolismo , Células Cultivadas , Proteínas de Homeodomínio/genética , Humanos , Células-Tronco Mesenquimais/citologia , Osteogênese/genética , Fatores de Transcrição/genética , Proteína Wnt1/biossíntese , Proteína Wnt1/genética
6.
Ann Clin Lab Sci ; 50(1): 13-23, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-32161008

RESUMO

FZD8, a G protein-coupled receptor protein belonging to the Frizzled family, is considered to play an important role in cancer invasion and metastasis. However, the function of FZD8 in the invasion and metastasis of gastric cancer (GC) has not been elucidated. In this study, we first confirm that FZD8 protein expression was significantly upregulated in gastric cancer tissue and has a potential to be an independent predictor of poor prognosis for patients with GC. In vivo and in vitro evidences were provided that support the idea of FZD8 being able to suppress GC cell invasion and metastasis. Further studies show that FZD8 promotes the markers expression related to invasion and metastasis. FZD8 exerts biological function through the ß-catenin pathway which plays an important role in invasion and metastasis of gastric cancer cells. Finally, FZD8 could activate the ß-catenin pathway and its target gene's expression. In conclusion, our findings show that FZD8 promotes GC invasion and metastasis via the ß-catenin pathway.


Assuntos
Adenocarcinoma/secundário , Biomarcadores Tumorais/metabolismo , Regulação Neoplásica da Expressão Gênica , Receptores de Superfície Celular/metabolismo , Neoplasias Gástricas/patologia , Proteína Wnt1/metabolismo , beta Catenina/metabolismo , Adenocarcinoma/genética , Adenocarcinoma/metabolismo , Biomarcadores Tumorais/genética , Feminino , Seguimentos , Humanos , Metástase Linfática , Masculino , Pessoa de Meia-Idade , Invasividade Neoplásica , Prognóstico , Receptores de Superfície Celular/genética , Neoplasias Gástricas/genética , Neoplasias Gástricas/metabolismo , Taxa de Sobrevida , Células Tumorais Cultivadas , Via de Sinalização Wnt , Proteína Wnt1/genética , beta Catenina/genética
7.
Development ; 147(5)2020 03 11.
Artigo em Inglês | MEDLINE | ID: mdl-32161062

RESUMO

The modulation of mechanical tension is important for sculpturing tissues during animal development, yet how mechanical tension is controlled remains poorly understood. In Drosophila wing discs, the local reduction of mechanical tension at basal cell edges results in basal relaxation and the formation of an epithelial fold. Here, we show that Wingless, which is expressed next to this fold, promotes basal cell edge tension to suppress the formation of this fold. Ectopic expression of Wingless blocks fold formation, whereas the depletion of Wingless increases fold depth. Moreover, local depletion of Wingless in a region where Wingless signal transduction is normally high results in ectopic fold formation. The depletion of Wingless also results in decreased basal cell edge tension and basal cell area relaxation. Conversely, the activation of Wingless signal transduction leads to increased basal cell edge tension and basal cell area constriction. Our results identify the Wingless signal transduction pathway as a crucial modulator of mechanical tension that is important for proper wing disc morphogenesis.


Assuntos
Padronização Corporal/genética , Proteínas de Drosophila/genética , Drosophila melanogaster/embriologia , Morfogênese/genética , Asas de Animais/embriologia , Proteína Wnt1/genética , Animais , Padronização Corporal/fisiologia , Regulação da Expressão Gênica no Desenvolvimento/genética , Transdução de Sinais/genética , Estresse Mecânico
8.
Dev Cell ; 52(5): 659-672.e3, 2020 03 09.
Artigo em Inglês | MEDLINE | ID: mdl-32084357

RESUMO

The Drosophila wing has served as a paradigm to mechanistically characterize the role of morphogens in patterning and growth. Wingless (Wg) and Decapentaplegic (Dpp) are expressed in two orthogonal signaling centers, and their gradients organize patterning by regulating the expression of well-defined target genes. By contrast, graded activity of these morphogens is not an absolute requirement for wing growth. Despite their permissive role in regulating growth, here we show that Wg and Dpp are utilized in a non-interchangeable manner by the two existing orthogonal signaling centers to promote preferential growth along the two different axes of the developing wing. Our data indicate that these morphogens promote anisotropic growth by making use of distinct and non-interchangeable molecular mechanisms. Whereas Dpp drives growth along the anterior-posterior axis by maintaining Brinker levels below a growth-repressing threshold, Wg exerts its action along the proximal-distal axis through a double repression mechanism involving T cell factor (TCF).


Assuntos
Proteínas de Drosophila/metabolismo , Morfogênese , Transdução de Sinais , Asas de Animais/crescimento & desenvolvimento , Proteína Wnt1/metabolismo , Animais , Proteínas de Drosophila/genética , Drosophila melanogaster , Proteínas Repressoras/genética , Proteínas Repressoras/metabolismo , Fatores de Transcrição TCF/metabolismo , Asas de Animais/metabolismo , Proteína Wnt1/genética
9.
Neoplasma ; 67(3): 492-500, 2020 May.
Artigo em Inglês | MEDLINE | ID: mdl-32009419

RESUMO

Increasing researches have focused on the biological functions of long noncoding RNAs (lncRNAs) in human cancers. HOXA11-AS, a widely known lncRNA, has been confirmed to be involved in the progression of several cancers, including gastric cancer (GC). Whereas, the detailed mechanism of this lncRNA in GC remains to be further illuminated. The abundances of HOXA11-AS, miR-148a and WNT1 in GC tissues and cell lines were examined by qRT-PCR. Clinicopathological and Kaplan-Meier survival analyses were determined to explore the relationship between HOXA11-AS expression and outcomes of patients. Transwell assay was performed for the evaluation of cell migration and invasion. Bioinformatics, dual-luciferase reporter and RNA immunoprecipitation assays were employed to analyze the correlation between HOXA11-AS and miR-148a or miR-148a and WNT1. The protein levels of WNT1 and ß-catenin were assessed by western blot assay. Results showed that HOXA11-AS and WNT1 expression levels were upregulated, while miR-148a level was downregulated in GC tissues and cell lines relative to matched controls. Elevated expression of HOXA11-AS was associated with increased tumor size, lymph node metastasis, advanced TNM stage, as well as reduced survival of GC patients. HOXA11-AS induced migration and invasion of GC cells through serving as a molecular sponge for miR-148a. Furthermore, miR-148a inactivated WNT1/ß-catenin signaling pathway via directly targeting WNT1. HOXA11-AS increased WNT1/ß-catenin pathway activity, which was abolished by miR-148a overexpression in GC cells. In conclusion, overexpression of HOXA11-AS contributed to migration and invasion of GC cells via activation of WNT1/ß-catenin signaling pathway through repressing miR-148a, providing a prospective therapeutic target for GC.


Assuntos
RNA Longo não Codificante/genética , Neoplasias Gástricas/patologia , Via de Sinalização Wnt , Linhagem Celular Tumoral , Movimento Celular , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Proteínas de Homeodomínio , Humanos , MicroRNAs/genética , Estudos Prospectivos , Neoplasias Gástricas/genética , Proteína Wnt1/genética , beta Catenina/genética
10.
Nucleic Acids Res ; 48(3): 1120-1130, 2020 02 20.
Artigo em Inglês | MEDLINE | ID: mdl-31912153

RESUMO

Time-resolved imino proton nuclear magnetic resonance spectra of the WT22m sequence d(GGGCCACCGGGCAGTGGGCGGG), derived from the WNT1 promoter region, revealed an intermediate G-quadruplex G4(I) structure during K+-induced conformational transition from an initial hairpin structure to the final G4(II) structure. Moreover, a single-base C-to-T mutation at either position C4 or C7 of WT22m could lock the intermediate G4(I) structure without further conformational change to the final G4(II) structure. Surprisingly, we found that the intermediate G4(I) structure is an atypical G4 structure, which differs from a typical hybrid G4 structure of the final G4(II) structure. Further studies of modified cytosine analogues associated with epigenetic regulation indicated that slight modification on a cytosine could modulate G4 structure. A simplified four-state transition model was introduced to describe such conformational transition and disclose the possible mechanism for G4 structural selection caused by cytosine modification.


Assuntos
Citosina/química , Quadruplex G , Regiões Promotoras Genéticas , Proteína Wnt1/genética , Citosina/metabolismo , Metilação de DNA , Epigênese Genética , Ressonância Magnética Nuclear Biomolecular
11.
Sci Rep ; 10(1): 44, 2020 01 08.
Artigo em Inglês | MEDLINE | ID: mdl-31913290

RESUMO

Low miR-96-5p expression is characteristic of many cancers but its role in breast cancer (BCa) remains poorly defined. Here, the role of miR-96-5p in BC development was assessed. We demonstrate that exogenously expressing miR-96-5p inhibits the proliferative, migratory and invasive capacity of BCa cells. Mechanistically, miR-96-5p in BCa cells was found to target and downregulate catenin delta 1 (CTNND1) leading to decreased ß-catenin expression, a loss of WNT11 signaling, reduced cyclin D1 levels and lower MMP7 expression. Exogenously expressing CTNND1 alleviated these effects. In summary, we are the first to reveal that miR-96-5p inhibits the proliferative, invasive and migratory phenotypes of BCa cells the targeting of CTNND1 and subsequent Wnt/ß-catenin signaling. These data highlight miR-96-5p as a novel target for BC treatment.


Assuntos
Biomarcadores Tumorais/metabolismo , Neoplasias da Mama/patologia , Cateninas/metabolismo , Proliferação de Células , MicroRNAs/genética , Proteína Wnt1/metabolismo , beta Catenina/metabolismo , Apoptose , Biomarcadores Tumorais/genética , Neoplasias da Mama/genética , Neoplasias da Mama/metabolismo , Cateninas/genética , Movimento Celular , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Invasividade Neoplásica , Prognóstico , Células Tumorais Cultivadas , Proteína Wnt1/genética , beta Catenina/genética
12.
Sci Rep ; 10(1): 517, 2020 01 16.
Artigo em Inglês | MEDLINE | ID: mdl-31949274

RESUMO

Wnt is a conserved family of secreted proteins that play diverse roles in tissue growth and differentiation. Identification of transcription factors that regulate wnt expression is pivotal for understanding tissue-specific signaling pathways regulated by Wnt. We identified pdm3m7, a new allele of the pdm3 gene encoding a POU family transcription factor, in a lethality-based genetic screen for modifiers of Wingless (Wg) signaling in Drosophila. Interestingly, pdm3m7 larvae showed slow locomotion, implying neuromuscular defects. Analysis of larval neuromuscular junctions (NMJs) revealed decreased bouton number with enlarged bouton in pdm3 mutants. pdm3 NMJs also had fewer branches at axon terminals than wild-type NMJs. Consistent with pdm3m7 being a candidate wg modifier, NMJ phenotypes in pdm3 mutants were similar to those of wg mutants, implying a functional link between these two genes. Indeed, lethality caused by Pdm3 overexpression in motor neurons was completely rescued by knockdown of wg, indicating that Pdm3 acts upstream to Wg. Furthermore, transient expression of Pdm3 induced ectopic expression of wg-LacZ reporter and Wg effector proteins in wing discs. We propose that Pdm3 expressed in presynaptic NMJ neurons regulates wg transcription for growth and development of both presynaptic neurons and postsynaptic muscles.


Assuntos
Proteínas de Drosophila/genética , Proteínas de Drosophila/metabolismo , Drosophila melanogaster/crescimento & desenvolvimento , Junção Neuromuscular/metabolismo , Fatores do Domínio POU/metabolismo , Proteína Wnt1/genética , Animais , Drosophila melanogaster/genética , Drosophila melanogaster/metabolismo , Feminino , Regulação da Expressão Gênica , Masculino , Neurônios Motores/metabolismo , Mutação , Especificidade de Órgãos , Fatores do Domínio POU/genética , Fenótipo , Transcrição Genética
13.
Nucleic Acids Res ; 48(3): 1192-1205, 2020 02 20.
Artigo em Inglês | MEDLINE | ID: mdl-31950163

RESUMO

Somatic synonymous mutations are one of the most frequent genetic variants occurring in the coding region of cancer genomes, while their contributions to cancer development remain largely unknown. To assess whether synonymous mutations involved in post-transcriptional regulation contribute to the genetic etiology of cancers, we collected whole exome data from 8,320 patients across 22 cancer types. By employing our developed algorithm, PIVar, we identified a total of 22,948 posttranscriptionally impaired synonymous SNVs (pisSNVs) spanning 2,042 genes. In addition, 35 RNA binding proteins impacted by these identified pisSNVs were significantly enriched. Remarkably, we discovered markedly elevated ratio of somatic pisSNVs across all 22 cancer types, and a high pisSNV ratio was associated with worse patient survival in five cancer types. Intriguing, several well-established cancer genes, including PTEN, RB1 and PIK3CA, appeared to contribute to tumorigenesis at both protein function and posttranscriptional regulation levels, whereas some pisSNV-hosted genes, including UBR4, EP400 and INTS1, exerted their function during carcinogenesis mainly via posttranscriptional mechanisms. Moreover, we predicted three drugs associated with two pisSNVs, and numerous compounds associated with expression signature of pisSNV-hosted genes. Our study reveals the prevalence and clinical relevance of pisSNVs in cancers, and emphasizes the importance of considering posttranscriptional impaired synonymous mutations in cancer biology.


Assuntos
Carcinogênese/genética , Genoma Humano/genética , Neoplasias/genética , Mutação Silenciosa/genética , Adulto , Idoso , Proteínas de Ligação a Calmodulina/genética , Classe I de Fosfatidilinositol 3-Quinases/genética , DNA Helicases/genética , Proteínas de Ligação a DNA/genética , Exoma/genética , Feminino , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Neoplasias/classificação , Neoplasias/patologia , PTEN Fosfo-Hidrolase/genética , Intervalo Livre de Progressão , Processamento de Proteína Pós-Traducional/genética , Locos de Características Quantitativas/genética , Proteínas de Ligação a Retinoblastoma/genética , Ubiquitina-Proteína Ligases/genética , Proteína Wnt1/genética
14.
Genesis ; 58(1): e23337, 2020 01.
Artigo em Inglês | MEDLINE | ID: mdl-31571391

RESUMO

Proper development of taste organs including the tongue and taste papillae requires interactions with the underlying mesenchyme through multiple molecular signaling pathways. The effects of bone morphogenetic proteins (BMPs) and antagonists are profound, however, the tissue-specific roles of distinct receptors are largely unknown. Here, we report that constitutive activation (ca) of ALK2-BMP signaling in the tongue mesenchyme (marked by Wnt1-Cre) caused microglossia-a dramatically smaller and misshapen tongue with a progressively severe reduction in size along the anteroposterior axis and absence of a pharyngeal region. At E10.5, the tongue primordia (branchial arches 1-4) formed in Wnt1-Cre/caAlk2 mutants while each branchial arch responded to elevated BMP signaling distinctly in gene expression of BMP targets (Id1, Snai1, Snai2, and Runx2), proliferation (Cyclin-D1) and apoptosis (p53). Moreover, elevated ALK2-BMP signaling in the mesenchyme resulted in apparent defects of lingual epithelium, muscles, and nerves. In Wnt1-Cre/caAlk2 mutants, a circumvallate papilla was missing and further development of formed fungiform papillae was arrested in late embryos. Our data collectively demonstrate that ALK2-BMP signaling in the mesenchyme plays essential roles in orchestrating various tissues for proper development of the tongue and its appendages in a region-specific manner.


Assuntos
Receptores de Ativinas Tipo I/genética , Proteínas Morfogenéticas Ósseas/genética , Língua/embriologia , Receptores de Ativinas Tipo I/metabolismo , Animais , Apoptose/genética , Proteínas Morfogenéticas Ósseas/metabolismo , Proliferação de Células/genética , Epitélio/metabolismo , Feminino , Regulação da Expressão Gênica no Desenvolvimento/efeitos dos fármacos , Regulação da Expressão Gênica no Desenvolvimento/genética , Masculino , Mesoderma/metabolismo , Camundongos , Camundongos Endogâmicos C57BL , Crista Neural/metabolismo , Transdução de Sinais/genética , Papilas Gustativas/embriologia , Doenças da Língua/genética , Doenças da Língua/metabolismo , Transativadores/genética , Proteína Wnt1/genética
15.
J Mol Neurosci ; 70(1): 1-8, 2020 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-31428919

RESUMO

This study presents two Chinese siblings with a rare neurodevelopmental disorder (NDD) caused by biallelic INTS1 mutations and investigates the clinical features of this disease by means of in silico analysis. Two siblings, an 11-year-old brother and a 5-year-old sister, visited our hospital due to physical retardation and profound intellectual disability. Whole-exome sequencing (WES) was performed for the girl, and Sanger sequencing was used to validate the identified variants. Phenotype correlation analysis and in silico genetic interaction network analysis were performed to investigate genes that could lead to diseases similar to the rare disease in the patients. Growth retardation, distinct intellectual disability, hypertelorism, mild cataract, uneven teeth, abnormal palmar and plantar creases, and dubious genitalia were noted in the sister. No neurological features related to neuropathy were found. The brother showed features and growth delay similar to his sister. Heterozygous novel variants of c.1645A>G,p.Met549Val and c.5881C>T,p.Gln1961* in INTS1 were considered a candidate etiology. Sanger sequencing demonstrated that the variants were inherited from the grandfather and (maternal) grandmother. Phenotype correlation analysis revealed that CTDP1 mutation-induced congenital cataracts-facial dysmorphism-neuropathy (CCFDN) mostly overlapped with the performance of our patients. In silico analysis of the genetic interaction network showed that INTS1 is highly associated with INTS8 and CTDP1. Our study further validated that biallelic INTS1 mutations could bring about the onset of a novel neurodevelopmental disorder.


Assuntos
Deficiência Intelectual/genética , Anormalidades Musculoesqueléticas/genética , Mutação , Transtornos do Neurodesenvolvimento/genética , Proteína Wnt1/genética , Criança , Feminino , Humanos , Deficiência Intelectual/patologia , Masculino , Anormalidades Musculoesqueléticas/patologia , Transtornos do Neurodesenvolvimento/patologia , Fenótipo , Irmãos , Síndrome
16.
Sci Rep ; 9(1): 19549, 2019 12 20.
Artigo em Inglês | MEDLINE | ID: mdl-31863086

RESUMO

Multicellular organisms repair injured epithelium by evolutionarily conserved biological processes including activation of c-Jun N-terminal kinase (JNK) signaling. Here, we show in Drosophila imaginal epithelium that physical injury leads to the emergence of dying cells, which are extruded from the wounded tissue by JNK-induced Slit-Roundabout2 (Robo2) repulsive signaling. Reducing Slit-Robo2 signaling in the wounded tissue suppresses extrusion of dying cells and generates aberrant cells with highly upregulated growth factors Wingless (Wg) and Decapentaplegic (Dpp). The inappropriately elevated Wg and Dpp impairs wound repair, as halving one of these growth factor genes cancelled wound healing defects caused by Slit-Robo2 downregulation. Our data suggest that JNK-mediated Slit-Robo2 signaling contributes to epithelial wound repair by promoting extrusion of dying cells from the wounded tissue, which facilitates transient and appropriate induction of growth factors for proper wound healing.


Assuntos
Proteínas de Drosophila/metabolismo , Drosophila/metabolismo , Proteínas Quinases JNK Ativadas por Mitógeno/metabolismo , Transdução de Sinais/fisiologia , Animais , Drosophila/genética , Proteínas de Drosophila/genética , Proteínas Quinases JNK Ativadas por Mitógeno/genética , Receptores Imunológicos/genética , Receptores Imunológicos/metabolismo , Proteína Wnt1/genética , Proteína Wnt1/metabolismo , Cicatrização/genética , Cicatrização/fisiologia
17.
Neoplasia ; 21(12): 1151-1163, 2019 12.
Artigo em Inglês | MEDLINE | ID: mdl-31783316

RESUMO

Tetraspanin CD151 is increasingly implicated as a multifaceted mediator of cancer development and progression. Here we investigated the role of CD151 in breast cancer in the context of the Wnt oncogenic activation. Our data showed that removal of one or both of CD151 alleles in the MMTV-Wnt1 model significantly decreased the tumor-free survival of mice from 34 weeks on average to 22 weeks and 18 weeks, respectively. This effect coincided with an accelerated tumor growth and an increased number of Ki-67+ proliferative cells. Mechanistically, the CD151-deficient tumors were largely ER+, and exhibited hyperactivation of the Wnt pathway as reflected by a marked upregulation in ß-catenin and Cyclin D1, and their target genes. In addition, E-cadherin displayed a cytosolic distribution and transcription factor Snail was markedly upregulated. Collectively, this data implies that CD151 suppresses the Wnt1-driven tumorigenesis, at least in part, via counteracting the epithelial-mesenchymal transition (EMT)-like program in luminal epithelial cells. Meanwhile, the proportion of tumor cells expressing CK5 or p63, the biomarkers of myoepithelial/basal cells, markedly decreased in the absence of CD151. This change was accompanied by a decreased invasiveness of tumors and their incompetence to form a long-term cell culture. Consistent with this basal cell-linked role, the CD151 downregulation impairs mammosphere formation in MCF-10A cells and the defect was rescued by re-expression of intact CD151 ORF, but not its integrin binding-defective mutant. Overall, our study suggests that CD151 is a key player in the Wnt oncogene-driven tumorigenesis and impacts breast cancer malignancy in a cell type-dependent manner.


Assuntos
Transformação Celular Neoplásica/genética , Transformação Celular Neoplásica/metabolismo , Deleção de Genes , Tetraspanina 24/genética , Proteínas Wnt/genética , Proteínas Wnt/metabolismo , Animais , Biomarcadores , Linhagem Celular Tumoral , Feminino , Perfilação da Expressão Gênica , Humanos , Imuno-Histoquímica , Neoplasias Mamárias Animais , Vírus do Tumor Mamário do Camundongo , Camundongos , Transdução de Sinais , Proteína Wnt1/genética , Proteína Wnt1/metabolismo
18.
Eur Rev Med Pharmacol Sci ; 23(18): 7905-7912, 2019 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-31599413

RESUMO

OBJECTIVE: To elucidate the regulatory effect of circular RNA HIPK3 (circHIPK3) on the progression of gastric cancer (GC) by regulating the Wnt/ß-catenin pathway. We aim to reveal whether the abnormal expression of circHIPK3 could predict the poor prognosis of GC. PATIENTS AND METHODS: CircHIPK3 level in GC tissues and paracancerous tissues was determined by quantitative Real Time-Polymerase Chain Reaction (qRT-PCR). Its level in GC cell lines (BGC, MGC, SGC and MKN) and gastric mucosal cell line (GES) was examined as well. The correlation between the circHIPK3 level and overall survival of GC was analyzed by the Kaplan-Meier method. Regulatory effects of circHIPK3 on the proliferative ability of GC cells were evaluated by Cell Counting Kit-8 (CCK-8) and colony formation assay, respectively. Migratory changes influenced by circHIPK3 were explored through wound healing assay. The expression levels of relative genes in the Wnt/ß-catenin pathway were detected in GC cells with circHIPK3 knockdown. Finally, the Wnt/ß-catenin pathway inhibitor PNU-74654 was applied for detecting its influence on cellular behaviors of GC cells. RESULTS: CircHIPK3 level was higher in GC tissues relative to paracancerous tissues. Identically, its level was higher in GC cells compared with that of GES cells. The expression level of circHIPK3 was negatively correlated to the overall survival of GC patients. Silence of circHIPK3 weakened proliferative and migratory abilities of GC cells. In addition, circHIPK3 knockdown markedly downregulated levels of WNT1, TCF4 and ß-catenin. Application of PNU-74654 weakened the abilities of GC cells to proliferate and migrate. CONCLUSIONS: CircHIPK3 promotes GC cells to proliferate and migrate by regulating the Wnt/ß-catenin pathway. Upregulation of circHIPK3 indicates poor prognosis of GC patients.


Assuntos
Mucosa Gástrica/metabolismo , Regulação Neoplásica da Expressão Gênica , Peptídeos e Proteínas de Sinalização Intracelular/genética , Proteínas Serina-Treonina Quinases/genética , RNA Circular/genética , Neoplasias Gástricas/genética , Via de Sinalização Wnt/genética , Benzamidas/farmacologia , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Progressão da Doença , Técnicas de Silenciamento de Genes , Humanos , Prognóstico , Reação em Cadeia da Polimerase em Tempo Real , Neoplasias Gástricas/metabolismo , Taxa de Sobrevida , Fator de Transcrição 4/genética , Proteína Wnt1/genética , beta Catenina/genética
19.
Dev Cell ; 51(3): 299-312.e4, 2019 11 04.
Artigo em Inglês | MEDLINE | ID: mdl-31607650

RESUMO

Tissue folding is a fundamental process that shapes epithelia into complex 3D organs. The initial positioning of folds is the foundation for the emergence of correct tissue morphology. Mechanisms forming individual folds have been studied, but the precise positioning of folds in complex, multi-folded epithelia is less well-understood. We present a computational model of morphogenesis, encompassing local differential growth and tissue mechanics, to investigate tissue fold positioning. We use the Drosophila wing disc as our model system and show that there is spatial-temporal heterogeneity in its planar growth rates. This differential growth, especially at the early stages of development, is the main driver for fold positioning. Increased apical layer stiffness and confinement by the basement membrane drive fold formation but influence positioning to a lesser degree. The model successfully predicts the in vivo morphology of overgrowth clones and wingless mutants via perturbations solely on planar differential growth in silico.


Assuntos
Drosophila melanogaster/crescimento & desenvolvimento , Epitélio/crescimento & desenvolvimento , Morfogênese , Animais , Membrana Basal/ultraestrutura , Células Clonais , Simulação por Computador , Proteínas de Drosophila/genética , Drosophila melanogaster/metabolismo , Epitélio/anatomia & histologia , Epitélio/ultraestrutura , Discos Imaginais/anatomia & histologia , Discos Imaginais/ultraestrutura , Modelos Biológicos , Mutação/genética , Fatores de Tempo , Asas de Animais/anatomia & histologia , Asas de Animais/ultraestrutura , Proteína Wnt1/genética
20.
Int J Mol Med ; 44(6): 2276-2288, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31661124

RESUMO

Lung cancer is a malignant tumor responsible for the highest mortality rate in humans. The identification of novel functional genes is of great importance in the treatment of lung cancer. The reported roles of replication factor C subunit 3 (RFC3) in tumorigenesis are contradictory. The present study aimed to explore the role and mechanism of RFC3 in lung cancer cells. An immunohistochemical study of 165 lung cancer and adjacent tissues was conducted (123 lung adenocarcinoma tissues and 42 lung squamous cell carcinoma tissues). Kaplan­Meier analysis and Cox multivariate analysis were employed to explore the relationship between RFC3 and patient prognosis. In addition, the proliferation, cell cycle distribution and apoptosis of A549 and H1299 cells were determined by MTT assay and flow cytometry, respectively, following cell transfection to induce overexpression and knockdown of RFC3. A Boyden chamber assay and wound­healing assay were conducted to determine the invasive and migratory abilities of A549 and H1299 cells. Western blotting was used to analyze the effects of RFC3 overexpression and RFC3 small interfering RNA­induced knockdown, and to explore the potential mechanism and pathway underlying the effects of RFC3. Positive expression of RFC3 was detected in lung adenocarcinoma, and overexpression of RFC3 shortened the survival time of patients with lung adenocarcinoma. Furthermore, overexpression of RFC3 increased the invasion and migration of A549 cells, whereas knockdown of RFC3 significantly reduced the invasion and migration of H1299 cells. Ectopic expression of RFC3 induced epithelial­mesenchymal transition (EMT), as determined by downregulation of E­cadherin, and upregulation of N­cadherin, vimentin and Wnt signaling target genes, including c­MYC, Wnt1 and ß­catenin, and the ratio of phosphorylated­glycogen synthase kinase 3 (GSK3)­ß (Ser9)/GSK3­ß. In conclusion, RFC3 may be considered a coactivator that promotes the Wnt/ß­catenin signaling pathway, and induces EMT and metastasis in lung adenocarcinoma.


Assuntos
Adenocarcinoma de Pulmão/genética , Glicogênio Sintase Quinase 3 beta/genética , Proteína de Replicação C/genética , Proteína Wnt1/genética , Células A549 , Adenocarcinoma de Pulmão/patologia , Adenocarcinoma de Pulmão/cirurgia , Idoso , Apoptose/genética , Movimento Celular/genética , Proliferação de Células/genética , Intervalo Livre de Doença , Transição Epitelial-Mesenquimal/genética , Feminino , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Masculino , Pessoa de Meia-Idade , Invasividade Neoplásica/genética , Invasividade Neoplásica/patologia , Prognóstico , Proteínas Proto-Oncogênicas c-myc/genética , Via de Sinalização Wnt/genética , beta Catenina/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...