Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 7.709
Filtrar
1.
Medicine (Baltimore) ; 99(16): e19749, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32311972

RESUMO

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.


Assuntos
Canal de Potássio ERG1/genética , Síndrome do QT Longo/genética , Feminino , Mutação da Fase de Leitura , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Pessoa de Meia-Idade , Deleção de Sequência
2.
Orv Hetil ; 161(17): 689-691, 2020 04 01.
Artigo em Húngaro | MEDLINE | ID: mdl-32324363

RESUMO

Hydroxychloroquine is an immunomodulatory drug that has been used to treat malaria and autoimmune diseases such as systemic lupus erythematosus and inflammatory arthritis. The authors conclude the proarrhytmic effects of hydroxychloroquine and the most important signs of drug-induced long QT syndrome. This article is especially relevant and timely due to the more frequent (currently not evidence-based) use of the drug during the 2019­2020 coronavirus pandemic. Orv Hetil. 2020; 161(17): 689­691.


Assuntos
Antivirais , Infecções por Coronavirus/tratamento farmacológico , Coronavirus , Hidroxicloroquina/efeitos adversos , Síndrome do QT Longo , Pneumonia Viral/tratamento farmacológico , Antimaláricos/efeitos adversos , Antimaláricos/uso terapêutico , Antivirais/efeitos adversos , Antivirais/uso terapêutico , Betacoronavirus , Eletrocardiografia , Humanos , Hidroxicloroquina/uso terapêutico , Síndrome do QT Longo/induzido quimicamente , Pandemias , Risco
3.
S D Med ; 73(3): 112-115, 2020 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-32142229

RESUMO

Advancements in clinical informatics and translational genomics are changing the way we practice medicine. Automated decision support currently helps providers adjust prescribing patterns to reduce the likelihood of QT prolongation based upon drug-drug interaction. A similar approach is being explored for drug-gene interaction. Like many adverse drug reactions, QT prolongation can be influenced by variability in genetic factors. However, drug-induced QT prolongation can occur in the absence of any known ion channel gene abnormalities. We therefore review differences between congenital long QT syndrome and drug-induced long QT syndrome, and we underscore the need for decision support that integrates EKG data.


Assuntos
Sistemas de Apoio a Decisões Clínicas , Efeitos Colaterais e Reações Adversas Relacionados a Medicamentos , Síndrome do QT Longo , Torsades de Pointes , Automação , Interações Medicamentosas , Eletrocardiografia , Humanos , Síndrome do QT Longo/induzido quimicamente , Síndrome do QT Longo/diagnóstico
5.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 37(3): 289-294, 2020 Mar 10.
Artigo em Chinês | MEDLINE | ID: mdl-32128746

RESUMO

Long Q-T syndrome (LQTS) is an ion channel disease of the heart featuring single gene inheritance. It is characterized by prolonged QT interval, abnormal T wave, torsade de points (TdP) on electrocardiogram, with recurrent syncope, convulsion and even sudden death. Although the overall prevalence of LQTS is not high, the disease has attracted attention of cardiologists for its high incidence of sudden cardiac death. The compilation of this guideline has referred to the consensus of basic and clinical research, guidelines of other countries, and summarized the clinical manifestations, molecular basis, diagnostic criteria, treatment and prognosis, and genetic counseling of LQTS, with an aim to standardize its clinical diagnosis and treatment.


Assuntos
Canalopatias/diagnóstico , Canalopatias/terapia , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/terapia , Guias de Prática Clínica como Assunto , Morte Súbita Cardíaca , Eletrocardiografia , Humanos , Canais Iônicos , Prognóstico
6.
Orv Hetil ; 161(7): 275-277, 2020 Feb.
Artigo em Húngaro | MEDLINE | ID: mdl-32037871

RESUMO

A 70-year-old male patient presented with acute respiratory failure. ECG at admission showed atrial tachycardia with macro T-wave alternans that disappeared as soon as normal sinus rhythm had returned. This ECG shape was not accompanied by either QT-prolongation or acute ischaemia. This case draws attention to atrial tachycardia (provoked here in a context of respiratory insufficiency) that may be the sole reason for macro T-wave alternans. Orv Hetil. 2020; 161(7): 275-277.


Assuntos
Arritmias Cardíacas/etiologia , Taquicardia Supraventricular/diagnóstico , Idoso , Eletrocardiografia , Humanos , Síndrome do QT Longo , Masculino , Insuficiência Respiratória/etiologia , Taquicardia Supraventricular/complicações
7.
Herzschrittmacherther Elektrophysiol ; 31(1): 48-54, 2020 Mar.
Artigo em Alemão | MEDLINE | ID: mdl-32025785

RESUMO

Long QT syndrome (LQTS) is a rare inherited or acquired channelopathy associated with a relevant mortality if left untreated. Therapy can reduce the sudden cardiac death (SCD) rate significantly. Of 17 subtypes, LQTS1-3 are the most common. Clinical presentation ranges from asymptomatic patients to torsade de pointes (TdP) and SCD. Emergency therapy includes defibrillation, administration of magnesium, betablockers and temporary pacing and sedation. Secondary prevention is based on betablocker therapy and implantation of an implantable cardioverter-defibrillator (ICD), if appropriate. Short QT syndrome (SQTS) is a rare channelopathy that manifests as SCD in 34%. So far 250 cases with mutations in 8 genes have been reported. ICDs are the only reliable protection against SCD. Drug therapy is based on hydroquinidine. Further therapeutic options exist for certain subtypes of both diseases. Patients should be referred to specialized centers.


Assuntos
Síndrome do QT Longo , Arritmias Cardíacas , Eletrocardiografia , Tratamento de Emergência , Humanos , Síndrome do QT Longo/prevenção & controle , Prevenção Secundária
8.
Nat Rev Cardiol ; 17(4): 200-201, 2020 04.
Artigo em Inglês | MEDLINE | ID: mdl-32042138
11.
Int Heart J ; 61(1): 29-38, 2020 Jan 31.
Artigo em Inglês | MEDLINE | ID: mdl-31956139

RESUMO

Low-circulating levels of adiponectin (ADPN) are associated with obesity, diabetes mellitus, and coronary artery disease. On the contrary, some studies have demonstrated a link between relatively high levels of plasma ADPN and heart failure, atrial fibrillation, and adverse outcome. However, little is known about the relationship between ADPN level and prolonged QT interval. The aim of this study was to investigate the association between plasma ADPN levels and prolonged QT interval in patients with stable angina.In this retrospective study, because the diverse disease severity and condition of the study population may have affected the results, we chose individuals with stable angina. Plasma ADPN concentrations were measured using enzyme-linked immunosorbent assays. A 12-lead ECG recording was obtained from each patient.We enrolled 479 stable-angina patients. Patients with an abnormal corrected QT (QTc) interval had higher median plasma ADPN levels than those with normal QTc intervals. Age- and sex-adjusted ADPN levels were positively associated with heart rate, QTc interval, left ventricular mass index, and creatinine but negatively associated with left ventricular ejection fraction, waist circumference, current smoking, total cholesterol, triglycerides, low-density lipoprotein cholesterol, albumin, and estimated glomerular filtration rate. A multiple logistic regression analysis revealed ADPN as an independent association factor for abnormal QTc interval. Increasing concentrations of sex-specific ADPN were independently and significantly associated with abnormal QTc interval, even after full adjustment of known biomarkers.Our results indicate that ADPN may play a role in the pathogenesis of abnormal QTc interval in patients with stable angina.


Assuntos
Adiponectina/sangue , Angina Estável/fisiopatologia , Biomarcadores/sangue , Síndrome do QT Longo/diagnóstico por imagem , Idoso , Idoso de 80 Anos ou mais , Angina Estável/metabolismo , Eletrocardiografia , Feminino , Humanos , Modelos Logísticos , Síndrome do QT Longo/metabolismo , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Índice de Gravidade de Doença
12.
Herz ; 45(1): 3-9, 2020 Feb.
Artigo em Alemão | MEDLINE | ID: mdl-31820028

RESUMO

Molecular genetic analysis is an important component in the diagnostics of some cardiovascular diseases; however, genetic testing should not be used as a screening technique as the diagnostic value strongly depends on anamnestic and clinical factors, such as a positive family history and the disease phenotype. In cardiovascular diseases with high mutation detection rates, e.g. hypertrophic cardiomyopathy and primary arrhythmia syndromes (long QT syndrome, catecholaminergic polymorphic ventricular tachycardia) genetic testing should be included in the diagnostic work-up. Family screening of first-degree relatives (cascade screening) is a particularly important application of genetic diagnostics for a timely identification of asymptomatic mutation carriers and initiation of preventive treatment. A molecular autopsy, also known as postmortem molecular genetic DNA testing, is a special indication for genetic diagnostics. It is particularly useful in the analysis of sudden cardiac death victims for the identification of disease-specific gene mutations. Therefore, given a selective use and a thorough evaluation of the test results, molecular genetic analyses can make a meaningful diagnostic and prognostic contribution. Potential applications of genetic analyses in the future are polygenic cardiovascular diseases. The use of new high-throughput technologies enables the analysis of multiple genetic variants, which can then be included in the calculation of a polygenic risk score for the prediction of the probability of a specific disease.


Assuntos
Testes Genéticos , Síndrome do QT Longo , Taquicardia Ventricular , Arritmias Cardíacas/diagnóstico , Arritmias Cardíacas/genética , Morte Súbita Cardíaca , Predisposição Genética para Doença , Humanos , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/genética , Mutação , Taquicardia Ventricular/diagnóstico , Taquicardia Ventricular/genética
13.
Am J Case Rep ; 20: 1949-1955, 2019 Dec 27.
Artigo em Inglês | MEDLINE | ID: mdl-31879415

RESUMO

BACKGROUND Trazodone is widely used in the treatment of depression, anxiety, and insomnia. It is thought to have a safe cardiac profile due to the relative lack of anticholinergic effects. Publications about cardiac toxicities of trazodone are scant. CASE REPORT A 55-year-old woman presented with acute disorder of consciousness secondary to an intentional trazodone overdose. She was found to have seizure activity without cerebral edema. The initial electrocardiogram was unremarkable, with a normal QTc interval. She eventually developed QTc prolongation that evolved into ventricular tachycardia, and then into a transient right bundle-branch block, left anterior fascicular block, and variable degrees of atrioventricular nodal blocks at 12-24 h after ingestion. She then developed generalized tonic-clonic seizures, cardiogenic shock, and respiratory arrest. She was intubated and treated with antiepileptics, norepinephrine, and dopamine infusion. QTc interval prolongation gradually resolved and the various forms of heart block did not recur after at 24-36 h. She did not require transcutaneous pacing, and was successfully extubated with intact neurological function. CONCLUSIONS Fatal arrhythmias can occur in trazodone overdose. Close monitoring and supportive care are crucial for patient survival.


Assuntos
Ansiolíticos/efeitos adversos , Bloqueio de Ramo/induzido quimicamente , Overdose de Drogas/complicações , Síndrome do QT Longo/induzido quimicamente , Convulsões/induzido quimicamente , Taquicardia Ventricular/induzido quimicamente , Trazodona/efeitos adversos , Anticonvulsivantes/uso terapêutico , Bloqueio de Ramo/diagnóstico por imagem , Bloqueio de Ramo/tratamento farmacológico , Dopamina/uso terapêutico , Eletrocardiografia , Feminino , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/tratamento farmacológico , Pessoa de Meia-Idade , Norepinefrina/uso terapêutico , Taquicardia Ventricular/diagnóstico por imagem , Taquicardia Ventricular/tratamento farmacológico
14.
Pharm Res ; 37(1): 7, 2019 Dec 16.
Artigo em Inglês | MEDLINE | ID: mdl-31845095

RESUMO

PURPOSE: Antidepressants like the serotonin reuptake inhibitors (SRIs) are often used concomitantly with tamoxifen (e.g. for treatment of depression). This may lead to an additional prolongation of the QTc-interval, with an increased risk of cardiac side effects. Therefore we investigated whether there is a drug-drug interaction between tamoxifen and SRIs resulting in a prolonged QTc-interval. METHODS: Electrocardiograms (ECGs) of 100 patients were collected at steady state tamoxifen treatment, with or without concomitant SRI co-medication. QTc-interval was manually measured and calculated using the Fridericia formula. Primary outcome was difference in QTc-interval between tamoxifen monotherapy and tamoxifen concomitantly with an SRI. RESULTS: The mean QTc-interval was 12.4 ms longer when tamoxifen was given concomitantly with an SRI (95% CI:1.8-23.1 ms; P = 0.023). Prolongation of the QTc-interval was particularly pronounced for paroxetine (17.2 ms; 95%CI:1.4-33.0 ms; P = 0.04), escitalopram (12.5 ms; 95%CI:4.4-20.6 ms; P < 0.01) and citalopram (20.7 ms; 95%CI:0.7-40.7 ms; P = 0.047), where other agents like venlafaxine did not seem to prolong the QTc-interval. None of the patients had a QTc-interval of >500 ms. CONCLUSIONS: Concomitant use of tamoxifen and SRIs resulted in a significantly higher mean QTc-interval, which was especially the case for paroxetine, escitalopram and citalopram. When concomitant administration with an SRI is warranted venlafaxine is preferred.


Assuntos
Antidepressivos de Segunda Geração/farmacologia , Antineoplásicos Hormonais/efeitos adversos , Neoplasias da Mama/tratamento farmacológico , Neoplasias da Mama/fisiopatologia , Inibidores de Captação de Serotonina/efeitos adversos , Tamoxifeno/efeitos adversos , Idoso , Antidepressivos de Segunda Geração/efeitos adversos , Antineoplásicos Hormonais/farmacologia , Neoplasias da Mama/complicações , Citalopram/farmacologia , Feminino , Humanos , Síndrome do QT Longo/induzido quimicamente , Pessoa de Meia-Idade , Inibidores de Captação de Serotonina/farmacologia , Tamoxifeno/farmacologia
15.
Int J Mol Sci ; 20(20)2019 Oct 11.
Artigo em Inglês | MEDLINE | ID: mdl-31614475

RESUMO

Dysfunction of the cardiac sodium channel Nav1.5 (encoded by the SCN5A gene) is associated with arrhythmias and sudden cardiac death. SCN5A mutations associated with long QT syndrome type 3 (LQT3) lead to enhanced late sodium current and consequent action potential (AP) prolongation. Internalization and degradation of Nav1.5 is regulated by ubiquitylation, a post-translational mechanism that involves binding of the ubiquitin ligase Nedd4-2 to a proline-proline-serine-tyrosine sequence of Nav1.5, designated the PY-motif. We investigated the biophysical properties of the LQT3-associated SCN5A-p.Y1977N mutation located in the Nav1.5 PY-motif, both in HEK293 cells as well as in newly generated mice harboring the mouse homolog mutation Scn5a-p.Y1981N. We found that in HEK293 cells, the SCN5A-p.Y1977N mutation abolished the interaction between Nav1.5 and Nedd4-2, suppressed PY-motif-dependent ubiquitylation of Nav1.5, and consequently abrogated Nedd4-2 induced sodium current (INa) decrease. Nevertheless, homozygous mice harboring the Scn5a-p.Y1981N mutation showed no electrophysiological alterations nor changes in AP or (late) INa properties, questioning the in vivo relevance of the PY-motif. Our findings suggest the presence of compensatory mechanisms, with additional, as yet unknown, factors likely required to reduce the "ubiquitylation reserve" of Nav1.5. Future identification of such modulatory factors may identify potential triggers for arrhythmias and sudden cardiac death in the setting of LQT3 mutations.


Assuntos
Substituição de Aminoácidos , Síndrome do QT Longo/genética , Canal de Sódio Disparado por Voltagem NAV1.5/genética , Motivos de Aminoácidos , Animais , Feminino , Técnicas de Introdução de Genes , Células HEK293 , Humanos , Camundongos , Camundongos Transgênicos , Canal de Sódio Disparado por Voltagem NAV1.5/química , Canal de Sódio Disparado por Voltagem NAV1.5/metabolismo , Ubiquitina-Proteína Ligases Nedd4/metabolismo , Ligação Proteica , Ubiquitinação , Adulto Jovem
16.
Expert Opin Pharmacother ; 20(17): 2101-2114, 2019 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-31566420

RESUMO

Introduction: Ventricular arrhythmias are often seen in association with structural heart disease. However, approximately a tenth of affected patients have apparently normal hearts, where such arrhythmias typically occur in young patients, are sometimes inherited and can occasionally lead to sudden cardiac death (SCD). Over the past two decades, increased understanding of the underlying pathophysiology resulted in improved targeted pharmacological therapy.Areas covered: This article reviews current knowledge regarding drug therapy for inherited arrhythmia syndromes (Brugada, early repolarization, long QT and short QT syndromes, and catecholaminergic polymorphic ventricular tachycardia), and acquired arrhythmias (idiopathic ventricular fibrillation, short-coupled torsade de pointes, outflow tract ventricular tachycardia, idiopathic left, papillary muscle and annular ventricular tachycardias).Expert opinion: In inherited arrhythmia syndromes, appropriate clinical and genetic diagnoses followed by proper selection and dosing of antiarrhythmic drugs are of utmost importance to prevent SCD, most often without the need of implantable cardioverter-defibrillators. In acquired arrhythmias, appropriate pharmacotherapy in selected patients can also provide symptomatic relief and avoid the need for invasive therapy. Further research is needed to develop novel antiarrhythmic drugs or targeted therapy to increase efficacy and limit side effects.


Assuntos
Antiarrítmicos/uso terapêutico , Arritmias Cardíacas/tratamento farmacológico , Antagonistas Adrenérgicos beta/uso terapêutico , Arritmias Cardíacas/genética , Arritmias Cardíacas/patologia , Síndrome de Brugada/tratamento farmacológico , Síndrome de Brugada/patologia , Estudos de Associação Genética , Humanos , Síndrome do QT Longo/tratamento farmacológico , Síndrome do QT Longo/patologia , Quinidina/uso terapêutico , Taquicardia Ventricular/tratamento farmacológico , Taquicardia Ventricular/patologia
20.
J Pharmacol Sci ; 140(3): 284-290, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-31481348

RESUMO

The human ether-a-go-go-related gene (hERG) encodes the K+ channel that carries the rapid component of the delayed rectifier current in the human heart. Reduction of hERG activity induced by gene mutations or pharmacological inhibition is responsible for the type 2 form of long QT syndrome in patients which can develop into ventricular arrhythmia and sudden cardiac death. Therefore, pharmacological activation of hERG may lead to therapeutic potential for cardiac arrhythmias. In this study we characterized a small and novel compound, N-(2-(tert-butyl)phenyl)-6-(4-chlorophenyl)-4-(trifluoromethyl) nicotinamide, HW-0168, that exhibits potent activation of hERG channel with an EC50 of 0.41 ± 0.2 µM. Using whole-cell patch clamp recording of HEK293 cells stably expressed hERG channels, we found that HW-0168 dramatically increased current amplitude about 2.5 folds and slowed down current inactivation about 4 folds. HW-0168 shifted the voltage-dependent channel activation to hyperpolarizing direction about 3.7 mV and the voltage-dependent channel inactivation to depolarizing direction about 9.4 mV. In addition, recording of guinea-pig ventricular cells confirmed that HW-0168 shortened the action potential duration. In conclusion, we identified a novel hERG channel activator HW-0168 that can be used for studying the physiological role of hERG in cardiac myocytes and may be beneficial for treating long QT syndrome.


Assuntos
Canais de Potássio Éter-A-Go-Go/metabolismo , Miócitos Cardíacos/efeitos dos fármacos , Miócitos Cardíacos/metabolismo , Bibliotecas de Moléculas Pequenas/farmacologia , Potenciais de Ação/efeitos dos fármacos , Animais , Arritmias Cardíacas/tratamento farmacológico , Arritmias Cardíacas/metabolismo , Linhagem Celular , Cobaias , Células HEK293 , Ventrículos do Coração/efeitos dos fármacos , Ventrículos do Coração/metabolismo , Humanos , Síndrome do QT Longo/tratamento farmacológico , Síndrome do QT Longo/metabolismo , Masculino
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA