Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 87
Filtrar
2.
PLoS One ; 15(8): e0237854, 2020.
Artigo em Inglês | MEDLINE | ID: mdl-32853262

RESUMO

Drug-induced long QT syndrome (diLQTS), characterized by a prolongation of the QT-interval on the electrocardiogram (ECG), is a serious adverse drug reaction that can cause the life-threatening arrhythmia Torsade de Points (TdP). Self-monitoring for diLQTS could therefore save lives, but detecting it on the ECG is difficult, particularly at high and low heart rates. In this paper, we evaluate whether using a pseudo-colouring visualisation technique and changing the coordinate system (Cartesian vs. Polar) can support lay people in identifying QT-prolongation at varying heart rates. Four visualisation techniques were evaluated using a counterbalanced repeated measures design including Cartesian no-colouring, Cartesian pseudo-colouring, Polar no-colouring and Polar pseudo-colouring. We used a multi-reader, multi-case (MRMC) receiver operating characteristic (ROC) study design within a psychophysical paradigm, along with eye-tracking technology. Forty-three lay participants read forty ECGs (TdP risk n = 20, no risk n = 20), classifying each QT-interval as normal/abnormal, and rating their confidence on a 6-point scale. The results show that introducing pseudo-colouring to the ECG significantly increased accurate detection of QT-interval prolongation regardless of heart rate, T-wave morphology and coordinate system. Pseudo-colour also helped to reduce reaction times and increased satisfaction when reading the ECGs. Eye movement analysis indicated that pseudo-colour helped to focus visual attention on the areas of the ECG crucial to detecting QT-prolongation. The study indicates that pseudo-colouring enables lay people to visually identify drug-induced QT-prolongation regardless of heart rate, with implications for the more rapid identification and management of diLQTS.


Assuntos
Eletrocardiografia , Frequência Cardíaca , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/fisiopatologia , Adulto , Cor , Movimentos Oculares/fisiologia , Feminino , Fixação Ocular/fisiologia , Humanos , Masculino , Pessoa de Meia-Idade , Satisfação Pessoal , Estimulação Luminosa , Psicofísica , Curva ROC , Tempo de Reação , Fatores de Risco , Sensibilidade e Especificidade , Adulto Jovem
3.
J Interv Card Electrophysiol ; 59(2): 337-345, 2020 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-32654098

RESUMO

PURPOSE: Hydroxychloroquine, chloroquine, and azithromycin have been used for treatment of COVID-19, but may cause QT prolongation. Minority populations are disproportionately impacted by COVID-19. This study evaluates the risk of QT prolongation and subsequent outcomes after administration of these medications in largely underrepresented minority COVID-19 patients. METHODS: We conducted an observational study on hospitalized COVID-19 patients in the Montefiore Health System (Bronx, NY). We examined electrocardiograms (ECG) pre/post-medication initiation to evaluate QTc, HR, QRS duration, and presence of other arrhythmias. RESULTS: One hundred five patients (mean age 67 years; 44.8% F) were analyzed. The median time from the first dose of any treatment to post-medication ECG was 2 days (IQR: 1-3). QTc in men increased from baseline (440 vs 455 ms, p < 0.001), as well as in women (438 vs 463 ms, p < 0.001). The proportion of patients with QT prolongation increased significantly (14.3% vs 34.3%, p < 0.001) even when adjusted for electrolyte abnormalities. The number of patients whose QTc > 500 ms was significantly increased after treatment (16.2% vs. 4.8%, p < 0.01). Patients with either QTc > 500 ms or an increase of 60 ms had a higher frequency of death (47.6% vs. 22.6%, p = 0.02) with an odds ratio of 3.1 (95% CI: 1.1-8.7). Adjusting for race/ethnicity yielded no significant associations. CONCLUSIONS: Hydroxychloroquine, chloroquine, and/or azithromycin were associated with QTc prolongation but did not result in fatal arrhythmias. Our findings suggest that any harm is unlikely to outweigh potential benefits of treatment. Careful risk-benefit analyses for individual patients should guide the use of these medications. Randomized control trials are necessary to evaluate their efficacies.


Assuntos
Antimaláricos/efeitos adversos , Azitromicina/efeitos adversos , Infecções por Coronavirus/tratamento farmacológico , Eletrocardiografia/métodos , Síndrome do QT Longo/induzido quimicamente , Pneumonia Viral/tratamento farmacológico , Distribuição por Idade , Idoso , Idoso de 80 Anos ou mais , Antimaláricos/administração & dosagem , Azitromicina/administração & dosagem , Cloroquina/administração & dosagem , Cloroquina/efeitos adversos , Infecções por Coronavirus/diagnóstico , Infecções por Coronavirus/epidemiologia , Feminino , Seguimentos , Hospitalização/estatística & dados numéricos , Humanos , Hidroxicloroquina/administração & dosagem , Hidroxicloroquina/efeitos adversos , Incidência , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/tratamento farmacológico , Síndrome do QT Longo/epidemiologia , Masculino , Pessoa de Meia-Idade , Pandemias/prevenção & controle , Pandemias/estatística & dados numéricos , Pneumonia Viral/diagnóstico , Pneumonia Viral/epidemiologia , Medição de Risco , Distribuição por Sexo , População Urbana
4.
J Interv Card Electrophysiol ; 59(2): 329-336, 2020 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-32494896

RESUMO

BACKGROUND: Cardiovascular and arrhythmic events have been reported in hospitalized COVID-19 patients. However, arrhythmia manifestations and treatment strategies used in these patients have not been well-described. We sought to better understand the cardiac arrhythmic manifestations and treatment strategies in hospitalized COVID-19 patients through a worldwide cross-sectional survey. METHODS: The Heart Rhythm Society (HRS) sent an online survey (via SurveyMonkey) to electrophysiology (EP) professionals (physicians, scientists, and allied professionals) across the globe. The survey was active from March 27 to April 13, 2020. RESULTS: A total of 1197 respondents completed the survey with 50% of respondents from outside the USA, representing 76 countries and 6 continents. Of respondents, 905 (76%) reported having COVID-19-positive patients in their hospital. Atrial fibrillation was the most commonly reported tachyarrhythmia whereas severe sinus bradycardia and complete heart block were the most common bradyarrhythmias. Ventricular tachycardia/ventricular fibrillation arrest and pulseless electrical activity were reported by 4.8% and 5.6% of respondents, respectively. There were 140 of 631 (22.2%) respondents who reported using anticoagulation therapy in all COVID-19-positive patients who did not otherwise have an indication. One hundred fifty-five of 498 (31%) reported regular use of hydroxychloroquine/chloroquine (HCQ) + azithromycin (AZM); concomitant use of AZM was more common in the USA. Sixty of 489 respondents (12.3%) reported having to discontinue therapy with HCQ + AZM due to significant QTc prolongation and 20 (4.1%) reported cases of Torsade de Pointes in patients on HCQ/chloroquine and AZM. Amiodarone was the most common antiarrhythmic drug used for ventricular arrhythmia management. CONCLUSIONS: In this global survey of > 1100 EP professionals regarding hospitalized COVID-19 patients, a variety of arrhythmic manifestations were observed, ranging from benign to potentially life-threatening. Observed adverse events related to use of HCQ + AZM included prolonged QTc requiring drug discontinuation as well as Torsade de Pointes. Large prospective studies to better define arrhythmic manifestations as well as the safety of treatment strategies in COVID-19 patients are warranted.


Assuntos
Antiarrítmicos/administração & dosagem , Arritmias Cardíacas/diagnóstico por imagem , Arritmias Cardíacas/epidemiologia , Infecções por Coronavirus/epidemiologia , Pandemias/estatística & dados numéricos , Pneumonia Viral/epidemiologia , Inquéritos e Questionários , Arritmias Cardíacas/tratamento farmacológico , Infecções por Coronavirus/diagnóstico , Infecções por Coronavirus/tratamento farmacológico , Estudos Transversais , Eletrocardiografia/métodos , Feminino , Humanos , Incidência , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/tratamento farmacológico , Síndrome do QT Longo/epidemiologia , Masculino , Pandemias/prevenção & controle , Pneumonia Viral/diagnóstico , Pneumonia Viral/tratamento farmacológico , Prognóstico , Índice de Gravidade de Doença , Taxa de Sobrevida , Torsades de Pointes/diagnóstico por imagem , Torsades de Pointes/tratamento farmacológico , Torsades de Pointes/epidemiologia , Resultado do Tratamento
5.
J Interv Card Electrophysiol ; 59(2): 315-320, 2020 Nov.
Artigo em Inglês | MEDLINE | ID: mdl-32418181

RESUMO

COVID-19 infection has shown rapid growth worldwide, and different therapies have been proposed for treatment, in particular, the combination of immune response modulating drugs such as chloroquine and hydroxychloroquine (antimalarials) alone or in combination with azithromycin. Although the clinical evidence supporting their use is scarce, the off label use of these drugs has spread very quickly in face of the progression of the epidemic and the high mortality rate in susceptible populations. However, these medications can pathologically prolong the QT interval and lead to malignant ventricular arrhythmias such that organized guidance on QT evaluation and management strategies are important to reduce morbidity associated with the potential large-scale use.


Assuntos
Antimaláricos/efeitos adversos , Infecções por Coronavirus/tratamento farmacológico , Eletrocardiografia , Síndrome do QT Longo/induzido quimicamente , Síndrome do QT Longo/diagnóstico por imagem , Pneumonia Viral/tratamento farmacológico , Guias de Prática Clínica como Assunto , Adulto , Idoso , Antimaláricos/administração & dosagem , Arritmias Cardíacas/induzido quimicamente , Arritmias Cardíacas/epidemiologia , Azitromicina/administração & dosagem , Azitromicina/efeitos adversos , Cloroquina/administração & dosagem , Cloroquina/efeitos adversos , Infecções por Coronavirus/diagnóstico , Infecções por Coronavirus/epidemiologia , Relação Dose-Resposta a Droga , Feminino , Humanos , Hidroxicloroquina/administração & dosagem , Hidroxicloroquina/efeitos adversos , Incidência , Masculino , Pessoa de Meia-Idade , Pandemias/prevenção & controle , Pandemias/estatística & dados numéricos , Pneumonia Viral/diagnóstico , Pneumonia Viral/epidemiologia , Prognóstico , Medição de Risco
7.
Medicine (Baltimore) ; 99(16): e19749, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32311972

RESUMO

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.


Assuntos
Canal de Potássio ERG1/genética , Síndrome do QT Longo/genética , Feminino , Mutação da Fase de Leitura , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Pessoa de Meia-Idade , Deleção de Sequência
8.
Int Heart J ; 61(1): 29-38, 2020 Jan 31.
Artigo em Inglês | MEDLINE | ID: mdl-31956139

RESUMO

Low-circulating levels of adiponectin (ADPN) are associated with obesity, diabetes mellitus, and coronary artery disease. On the contrary, some studies have demonstrated a link between relatively high levels of plasma ADPN and heart failure, atrial fibrillation, and adverse outcome. However, little is known about the relationship between ADPN level and prolonged QT interval. The aim of this study was to investigate the association between plasma ADPN levels and prolonged QT interval in patients with stable angina.In this retrospective study, because the diverse disease severity and condition of the study population may have affected the results, we chose individuals with stable angina. Plasma ADPN concentrations were measured using enzyme-linked immunosorbent assays. A 12-lead ECG recording was obtained from each patient.We enrolled 479 stable-angina patients. Patients with an abnormal corrected QT (QTc) interval had higher median plasma ADPN levels than those with normal QTc intervals. Age- and sex-adjusted ADPN levels were positively associated with heart rate, QTc interval, left ventricular mass index, and creatinine but negatively associated with left ventricular ejection fraction, waist circumference, current smoking, total cholesterol, triglycerides, low-density lipoprotein cholesterol, albumin, and estimated glomerular filtration rate. A multiple logistic regression analysis revealed ADPN as an independent association factor for abnormal QTc interval. Increasing concentrations of sex-specific ADPN were independently and significantly associated with abnormal QTc interval, even after full adjustment of known biomarkers.Our results indicate that ADPN may play a role in the pathogenesis of abnormal QTc interval in patients with stable angina.


Assuntos
Adiponectina/sangue , Angina Estável/fisiopatologia , Biomarcadores/sangue , Síndrome do QT Longo/diagnóstico por imagem , Idoso , Idoso de 80 Anos ou mais , Angina Estável/metabolismo , Eletrocardiografia , Feminino , Humanos , Modelos Logísticos , Síndrome do QT Longo/metabolismo , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Índice de Gravidade de Doença
9.
Am J Case Rep ; 20: 1949-1955, 2019 Dec 27.
Artigo em Inglês | MEDLINE | ID: mdl-31879415

RESUMO

BACKGROUND Trazodone is widely used in the treatment of depression, anxiety, and insomnia. It is thought to have a safe cardiac profile due to the relative lack of anticholinergic effects. Publications about cardiac toxicities of trazodone are scant. CASE REPORT A 55-year-old woman presented with acute disorder of consciousness secondary to an intentional trazodone overdose. She was found to have seizure activity without cerebral edema. The initial electrocardiogram was unremarkable, with a normal QTc interval. She eventually developed QTc prolongation that evolved into ventricular tachycardia, and then into a transient right bundle-branch block, left anterior fascicular block, and variable degrees of atrioventricular nodal blocks at 12-24 h after ingestion. She then developed generalized tonic-clonic seizures, cardiogenic shock, and respiratory arrest. She was intubated and treated with antiepileptics, norepinephrine, and dopamine infusion. QTc interval prolongation gradually resolved and the various forms of heart block did not recur after at 24-36 h. She did not require transcutaneous pacing, and was successfully extubated with intact neurological function. CONCLUSIONS Fatal arrhythmias can occur in trazodone overdose. Close monitoring and supportive care are crucial for patient survival.


Assuntos
Ansiolíticos/efeitos adversos , Bloqueio de Ramo/induzido quimicamente , Overdose de Drogas/complicações , Síndrome do QT Longo/induzido quimicamente , Convulsões/induzido quimicamente , Taquicardia Ventricular/induzido quimicamente , Trazodona/efeitos adversos , Anticonvulsivantes/uso terapêutico , Bloqueio de Ramo/diagnóstico por imagem , Bloqueio de Ramo/tratamento farmacológico , Dopamina/uso terapêutico , Eletrocardiografia , Feminino , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/tratamento farmacológico , Pessoa de Meia-Idade , Norepinefrina/uso terapêutico , Taquicardia Ventricular/diagnóstico por imagem , Taquicardia Ventricular/tratamento farmacológico
11.
Iran Biomed J ; 23(3): 228-34, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30797226

RESUMO

Background: Long QT syndrome (LQTS) is characterized by the prolongation of QT interval, which results in syncope and sudden cardiac death in young people. KCNQ1 is the most common gene responsible for this syndrome. Methods: Molecular investigation was performed by DNA Sanger sequencing in Iranian families with a history of syncope. In silico examinations were performed for predicting the pathogenicity of the novel variant. Results: A novel homozygous KCNQ1 frameshift mutation, c.1426_1429delATGC (M476Pfs*4), was identified, and then the current literatures of five patients were reviewed regarding the LQTS. Conclusion: The novel frameshift mutation has been reported for the first time among the Iranian population. Our finding along with the case series study of LQTS patients illustrates the importance of genetic and case series in precise detection of the frequency of LQTS carriers.


Assuntos
Mutação da Fase de Leitura/genética , Predisposição Genética para Doença , Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/genética , Sequência de Bases , Eletrocardiografia , Feminino , Humanos , Irã (Geográfico) , Síndrome do QT Longo/diagnóstico por imagem , Masculino , Linhagem
12.
Am J Trop Med Hyg ; 100(2): 399-404, 2019 02.
Artigo em Inglês | MEDLINE | ID: mdl-30734694

RESUMO

This study compared the frequency of abnormal electrocardiogram (ECG) types between scrub typhus patient group and age- and gender-matched health checkup group and their associations with disease severity in scrub typhus patient. Demographic characteristics and ECG and laboratory findings of patients with scrub typhus admitted to Chosun University Hospital, and normal subjects visiting the hospital for health checkup from January 2008 to December 2012 were retrospectively studied. Electrocardiogram abnormalities at admission were observed in 72 of 165 (43.6%) scrub typhus confirmed patients. The following ECG abnormalities were observed: arrhythmic group (31 cases, 18.8%), ischemic change group (25 cases, 15.1%), prolonged QT group (32 cases, 19.4%).Compared with the age and gender-matched health checkup group, ECG abnormalities were more commonly observed in scrub typhus patient group (13.9% versus 43.6%, P < 0.001). In addition, when compared with the normal ECG group, scrub typhus in the abnormal ECG group showed greater disease severity and this phenomenon was particularly prominent in the prolonged QT group. Based on our study prolonged QT observed in approximately 20% of patients with scrub typhus, clinicians should pay additional attention to drugs that affect QT interval.


Assuntos
Arritmias Cardíacas/fisiopatologia , Síndrome do QT Longo/fisiopatologia , Isquemia Miocárdica/fisiopatologia , Tifo por Ácaros/fisiopatologia , Idoso , Arritmias Cardíacas/complicações , Arritmias Cardíacas/diagnóstico por imagem , Arritmias Cardíacas/microbiologia , Análise Química do Sangue , Estudos de Casos e Controles , Eletrocardiografia , Feminino , Humanos , Síndrome do QT Longo/complicações , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/microbiologia , Masculino , Pessoa de Meia-Idade , Isquemia Miocárdica/complicações , Isquemia Miocárdica/diagnóstico por imagem , Isquemia Miocárdica/microbiologia , Orientia tsutsugamushi/patogenicidade , Orientia tsutsugamushi/fisiologia , Estudos Retrospectivos , Tifo por Ácaros/complicações , Tifo por Ácaros/diagnóstico por imagem , Tifo por Ácaros/microbiologia , Índice de Gravidade de Doença
13.
J Interv Card Electrophysiol ; 54(2): 189-196, 2019 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30353374

RESUMO

PURPOSE: There is a significant variation in the clinical approach of initiation and dose adjustment of dofetilide in atrial fibrillation (AF). Excessive QT prolongation could predispose patients to torsades de pointes (TdP), which can be fatal. METHODS: We performed a retrospective case-control study at Mayo Clinic Rochester (January 1, 2003 to December 31, 2016). "TdP risk" cases were defined as patients on dofetilide therapy for AF with subsequent TdP or excessive QTc prolongation requiring dose reduction or discontinuation (N = 31). A control group was matched 1:1 with cases by age, gender, year of admission, and dofetilide dose (N = 31). RESULTS: Using multivariate regression analysis, independent predictors of TdP risk included baseline QTc exceeding recommendations (adjusted odd ratio [AOR] 4.57; P = 0.023); underlying AF with rapid ventricular rate (AOR 16.95; P = 0.004); and diuretic therapy for acute heart failure (AOR 8.42; P = 0.007). Poor inter-observer agreement was identified among QT interval measurement in patients with AF and rapid ventricular rate compared to those in rate controlled AF or sinus rhythm. TdP risk cases receiving diuretics for acute heart failure had a significant decline in creatinine clearance than controls, although serum electrolytes and replacement did not differ among the two groups. CONCLUSIONS: Excessive QTc prolongation and AF with rapid ventricular rate at time of dofetilide initiation (likely due to difficulty in measuring QT intervals), and diuretic therapy for acute heart failure were independent factors for dofetilide-related TdP risk. Based on these data, possible preventive strategies could be adapted for safety protocols among hospitalized patients.


Assuntos
Antiarrítmicos/efeitos adversos , Fibrilação Atrial/tratamento farmacológico , Eletrocardiografia/métodos , Fenetilaminas/efeitos adversos , Sulfonamidas/efeitos adversos , Torsades de Pointes/induzido quimicamente , Centros Médicos Acadêmicos , Idoso , Antiarrítmicos/uso terapêutico , Fibrilação Atrial/diagnóstico por imagem , Estudos de Casos e Controles , Relação Dose-Resposta a Droga , Esquema de Medicação , Feminino , Frequência Cardíaca/efeitos dos fármacos , Hospitalização/estatística & dados numéricos , Humanos , Modelos Logísticos , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/tratamento farmacológico , Masculino , Pessoa de Meia-Idade , Análise Multivariada , Variações Dependentes do Observador , Fenetilaminas/uso terapêutico , Prognóstico , Estudos Retrospectivos , Medição de Risco , Sulfonamidas/uso terapêutico , Taxa de Sobrevida , Torsades de Pointes/diagnóstico por imagem , Resultado do Tratamento
14.
Ann Noninvasive Electrocardiol ; 24(2): e12609, 2019 03.
Artigo em Inglês | MEDLINE | ID: mdl-30417951

RESUMO

BACKGROUND: Varenicline, which is a selective partial agonist of the alpha4-beta2 nicotinic acetylcholine receptor, is used for the smoking cessation pharmacotherapy. Cardiovascular adverse effects have been reported after varenicline usage in patients who stop smoking. We investigated the effect of varenicline usage on ventricular repolarization after smoking cessation. METHODS: In this prospective cohort study, we evaluated the cardiac arrhythmic effects of varenicline by comparing smoking patients (n = 214) before and after varenicline usage. Varenicline administered patients were also compared to ex-smoker individuals (n = 50) who quit smoking without varenicline usage in terms of ventricular repolarization parameters. RESULTS: After calculated according to Fridericia's and Framingham's formulas, QTc intervals were significantly increased when patients compared before and after smoking cessation with varenicline (402.9 ± 24.5 ms vs. 409.1 ± 25.0 ms p < 0.001 and 376.5 ± 15.2 ms, vs. 380.6 ± 13.5 ms; p < 0.001, respectively). There was no arrhythmic event during the follow-up. The change in Tp-e and QTc following varenicline usage was negatively correlated with the smoking packet/year. (ρ: -0.443, p < 0.001 and ρ = -0.601, p < 0.001) CONCLUSION: Varenicline usage was demonstrated to prolong ventricular repolarization parameters similar to animal studies. Varenicline may have a role to predispose cardiac dysrhythmias after utilization in smoking cessation.


Assuntos
Arritmias Cardíacas/tratamento farmacológico , Eletrocardiografia/métodos , Síndrome do QT Longo/induzido quimicamente , Agentes de Cessação do Hábito de Fumar/administração & dosagem , Abandono do Hábito de Fumar/métodos , Vareniclina/administração & dosagem , Adulto , Arritmias Cardíacas/induzido quimicamente , Arritmias Cardíacas/diagnóstico por imagem , Estudos de Coortes , Feminino , Seguimentos , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Masculino , Pessoa de Meia-Idade , Projetos Piloto , Estudos Prospectivos , Medição de Risco , Fumar/efeitos adversos , Agentes de Cessação do Hábito de Fumar/efeitos adversos , Fatores de Tempo
15.
Biomed Res Int ; 2018: 1574806, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-30406128

RESUMO

Background: Azithromycin exposure has been reported to increase the risk of QT prolongation and cardiovascular death. However, findings on the association between azithromycin and cardiovascular death are controversial, and azithromycin is still used in actual practice. Additionally, quantitative assessments of risk have not been performed, including the risk of QT prolongation when patients are exposed to azithromycin in a real-world clinical setting. Therefore, in this study, we aimed to evaluate the risk of exposure to azithromycin on QT prolongation in a real-world clinical setting using a 21-year medical history database of a tertiary medical institution. Methods: We analyzed the electrocardiogram results and relevant electronic health records of 402,607 subjects in a tertiary teaching hospital in Korea from 1996 to 2015. To evaluate the risk of QT prolongation of azithromycin, we conducted a case-control analysis using amoxicillin for comparison. Multiple logistic regression analysis was performed to correct for age, sex, accompanying drugs, and disease. Results: The odds ratio (OR) for QT prolongation (QTc>450 ms in male and >460 ms in female) on azithromycin exposure was 1.40 (95% confidence interval [CI], 1.23-1.59), and the OR for severe QT prolongation (QTc>500 ms) was 1.43 (95% CI, 1.13-1.82). On the other hand, the ORs on exposure to amoxicillin were 1.06 (95% CI, 0.97-1.15) and 0.88 (95% CI, 0.70-1.09). In a subgroup analysis, the risk of QT prolongation in patients aged between 60 and 80 years was significantly higher when they are exposed to azithromycin. Conclusions: The risk of QT prolongation was increased when patients, particularly the elderly aged 60-79 years, were exposed to azithromycin. Therefore, clinicians should pay exercise caution using azithromycin or consider using other antibiotics, such as amoxicillin, instead of azithromycin.


Assuntos
Azitromicina/efeitos adversos , Síndrome do QT Longo/induzido quimicamente , Medição de Risco , Amoxicilina/efeitos adversos , Eletrocardiografia , Feminino , Humanos , Modelos Logísticos , Síndrome do QT Longo/diagnóstico por imagem , Masculino , Pessoa de Meia-Idade , Razão de Chances , Fatores de Risco
16.
J Interv Card Electrophysiol ; 52(3): 255-262, 2018 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-30056516

RESUMO

There has always been an appreciation of the role of Purkinje fibers in the fast conduction of the normal cardiac impulse. Here, we briefly update our knowledge of this important set of cardiac cells. We discuss the anatomy of a Purkinje fiber strand, the importance of longitudinal conduction within a strand, circus movement within a strand, conduction, and excitability properties of Purkinjes. At the cell level, we discuss the important components of the ion channel makeup in the nonremodeled Purkinjes of healthy hearts. Finally, we discuss the role of the Purkinjes in forming the heritable arrhythmogenic substrates such as long QT, heritable conduction slowing, CPVT, sQT, and Brugada syndromes.


Assuntos
Arritmias Cardíacas/fisiopatologia , Sistema de Condução Cardíaco/fisiopatologia , Síndrome do QT Longo/diagnóstico por imagem , Ramos Subendocárdicos/anatomia & histologia , Animais , Arritmias Cardíacas/diagnóstico por imagem , Eletrocardiografia/métodos , Humanos , Síndrome do QT Longo/fisiopatologia , Ramos Subendocárdicos/fisiologia , Papel (figurativo) , Sensibilidade e Especificidade
17.
Circ Arrhythm Electrophysiol ; 11(4): e005797, 2018 04.
Artigo em Inglês | MEDLINE | ID: mdl-29654130

RESUMO

BACKGROUND: Long-QT syndrome (LQTS), an inherited cardiac repolarization disorder, is an important cause of fetal and neonatal mortality. Detecting LQTS prenatally is challenging. A fetal heart rate (FHR) less than third percentile for gestational age is specific for LQTS, but the sensitivity is only ≈50%. Left ventricular isovolumetric relaxation time (LVIRT) was evaluated as a potential diagnostic marker for fetal LQTS. METHODS AND RESULTS: LV isovolumetric contraction time, LV ejection time, LVIRT, cycle length, and FHR were measured using pulsed Doppler waveforms in fetuses. Time intervals were expressed as percentages of cycle length, and the LV myocardial performance index was calculated. Single measurements were stratified by gestational age and compared between LQTS fetuses and controls. Receiver-operator curves were performed for FHR and normalized LVIRT (N-LVIRT). A linear mixed-effect model including multiple measurements was used to analyze trends in FHR, N-LVIRT, and LV myocardial performance index. There were 33 LQTS fetuses and 469 controls included. In LQTS fetuses, the LVIRT was prolonged in all gestational age groups (P<0.001), as was the N-LVIRT. The best cutoff to diagnose LQTS was N-LVIRT ≥11.3 at ≤20 weeks (92% sensitivity, 70% specificity). Simultaneous analysis of N-LVIRT and FHR improved the sensitivity and specificity for LQTS (area under the curve=0.96; 95% confidence interval, 0.82-1.00 at 21-30 weeks). N-LVIRT, LV myocardial performance index, and FHR trends differed significantly between LQTS fetuses and controls through gestation. CONCLUSIONS: The LVIRT is prolonged in LQTS fetuses. Findings of a prolonged N-LVIRT and sinus bradycardia can improve the prenatal detection of fetal LQTS.


Assuntos
Coração Fetal/fisiopatologia , Frequência Cardíaca Fetal , Síndrome do QT Longo/fisiopatologia , Função Ventricular Esquerda , Potenciais de Ação , Colorado , Diástole , Ecocardiografia Doppler de Pulso , Eletrocardiografia , Feminino , Coração Fetal/diagnóstico por imagem , Idade Gestacional , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/genética , Países Baixos , Valor Preditivo dos Testes , Gravidez , Reprodutibilidade dos Testes , Estudos Retrospectivos , Volume Sistólico , Fatores de Tempo , Ultrassonografia Pré-Natal/métodos
20.
Rev. esp. cardiol. (Ed. impr.) ; 70(10): 801-807, oct. 2017. mapas, tablas
Artigo em Espanhol | IBECS | ID: ibc-167860

RESUMO

Introducción y objetivos: Hay patrones electrocardiográficos asociados a mayor riesgo de muerte súbita por arritmias ventriculares. En España no existe información acerca de su prevalencia en la población. El objetivo es estudiar la prevalencia de estos patrones, así como los factores clinicoepidemiológicos asociados a su presencia. Métodos: Subanálisis del estudio OFRECE en el que se estudió la prevalencia de patrones electrocardiográficos de síndrome de Brugada o anomalías del intervalo QT en una muestra representativa de la población española ≥ 40 años. Se dispuso de datos clínicos y electrocardiogramas de todos los participantes. Los electrocardiogramas fueron evaluados de forma independiente por 2 cardiólogos y, en caso de desacuerdo, se consultó con un tercero. Se analizaron las prevalencias ponderadas y los factores clínicos asociados a patrones tipo Brugada o a anomalías del segmento QT. Resultados: Se evaluó a 8.343 individuos (59,2 años, 52,4% mujeres) y se detectaron 12 casos de patrón Brugada (tipo 1, 2 casos; tipo 2, 10 casos; prevalencia ponderada, 0,13%). Para el análisis del QT corregido (QTc) se excluyó a los participantes con bloqueo de rama izquierda o ritmos no sinusales. Las prevalencias ponderadas fueron: QTc corto (< 340 ms) 0,18%, QTc borderline(441-469 ms) 8,33%, QTc largo (criterio ≥ 470 ms) 1,01% y QTc largo (criterio ≥ 480 ms) 0,42%. Conclusiones: El 0,6-1,1% de la población española de edad ≥ 40 años presenta un patrón electrocardiográfico de riesgo de muerte súbita (síndrome de Brugada, QT largo o QT corto) (AU)


Introduction and objectives: Some electrocardiographic patterns are associated with an increased risk of sudden cardiac death due to ventricular arrhythmias. There is no information on the prevalence of these patterns in the general population in Spain. The objective of this study was to analyze the prevalence of these patterns and associated clinical and epidemiological factors. Methods: This subanalysis of the OFRECE study selected a representative sample of the Spanish population aged ≥ 40 years. We studied the presence or absence of electrocardiographic patterns of Brugada syndrome and QT interval abnormalities. Clinical data and electrocardiograms were available in all participants. Electrocardiograms were evaluated by 2 cardiologists and a third cardiologist was consulted if there was disagreement in the diagnosis. We calculated the weighted prevalence and clinical factors associated with the presence of Brugada-type patterns or QT segment abnormalities. Results: Overall, 8343 individuals were evaluated (59.2 years, 52.4% female). There were 12 Brugada cases (type 1, 2 cases; type 2, 10 cases; weighted prevalence, 0.13%). For corrected QT (QTc) analysis, we excluded participants with left bundle branch block or without sinus rhythm. Weighted prevalences were as follows: short QTc (< 340 ms) 0.18%, borderline QTc (441-469 ms) 8.33%, long QTc (≥ 470 ms criterion) 1.01% and long QTc (≥ 480 criterion) 0.42%. Conclusions: A total of 0.6% to 1.1% of the Spanish population aged ≥ 40 years has an electrocardiographic pattern associated with a higher risk of sudden death (Brugada syndrome, long QT, or short QT) (AU)


Assuntos
Humanos , Masculino , Feminino , Adulto , Pessoa de Meia-Idade , Idoso , Idoso de 80 Anos ou mais , Morte Súbita Cardíaca/epidemiologia , Eletrocardiografia/normas , Síndrome do QT Longo/diagnóstico por imagem , Síndrome do QT Longo/epidemiologia , Arritmias Cardíacas/complicações , Arritmias Cardíacas/diagnóstico por imagem , Síndrome de Brugada/complicações , Análise Multivariada
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA