Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 2.207
Filtrar
1.
Medicine (Baltimore) ; 99(16): e19749, 2020 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-32311972

RESUMO

INTRODUCTION: Long QT syndrome (LQTS) is electrocardiographically characterized by a prolonged QT interval and manifests predisposition to life-threatening arrhythmia which often leads to sudden cardiac death. Type 2 LQTS (LQT2) is the second most common subtype of LQTS and caused by mutations in KCNH2 gene. Up to date, >900 mutations have been reported to be related to LQT2. However, mutational screening of the KCNH2 gene is still far from completeness. Identification of KCNH2 mutations is particularly important in diagnosis of LQT2 and will gain more insights into the molecular basis for the pathogenesis of LQT2. PATIENT CONCERNS: A Chinese Han family with LQTS phenotypes was examined. DIAGNOSIS: A novel deletion-frameshift mutation, c.381_408delCAATTTCGAGGTGGTGATGGAGAAGGAC, in exon 3 of KCNH2 gene was identified in a Chinese family with LQTS. On the basis of this finding and clinical manifestations, the final diagnosis of LQT2 was made. INTERVENTIONS: Next-generation sequencing (NGS) of DNA samples was performed to detect the mutation in the LQTS-related genes on the proband and her mother, which was confirmed by Sanger sequencing. The proband was then implanted with an implantable cardioverter defibrillator and prescribed metoprolol 47.5 mg per day. OUTCOMES: This novel heterozygous mutation results in a frameshift mutation after the 128 residue (Asparagine), which replaced the original 1031 amino acids with 27 novel amino acids (p.N128fsX156). CONCLUSION: This novel mutation presumably resulted in a frameshift mutation, p.N128fsX156. Our data expanded the mutation spectrum of KCNH2 gene and facilitated clinic diagnosis and genetic counseling for this family with LQTS.


Assuntos
Canal de Potássio ERG1/genética , Síndrome do QT Longo/genética , Feminino , Mutação da Fase de Leitura , Sequenciamento de Nucleotídeos em Larga Escala , Humanos , Síndrome do QT Longo/diagnóstico por imagem , Pessoa de Meia-Idade , Deleção de Sequência
2.
Herz ; 45(1): 3-9, 2020 Feb.
Artigo em Alemão | MEDLINE | ID: mdl-31820028

RESUMO

Molecular genetic analysis is an important component in the diagnostics of some cardiovascular diseases; however, genetic testing should not be used as a screening technique as the diagnostic value strongly depends on anamnestic and clinical factors, such as a positive family history and the disease phenotype. In cardiovascular diseases with high mutation detection rates, e.g. hypertrophic cardiomyopathy and primary arrhythmia syndromes (long QT syndrome, catecholaminergic polymorphic ventricular tachycardia) genetic testing should be included in the diagnostic work-up. Family screening of first-degree relatives (cascade screening) is a particularly important application of genetic diagnostics for a timely identification of asymptomatic mutation carriers and initiation of preventive treatment. A molecular autopsy, also known as postmortem molecular genetic DNA testing, is a special indication for genetic diagnostics. It is particularly useful in the analysis of sudden cardiac death victims for the identification of disease-specific gene mutations. Therefore, given a selective use and a thorough evaluation of the test results, molecular genetic analyses can make a meaningful diagnostic and prognostic contribution. Potential applications of genetic analyses in the future are polygenic cardiovascular diseases. The use of new high-throughput technologies enables the analysis of multiple genetic variants, which can then be included in the calculation of a polygenic risk score for the prediction of the probability of a specific disease.


Assuntos
Testes Genéticos , Síndrome do QT Longo , Taquicardia Ventricular , Arritmias Cardíacas/diagnóstico , Arritmias Cardíacas/genética , Morte Súbita Cardíaca , Predisposição Genética para Doença , Humanos , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/genética , Mutação , Taquicardia Ventricular/diagnóstico , Taquicardia Ventricular/genética
3.
Int J Mol Sci ; 20(20)2019 Oct 11.
Artigo em Inglês | MEDLINE | ID: mdl-31614475

RESUMO

Dysfunction of the cardiac sodium channel Nav1.5 (encoded by the SCN5A gene) is associated with arrhythmias and sudden cardiac death. SCN5A mutations associated with long QT syndrome type 3 (LQT3) lead to enhanced late sodium current and consequent action potential (AP) prolongation. Internalization and degradation of Nav1.5 is regulated by ubiquitylation, a post-translational mechanism that involves binding of the ubiquitin ligase Nedd4-2 to a proline-proline-serine-tyrosine sequence of Nav1.5, designated the PY-motif. We investigated the biophysical properties of the LQT3-associated SCN5A-p.Y1977N mutation located in the Nav1.5 PY-motif, both in HEK293 cells as well as in newly generated mice harboring the mouse homolog mutation Scn5a-p.Y1981N. We found that in HEK293 cells, the SCN5A-p.Y1977N mutation abolished the interaction between Nav1.5 and Nedd4-2, suppressed PY-motif-dependent ubiquitylation of Nav1.5, and consequently abrogated Nedd4-2 induced sodium current (INa) decrease. Nevertheless, homozygous mice harboring the Scn5a-p.Y1981N mutation showed no electrophysiological alterations nor changes in AP or (late) INa properties, questioning the in vivo relevance of the PY-motif. Our findings suggest the presence of compensatory mechanisms, with additional, as yet unknown, factors likely required to reduce the "ubiquitylation reserve" of Nav1.5. Future identification of such modulatory factors may identify potential triggers for arrhythmias and sudden cardiac death in the setting of LQT3 mutations.


Assuntos
Substituição de Aminoácidos , Síndrome do QT Longo/genética , Canal de Sódio Disparado por Voltagem NAV1.5/genética , Motivos de Aminoácidos , Animais , Feminino , Técnicas de Introdução de Genes , Células HEK293 , Humanos , Camundongos , Camundongos Transgênicos , Canal de Sódio Disparado por Voltagem NAV1.5/química , Canal de Sódio Disparado por Voltagem NAV1.5/metabolismo , Ubiquitina-Proteína Ligases Nedd4/metabolismo , Ligação Proteica , Ubiquitinação , Adulto Jovem
4.
Zhonghua Er Ke Za Zhi ; 57(9): 700-704, 2019 Sep 02.
Artigo em Chinês | MEDLINE | ID: mdl-31530356

RESUMO

Objective: To analyze and summarize the diagnosis and treatment experience of common inherited cardiac arrhythmia syndrome in pediatric patients, and explore the most appropriate therapy. Methods: A retrospective review identified 30 pediatric cases (19 males, 11 females) diagnosed with long QT syndrome (LQTS), Brugada syndrome (BrS), catecholaminergic polymorphic ventricular tachycardia (CPVT), hypertrophic cardiomyopathy (HCM), arrhythmogenc right ventricular cardiomyopathy (ARVC) from January 2008 to December 2018 in the Pediatric Cardiology Department, Guangdong Provincial People's Hospital. Data obtained included the diagnosis, treatment and follow-up outcome. Results: The most common inherited cardiac arrhythmia syndromes were LQTS (n=14) including 1 case with epilepsy, CPVT (n=5), HCM (n=7), ARVC (n=1), and BrS (n=3). Twenty-seven cases were admitted to hospital due to syncope, whereas the remaining 3 cases of BrS had not presented with syncope before admission. The average onset age of inherited arrhythmia was (10.0±3.3) years. Genetic testing was performed on 20 patients. The median follow-up time was 40 months. Among 15 patients who underwent implantable cardioverter defibrillator (ICD) and survived, 2 patients had frequent ICD discharge. One patient underwent radiofrequency ablation, and the other one received left cardiac sympathetic denervation and an increased ICD defibrillation threshold, and the number of ICD discharge was significantly reduced. Among 10 patients who received drug therapy, 4 patients including two patients who discontinued treatment without advices died. Two patients whose parents refused treatment died, 1 case diagnosed with unexplained sudden cerebral death, and the remaining 2 cases without indication for drug therapy survived without any treatment. Conclusions: Mortality rate is high in pediatric patients with inherited cardiac arrhythmia and syncope. The therapeutic effect of drugs are not satisfactory, ICD implantation is the most effective treatment to prevent sudden cardiac death currently, but the postoperative frequent discharge should be brought to the forefront and handled in time.


Assuntos
Displasia Arritmogênica Ventricular Direita/genética , Síndrome de Brugada/genética , Cardiomiopatia Hipertrófica/genética , Síndrome do QT Longo/genética , Taquicardia Ventricular/genética , Arritmias Cardíacas , Displasia Arritmogênica Ventricular Direita/diagnóstico , Displasia Arritmogênica Ventricular Direita/mortalidade , Displasia Arritmogênica Ventricular Direita/terapia , Síndrome de Brugada/diagnóstico , Síndrome de Brugada/mortalidade , Síndrome de Brugada/terapia , Cardiomiopatia Hipertrófica/diagnóstico , Cardiomiopatia Hipertrófica/mortalidade , Cardiomiopatia Hipertrófica/terapia , Criança , Morte Súbita Cardíaca , Desfibriladores Implantáveis , Feminino , Seguimentos , Testes Genéticos , Humanos , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/mortalidade , Síndrome do QT Longo/terapia , Masculino , Estudos Retrospectivos , Síncope , Taquicardia Ventricular/diagnóstico , Taquicardia Ventricular/mortalidade , Taquicardia Ventricular/terapia , Resultado do Tratamento
5.
PLoS Genet ; 15(8): e1008288, 2019 08.
Artigo em Inglês | MEDLINE | ID: mdl-31393878

RESUMO

Neuronal physiology is particularly sensitive to acute stressors that affect excitability, many of which can trigger seizures and epilepsies. Although intrinsic neuronal homeostasis plays an important role in maintaining overall nervous system robustness and its resistance to stressors, the specific genetic and molecular mechanisms that underlie these processes are not well understood. Here we used a reverse genetic approach in Drosophila to test the hypothesis that specific voltage-gated ion channels contribute to neuronal homeostasis, robustness, and stress resistance. We found that the activity of the voltage-gated potassium channel seizure (sei), an ortholog of the mammalian ERG channel family, is essential for protecting flies from acute heat-induced seizures. Although sei is broadly expressed in the nervous system, our data indicate that its impact on the organismal robustness to acute environmental stress is primarily mediated via its action in excitatory neurons, the octopaminergic system, as well as neuropile ensheathing and perineurial glia. Furthermore, our studies suggest that human mutations in the human ERG channel (hERG), which have been primarily implicated in the cardiac Long QT Syndrome (LQTS), may also contribute to the high incidence of seizures in LQTS patients via a cardiovascular-independent neurogenic pathway.


Assuntos
Proteínas de Drosophila/genética , Resposta ao Choque Térmico/genética , Canais de Potássio de Abertura Dependente da Tensão da Membrana/genética , Convulsões/genética , Regulador Transcricional ERG/genética , Animais , Animais Geneticamente Modificados , Drosophila , Proteínas de Drosophila/metabolismo , Técnicas de Silenciamento de Genes , Incidência , Síndrome do QT Longo/complicações , Síndrome do QT Longo/genética , Neurônios/metabolismo , Canais de Potássio de Abertura Dependente da Tensão da Membrana/metabolismo , Genética Reversa , Convulsões/epidemiologia , Regulador Transcricional ERG/metabolismo
6.
Pediatr Cardiol ; 40(7): 1419-1430, 2019 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-31440766

RESUMO

Long QT syndrome (LQTS) is an inherited primary arrhythmia syndrome that may present with malignant arrhythmia and, rarely, risk of sudden death. The clinical symptoms include palpitations, syncope, and anoxic seizures secondary to ventricular arrhythmia, classically torsade de pointes. This predisposition to malignant arrhythmia is from a cardiac ion channelopathy that results in delayed repolarization of the cardiomyocyte action potential. The QT interval on the surface electrocardiogram is a summation of the individual cellular ventricular action potential durations, and hence is a surrogate marker of the abnormal cellular membrane repolarization. Severely affected phenotypes administered current standard of care therapies may not be fully protected from the occurrence of cardiac arrhythmias. There are 17 different subtypes of LQTS associated with monogenic mutations of 15 autosomal dominant genes. It is now possible to model the various LQTS phenotypes through the generation of patient-specific induced pluripotent stem cell-derived cardiomyocytes. RNA interference can silence or suppress the expression of mutant genes. Thus, RNA interference can be a potential therapeutic intervention that may be employed in LQTS to knock out mutant mRNAs which code for the defective proteins. CRISPR/Cas9 is a genome editing technology that offers great potential in elucidating gene function and a potential therapeutic strategy for monogenic disease. Further studies are required to determine whether CRISPR/Cas9 can be employed as an efficacious and safe rescue of the LQTS phenotype. Current progress has raised opportunities to generate in vitro human cardiomyocyte models for drug screening and to explore gene therapy through genome editing.


Assuntos
Síndrome do QT Longo/genética , Eletrocardiografia , Ventrículos do Coração/fisiopatologia , Humanos , Células-Tronco Pluripotentes Induzidas/metabolismo , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/metabolismo , Mutação , Miócitos Cardíacos/metabolismo
7.
Int Heart J ; 60(5): 1189-1191, 2019 Sep 27.
Artigo em Inglês | MEDLINE | ID: mdl-31447465

RESUMO

The first onset of cardiac event of long QT syndrome (LQTS) was at young age and caused by emotional or physical triggers. We presented a 64-year-old woman who experienced recurrent ventricular arrhythmia after hemodialysis initiation because of end-stage renal disease. Persistent prolonged QTc interval and diagnosis of inherited LQT2 were missed at her first 3 years of hemodialysis. The patient was beta-blocker nonresponder for ventricular arrhythmias suppression and experienced multiple ICD discharge. We reported an inherited LQT2 case with uncommon clinical manifestations and the successful experience of mexiletine use in such a patient.


Assuntos
Falência Renal Crônica/terapia , Síndrome do QT Longo/genética , Mexiletina/uso terapêutico , Diálise Renal/efeitos adversos , Taquicardia Ventricular/tratamento farmacológico , Taquicardia Ventricular/etiologia , Antiarrítmicos/uso terapêutico , Eletrocardiografia/métodos , Feminino , Seguimentos , Humanos , Falência Renal Crônica/complicações , Falência Renal Crônica/diagnóstico , Síndrome do QT Longo/diagnóstico , Pessoa de Meia-Idade , Doenças Raras , Recidiva , Diálise Renal/métodos , Medição de Risco , Taquicardia Ventricular/diagnóstico , Resultado do Tratamento
8.
Int Heart J ; 60(5): 1083-1090, 2019 Sep 27.
Artigo em Inglês | MEDLINE | ID: mdl-31447468

RESUMO

Contemporary studies have identified rs10494366 in the nitric oxide synthase 1 adaptor protein (NOS1AP) gene as a new genetic marker in modulating the QT interval and sudden cardiac death (SCD) in general populations. However, the conclusions were not coincident. Therefore, we conducted for the first time a system evaluation of the relativity of rs10494366, the QT interval, and sudden death by meta-analysis. In our study, the meta-analysis displayed the GG genotype of rs10494366 correlated with the QT interval in women with no heterogeneity, and in diabetes mellitus (DM) patients with minor heterogeneity. In the Caucasian population, the correlation of rs10494366 and sudden death was significant. The heterogeneity referred to the relevance between rs10494366 and sudden death in the Asian population. In conclusion, the minor allele of rs10494366 may have an impact on the QT interval in women or DM patients and may have a potential role in sudden death in the Caucasian population.


Assuntos
Proteínas Adaptadoras de Transdução de Sinal/genética , Morte Súbita Cardíaca/epidemiologia , Predisposição Genética para Doença/epidemiologia , Síndrome do QT Longo/genética , Síndrome do QT Longo/mortalidade , Polimorfismo de Nucleotídeo Único/genética , Alelos , Grupo com Ancestrais do Continente Asiático/genética , China , Morte Súbita Cardíaca/etnologia , Eletrocardiografia , Feminino , Genótipo , Humanos , Masculino , Análise de Sobrevida
9.
Pediatr Int ; 61(9): 852-858, 2019 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-31283864

RESUMO

BACKGROUND: Human calmodulin (CALM) gene mutation has been reported to be related to inherited arrhythmia syndromes, but the genotype-phenotype relationship remains unclear. METHODS AND RESULTS: We report here a 4-year-old boy who had cardiac arrest while playing in a kindergarten playground. Cardiopulmonary resuscitation was initiated immediately. Eleven minutes after the cardiac arrest, ambulance crews arrived and an automated external defibrillator was attached. His heart rhythm, which was ventricular fibrillation (VF), was returned to sinus rhythm after only one shock delivery. The boy was brought to hospital by air ambulance. During transfer, electrocardiogram (ECG) showed transient VF. On arrival, chest radiograph showed a cardiothoracic ratio of 55% without pulmonary congestion. A 12-lead ECG showed a normal sinus rhythm, biphasic T wave, and prolongation of the corrected QT interval. On ECG, VF was preceded by torsade de pointes or frequent polymorphic premature ventricular contractions (PVC). Echocardiography showed a normal heart structure with decreased cardiac function. On the second day of hospitalization, ECG showed remarkable QT prolongation, T-wave alternans, and frequent PVC. Thereafter, propranolol was started. The ECG showed rapid improvement of QT prolongation and T-wave abnormality. Genetic test indicated a CALM2 mutation, and he was diagnosed with long QT syndrome-15 (LQT15). CONCLUSIONS: CALM mutations cause long QT syndrome (LQTS), catecholaminergic polymorphic ventricular tachycardia (CPVT) and idiopathic VF. This patient with a CALM2 p.N98S mutation had both phenotypes of LQTS and CPVT.


Assuntos
Calmodulina/genética , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/genética , Mutação , Pré-Escolar , Marcadores Genéticos , Humanos , Masculino
10.
Elife ; 82019 07 22.
Artigo em Inglês | MEDLINE | ID: mdl-31329101

RESUMO

Upon membrane depolarization, the KCNQ1 potassium channel opens at the intermediate (IO) and activated (AO) states of the stepwise voltage-sensing domain (VSD) activation. In the heart, KCNQ1 associates with KCNE1 subunits to form IKs channels that regulate heart rhythm. KCNE1 suppresses the IO state so that the IKs channel opens only to the AO state. Here, we tested modulations of human KCNQ1 channels by an activator ML277 in Xenopus oocytes. It exclusively changes the pore opening properties of the AO state without altering the IO state, but does not affect VSD activation. These observations support a distinctive mechanism responsible for the VSD-pore coupling at the AO state that is sensitive to ML277 modulation. ML277 provides insights and a tool to investigate the gating mechanism of KCNQ1 channels, and our study reveals a new strategy for treating long QT syndrome by specifically enhancing the AO state of native IKs currents.


Assuntos
Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/tratamento farmacológico , Canais de Potássio de Abertura Dependente da Tensão da Membrana/genética , Animais , Membrana Celular/genética , Membrana Celular/fisiologia , Polaridade Celular/genética , Humanos , Síndrome do QT Longo/genética , Síndrome do QT Longo/patologia , Oócitos/efeitos dos fármacos , Oócitos/crescimento & desenvolvimento , Piperidinas/farmacologia , Potássio/metabolismo , Tiazóis/farmacologia , Compostos de Tosil/farmacologia , Xenopus/genética
11.
Int Heart J ; 60(4): 979-982, 2019 Jul 27.
Artigo em Inglês | MEDLINE | ID: mdl-31257342

RESUMO

Congenital long QT syndrome (LQTS) is a cardiac channelopathy that leads to the prolongation of the QT interval. This prolongation can lead to ventricular tachyarrhythmia, syncope, and sudden cardiac death. There are various types of LQTS. Treatment of LQT1 and LQT2 is mainly based on antiadrenergic therapy. LQT3, on the other hand, is a result of a mutation of the SCN5A gene, which encodes the sodium channels. In this type, patients are sensitive to vagal stimuli and episodes tend to occur at rest. Sodium channel blocking compounds, such as ranolazine, mexiletine, and flecainide, have been found to be effective in selective mutations.In this case report, we report the case of a child with congenital LQT3 (V411M) who presented first with sudden cardiac death and three weeks later with an implantable cardioverter defibrillator storm. Knowing the specific mutation and understanding the mechanism at the molecular level through an in vitro study yielded a clinically meaningful result. The patient's arrhythmia burden was totally eliminated following successful treatment with flecainide.


Assuntos
DNA/genética , Eletrocardiografia , Flecainida/uso terapêutico , Síndrome do QT Longo/tratamento farmacológico , Mutação , Canal de Sódio Disparado por Voltagem NAV1.5/genética , Criança , Análise Mutacional de DNA , Feminino , Humanos , Síndrome do QT Longo/diagnóstico , Síndrome do QT Longo/genética , Canal de Sódio Disparado por Voltagem NAV1.5/metabolismo , Bloqueadores do Canal de Sódio Disparado por Voltagem/uso terapêutico
13.
Eur J Med Genet ; 62(7): 103648, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30998997

RESUMO

CANAC1C encodes for the main cardiac L-type calcium channel and mutations on it lead to a prolonged QT interval in Timothy Syndrome (TS). We provide a new de novo constitutional heterozygote missense variation in CACNA1C in a living adult woman, also carrier of the known c.2146-1G>C heterozygous variation of PKP2 inherited from her father. To our knowledge, this patient is the first to have the two variations in these genes. Theses clinical and molecular findings expand the clinical and molecular spectrum of TS and show the interest of next generation sequencing or whole exome sequencing in rare disorders, atypical or novel phenotype.


Assuntos
Transtorno Autístico/genética , Canais de Cálcio Tipo L/genética , Síndrome do QT Longo/genética , Fenótipo , Sindactilia/genética , Adulto , Transtorno Autístico/patologia , Feminino , Heterozigoto , Humanos , Síndrome do QT Longo/patologia , Mutação , Placofilinas/genética , Sindactilia/patologia
14.
Can J Cardiol ; 35(4): 511-522, 2019 04.
Artigo em Inglês | MEDLINE | ID: mdl-30935642

RESUMO

The slow delayed rectifier potassium current (IKs) significantly contributes to cardiac repolarization under specific conditions, particularly at stimulation by the protein kinase A (PKA) during increased sympathetic tone. Impaired PKA-mediated stimulation of IKs channels may considerably aggravate dysfunction of the channels induced by mutations in the KCNQ1 gene that encodes the structure of the α-subunit of IKs channels. These mutations are associated with several subtypes of inherited arrhythmias, mainly long QT syndrome type 1, less commonly short QT syndrome type 2, and atrial fibrillation. The impaired PKA reactivity of IKs channels may significantly increase the risk of arrhythmia in these patients. Unfortunately, only approximately 2.7% of the KCNQ1 variants identified as putatively clinically significant have been studied with respect to this problem. This review summarizes the current knowledge in the field to stress the importance of the PKA-mediated regulation of IKs channels, and to appeal for further analysis of this regulation in KCNQ1 mutations associated with inherited arrhythmogenic syndromes. On the basis of the facts summarized in our review, we suggest several new regions of the α-subunit of the IKs channels as potential contributors to PKA stimulation, namely the S4 and S5 segments, and the S2-S3 and S4-S5 linkers. Deeper knowledge of mechanisms of the impaired PKA response in mutated IKs channels may help to better understand this regulation, and may improve risk stratification and management of patients suffering from related pathologies.


Assuntos
Proteínas Quinases Dependentes de AMP Cíclico/fisiologia , Canais de Potássio de Retificação Tardia/fisiologia , Síndrome do QT Longo/fisiopatologia , Receptores Adrenérgicos beta/fisiologia , Sistema de Condução Cardíaco/fisiologia , Humanos , Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/genética , Mutação , Fosforilação
15.
Rev. esp. cardiol. (Ed. impr.) ; 72(4): 324-332, abr. 2019. ilus, tab, graf
Artigo em Espanhol | IBECS | ID: ibc-187898

RESUMO

Introducción y objetivos: En 4 miembros de una familia española se identificó una mutación en los canales cardiacos Nav1.5 (p.R1644H) descrita ya y relacionada con el síndrome de QT largo con anterioridad. Sin embargo, solo 1 de los portadores presentaba el intervalo QT prolongado. En los otros 3 individuos se identificó una nueva mutación con cambio de sentido en los canales cardiacos Cav1.2 (p.S1961N). En este trabajo se analizaron las características funcionales de los canales p.S1961N Cav1.2 para averiguar si dicha mutación regula la expresividad del síndrome de QT largo en esta familia. Métodos: La corriente de calcio tipo L (ICaL) se registró mediante la técnica de patch-clamp en células de ovario de hámster chino transfectadas transitoriamente con los canales cardiacos humanos en su forma nativa o mutada. Resultados: La expresión de canales p.S1961N disminuye significativamente la densidad de la ICaL. Al sustituir el ion calcio por bario para suprimir la inactivación dependiente del calcio de los canales Cav1.2, se demostró que la mutación acelera significativamente la inactivación dependiente del voltaje de los canales Cav1.2 y disminuye la constante de tiempo de inactivación. Como consecuencia, la carga total que atraviesa los canales p.S1961N Cav1.2 disminuye significativamente. Los efectos que las mutaciones p.S1961N Cav1.2 y p.R1644H Nav1.5, por separado o en combinación, producen sobre las características de los potenciales de acción (PA) se simularon mediante un modelo matemático de PA ventriculares humanos. Los resultados demuestran que la mutación p.S1961N Cav1.2 abrevia la duración del PA y suprime la prolongación inducida por la mutación p.R1644H de los canales Nav1.5. Conclusiones: La mutación p.S1961N en los canales Cav1.2 disminuye la ICaL, un efecto que podría abreviar la duración de los PA ventriculares humanos. La presencia de esta mutación que disminuye la función de los canales Cav1.2 compensa funcionalmente los efectos producidos por la mutación de los canales Nav1.5 que aumenta su función y prolonga la duración de los PA


Introduction and objectives: A known long QT syndrome-related mutation in Nav1.5 cardiac channels (p.R1644H) was found in 4 members of a Spanish family but only 1 of them showed prolongation of the QT interval. In the other 3 relatives, a novel missense mutation in Cav1.2 cardiac channels was found (p.S1961N). Here, we functionally analyzed p.S1961N Cav1.2 channels to elucidate whether this mutation regulates the expressivity of the long QT syndrome phenotype in this family. Methods: L-type calcium current (ICaL) recordings were performed by using the whole-cell patch-clamp technique in Chinese hamster ovary cells transiently transfected with native and/or p.S1961N Cav1.2 channels. Results: Expression of p.S1961N channels significantly decreased ICaL density. Using Ba as a charge carrier to suppress the Ca-dependent inactivation of Cav1.2 channels, we demonstrated that the mutation significantly accelerates the voltage-dependent inactivation of Cav1.2 channels decreasing the inactivation time constant. As a consequence, the total charge flowing through p.S1961N Cav1.2 channels significantly decreased. The effects of the p.S1961N Cav1.2 and p.R1644H Nav1.5 mutations alone or their combination on the action potential (AP) morphology were simulated using a validated model of the human ventricular AP. The p.S1961N Cav1.2 mutation shortens the AP duration and abrogates the prolongation induced by p.R1644H Nav1.5 channels. Conclusions: The p.S1961N mutation in Cav1.2 channels decreased the ICaL, an effect which might shorten ventricular AP. The presence of the loss-of-function Cav1.2 mutation could functionally compensate the prolonging effects produced by the Nav1.5 gain-of-function mutation


Assuntos
Humanos , Masculino , Feminino , Adolescente , Adulto , Pessoa de Meia-Idade , Síndrome do QT Longo/genética , Heterozigoto , Transfecção/métodos , Mutagênese/genética , Canalopatias/genética , Canal de Sódio Disparado por Voltagem NAV1.1/genética , Canal de Sódio Disparado por Voltagem NAV1.5/genética , Doenças Genéticas Inatas , Mutação/genética , Eletrocardiografia/estatística & dados numéricos , Testes Genéticos/métodos , Técnicas de Patch-Clamp/métodos , Morte Súbita Cardíaca
16.
JAMA Cardiol ; 4(3): 246-254, 2019 03 01.
Artigo em Inglês | MEDLINE | ID: mdl-30758498

RESUMO

Importance: Long QT syndrome (LQTS) is caused by several ion channel genes, yet risk of arrhythmic events is not determined solely by the responsible gene pathogenic variants. Female sex after adolescence is associated with a higher risk of arrhythmic events in individuals with congenital LQTS, but the association between sex and genotype-based risk of LQTS is still unclear. Objective: To examine the association between sex and location of the LQTS-related pathogenic variant as it pertains to the risk of life-threatening arrhythmias. Design, Setting, and Participants: This retrospective observational study enrolled 1124 genotype-positive patients from 11 Japanese institutions from March 1, 2006, to February 28, 2013. Patients had LQTS type 1 (LQT1), type 2 (LQT2), and type 3 (LQT3) (616 probands and 508 family members), with KCNQ1 (n = 521), KCNH2 (n = 487) and SCN5A (n = 116) genes. Clinical characteristics such as age at the time of diagnosis, sex, family history, cardiac events, and several electrocardiographic measures were collected. Statistical analysis was conducted from January 18 to October 10, 2018. Main Outcomes and Measures: Sex difference in the genotype-specific risk of congenital LQTS. Results: Among the 1124 patients (663 females and 461 males; mean [SD] age, 20 [15] years) no sex difference was observed in risk for arrhythmic events among those younger than 15 years; in contrast, female sex was associated with a higher risk for LQT1 and LQT2 among those older than 15 years. In patients with LQT1, the pathogenic variant of the membrane-spanning site was associated with higher risk of arrhythmic events than was the pathogenic variant of the C-terminus of KCNQ1 (HR, 1.60; 95% CI, 1.19-2.17; P = .002), although this site-specific difference in the incidence of arrhythmic events was observed in female patients only. In patients with LQT2, those with S5-pore-S6 pathogenic variants in KCNH2 had a higher risk of arrhythmic events than did those with others (HR, 1.88; 95% CI, 1.44-2.44; P < .001). This site-specific difference in incidence, however, was observed in both sexes. Regardless of the QTc interval, however, female sex itself was associated with a significantly higher risk of arrhythmic events in patients with LQT2 after puberty (106 of 192 [55.2%] vs 19 of 94 [20.2%]; P < .001). In patients with LQT3, pathogenic variants in the S5-pore-S6 segment of the Nav1.5 channel were associated with lethal arrhythmic events compared with others (HR, 4.2; 95% CI, 2.09-8.36; P < .001), but no sex difference was seen. Conclusions and Relevance: In this retrospective analysis, pathogenic variants in the pore areas of the channels were associated with higher risk of arrhythmic events than were other variants in each genotype, while sex-associated differences were observed in patients with LQT1 and LQT2 but not in those with LQT3. The findings of this study suggest that risk for cardiac events in LQTS varies according to genotype, variant site, age, and sex.


Assuntos
Arritmias Cardíacas/genética , Síndrome do QT Longo/congênito , Síndrome do QT Longo/genética , Síndrome do QT Longo/fisiopatologia , Adolescente , Adulto , Arritmias Cardíacas/diagnóstico , Arritmias Cardíacas/epidemiologia , Arritmias Cardíacas/fisiopatologia , Criança , Pré-Escolar , Canal de Potássio ERG1/genética , Feminino , Genótipo , Humanos , Incidência , Japão/epidemiologia , Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/epidemiologia , Masculino , Estudos Retrospectivos , Fatores de Risco , Caracteres Sexuais , Adulto Jovem
17.
Iran Biomed J ; 23(3): 228-34, 2019 05.
Artigo em Inglês | MEDLINE | ID: mdl-30797226

RESUMO

Background: Long QT syndrome (LQTS) is characterized by the prolongation of QT interval, which results in syncope and sudden cardiac death in young people. KCNQ1 is the most common gene responsible for this syndrome. Methods: Molecular investigation was performed by DNA Sanger sequencing in Iranian families with a history of syncope. In silico examinations were performed for predicting the pathogenicity of the novel variant. Results: A novel homozygous KCNQ1 frameshift mutation, c.1426_1429delATGC (M476Pfs*4), was identified, and then the current literatures of five patients were reviewed regarding the LQTS. Conclusion: The novel frameshift mutation has been reported for the first time among the Iranian population. Our finding along with the case series study of LQTS patients illustrates the importance of genetic and case series in precise detection of the frequency of LQTS carriers.


Assuntos
Mutação da Fase de Leitura/genética , Predisposição Genética para Doença , Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/genética , Sequência de Bases , Eletrocardiografia , Feminino , Humanos , Irã (Geográfico) , Síndrome do QT Longo/diagnóstico por imagem , Masculino , Linhagem
18.
Int J Mol Med ; 43(3): 1253-1262, 2019 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30628647

RESUMO

Congenital long QT syndrome (LQTS) is a cardiac channelopathy that often results in fatal arrhythmias. LQTS mutations not only lead to abnormal myocardial electrical activities but are associated with heart contraction abnormalities, cardiomyopathy and congenital heart defects. In vivo and in vitro studies have found that LQTS mutations are associated with cardiomyocyte apoptosis, cardiac developmental disorders and even embryonic mortality. Cardiac delayed rectifier potassium channel dysfunction due to the human ether­à­go­go­related gene (hERG) mutation causes congenital LQTS type 2. The majority of LQTS 2 mutations are characterized by mutant protein accumulation in the endoplasmic reticulum (ER). Unfolded or misfolded protein retention in the ER causes an unfolded protein reaction, which is characteristic of ER stress (ERS). Therefore, the present study hypothesized that LQTS mutations can cause cardiac structural abnormalities via ERS­mediated cardiomyocyte apoptosis. To test this hypothesis, 293 cells were transiently transfected with an L539fs/47­hERG plasmid to generate an LQTS 2 model. L539fs/47­hERG is an LQTS 2 mutation, which consists of a 19­bp deletion at 1619­1637 and a point mutation at 1692. Using confocal laser scanning microscopy analysis, it was verified that the L539fs/47­hERG protein was retained in the ER. Hoechst 33342 apoptosis staining indicated that apoptosis was increased in the L539fs/47­hERG­transfected cells, and this be reversed by treatment with 4­phenyl butyric acid. Western blot analysis revealed increased expression levels of the ERS chaperone glucose regulated protein 78 and pro­apoptotic ERS­induced factors, including protein kinase R­like endoplasmic reticulum kinase, eukaryotic translation­initiation factor­2α and C/EBP homologous protein, in the L539fs/47­hERG­transfected cells. The B­cell lymphoma (Bcl­2)­associated X protein/Bcl­2 ratio and caspase­12 were also increased in the mutated cells. These results demonstrate that L539fs/47­hERG induces cell apoptosis and the potential molecular mechanism involves the activation of ERS and ERS­mediated cell apoptosis.


Assuntos
Apoptose/genética , Estresse do Retículo Endoplasmático/genética , Mutação , Substituição de Aminoácidos , Sequência de Bases , Retículo Endoplasmático/genética , Retículo Endoplasmático/metabolismo , Células HEK293 , Humanos , Síndrome do QT Longo/genética , Síndrome do QT Longo/metabolismo , Modelos Biológicos , Análise de Sequência de DNA , Regulador Transcricional ERG/química , Regulador Transcricional ERG/genética , Regulador Transcricional ERG/metabolismo , Resposta a Proteínas não Dobradas
19.
Curr Opin Cardiol ; 34(1): 46-56, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30394905

RESUMO

PURPOSE OF REVIEW: Our purpose is to provide an update on the new clinical and genetic aspects of long QT syndrome (LQTS). LQTS is the most common channelopathy and a cause of syncope and sudden death in the young. Although there are 17 types of LQTS, most patients have types 1 or 2 which are due to mutations in KCNQ1 and KCNH2 (encoding for the cardiac potassium channels), and type 3 which is due to a mutation in SCN5A (encoding for the sodium channel). LQTS is characterized by incomplete penetrance and variable expressivity. Significant data exist concerning the common types of LQTS and include mutational location, biophysical function, gene-specific triggers, and disease modifiers that are known and help characterize the disease. RECENT FINDINGS: Recent studies support the use of ß-blockers in LQTS. Nadolol and propranolol are superior likely because of their sodium channel blocking effects. There are recent data supporting the use of ß-blockers in LQTS type 3 in which their use was once discouraged. There are increasing data that left cardiac sympathetic denervation is effective in LQTS and should be considered before an implantable cardioverter defibrillator is implanted. SUMMARY: LQTS is a model for effective collaboration between clinicians and basic scientists and between cardiologists and geneticists. Recent advances in the derivation of induced pluripotent stem cells from LQTS patients and creation of genetically engineered human models using clusters of regularly interspaced palindromic repeats (CRISPR/Cas9) will advance translational arrhythmia research and move us toward the goal of personalized medicine.


Assuntos
Canal de Potássio KCNQ1 , Síndrome do QT Longo , Medicina de Precisão , Antagonistas Adrenérgicos beta/uso terapêutico , Canal de Potássio ERG1/genética , Canais de Potássio Éter-A-Go-Go , Humanos , Canal de Potássio KCNQ1/genética , Síndrome do QT Longo/genética , Síndrome do QT Longo/terapia , Mutação
20.
J Hum Genet ; 64(3): 233-238, 2019 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30542207

RESUMO

Long QT syndrome (LQTS) is a rare inherited arrhythmia disease characterized by a prolonged QT interval on 12-lead electrocardiograms. It is the crucial factor to induce syncope, ventricular fibrillation, and even sudden cardiac death. Previous studies have proved that mutations of ion channels-related genes play an important role in LQTS patients. In this study, we enrolled a Chinese family with LQTS and syncope. With the help of whole-exome sequencing, we identified a novel nonsense mutation (c.439C>T/p.Q147X) of Ring Finger Protein 207 (RNF207) in this family. The novel mutation, resulting in a premature stop codon in exon 4 of the RNF207 gene, co-segregated with the affected individuals. Bioinformatics analysis and real-time PCR further proved that the newly identified mutation might induce nonsense-mediated mRNA decay. In mutation carriers, the level of RNF207 mRNA expression was much lower than controls, which may affect potassium channel KCNH2 and lead to LQTS and syncope. In this research, we reported a rare novel mutation of RNF207 in LQTS and syncope patients which further supports the significant role of RNF207 in potassium channel activation and expanded the spectrum of RNF207 mutations. These data may contribute to the genetic diagnosis and counseling of families with LQTS and syncope.


Assuntos
Grupo com Ancestrais do Continente Asiático/genética , Códon sem Sentido , Exoma , Síndrome do QT Longo/genética , Ubiquitina-Proteína Ligases/genética , Sequenciamento Completo do Exoma/métodos , Adolescente , Adulto , Idoso de 80 Anos ou mais , Criança , Feminino , Humanos , Síndrome do QT Longo/patologia , Masculino , Pessoa de Meia-Idade , Linhagem
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA