Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 806
Filtrar
1.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 36(12): 1191-1194, 2019 Dec 10.
Artigo em Chinês | MEDLINE | ID: mdl-31813145

RESUMO

OBJECTIVE: To explore the genetic basis of a pedigree affected with oculodentodigital dysplasia. METHODS: Genomic DNA was extracted from peripheral blood or amniotic fluid samples derived from the pedigree. Exon 2 of the GJA1 gene was amplified for sequencing. RESULTS: Two pedigree members were found to carry heterozygous missense variation of the GJA1 gene, c.221A>C (p.H74P). CONCLUSION: The missense c.221A>C variation of the GJA1 gene probably underlies the oculodentodigital dysplasia in this pedigree.


Assuntos
Conexina 43/genética , Anormalidades Craniofaciais/genética , Anormalidades do Olho/genética , Deformidades Congênitas do Pé/genética , Sindactilia/genética , Anormalidades Dentárias/genética , Humanos , Mutação , Linhagem
2.
BMC Med Genet ; 20(1): 203, 2019 12 23.
Artigo em Inglês | MEDLINE | ID: mdl-31870337

RESUMO

BACKGROUND: Synpolydactyly type 1 (SPD1), also known as syndactyly type II, is an autosomal dominant limb deformity generally results in webbing of 3rd and 4th fingers, duplication of 4th or 5th toes. It is most commonly caused by mutation in HOXD13 gene. In this study, a five-generation Chinese family affected with SPD1 disease were collected. We tried to identify the pathogenic variations associated with SPD1 involved in the family. METHODS: We used the whole genome sequencing (WGS) to identify the pathogenic variant in this family which was later confirmed by PCR-Sanger sequencing. The genetic variation were evaluated with the frequencies in the 1000 Genome Project and Exome Aggregation Consortium (ExAC) dataset. The significance of variants were assessed using different mutation predictor softwares like Mutation Taster, PROVEAN and SIFT. The classification of variants was assessed according to American College of Medical Genetics and Genomics (ACMG) guidelines. RESULTS: Our results showed the mutation of 24-base pair duplication (c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC) in exon one of HOXD13 in heterozygous form which was predicted to result in eight extra alanine (A) residues in N-terminal domain of HOXD13 protein. The mutation was detected in all affected members of the family. CONCLUSION: Based on our mutation analysis of variant c.183_206dupAGCGGCGGCTGCGGCGGCGGCGGC in HOXD13 and its cosegregation in all affected family members, we found this variant as likely pathogenic to this SPD1 family. Our study highlights variable expressivity of HOXD13 mutation. Our results also widen the spectrum of HOXD13 mutation responsible for SPD1.


Assuntos
Duplicação Gênica , Heterozigoto , Proteínas de Homeodomínio/genética , Mutação , Sindactilia/genética , Fatores de Transcrição/genética , Criança , China , Éxons , Feminino , Humanos , Masculino , Linhagem
3.
Zhonghua Yi Xue Yi Chuan Xue Za Zhi ; 36(10): 1010-1014, 2019 Oct 10.
Artigo em Chinês | MEDLINE | ID: mdl-31598948

RESUMO

OBJECTIVE: To explore the genetic basis for a child with developmental delay and congenital syndactyly. METHODS: G-banding chromosomal karyotyping and chromosomal microarray analysis (CMA) were performed on peripheral blood sample from the child. RESULTS: The child was ascertained as 46, XY, r(18)[52]/45,XY,?18[3]. A 18q21.32-q23 deletion was identified by CMA with a size of 19.85 Mb, which has encompassed 99 genes including CTDP1, TXNL4A, TSHZ1, PIGN, RTTN, TNFRSF11A, KDSR and CYB5A. CONCLUSION: Clinical phenotype of the patient with ring chromosome 18 is associated with the size of the euchromatin loss and involved genes. As a useful complement to conventional karyotyping, CMA has provided an powerful tool for delineating complex chromosomal aberrations.


Assuntos
Aberrações Cromossômicas , Deficiências do Desenvolvimento/genética , Sindactilia/genética , Criança , Cromossomos Humanos Par 18/genética , Citogenética , Humanos , Cariotipagem , Cromossomos em Anel
4.
Nature ; 574(7777): 249-253, 2019 10.
Artigo em Inglês | MEDLINE | ID: mdl-31578523

RESUMO

The integrity of the mammalian epidermis depends on a balance of proliferation and differentiation in the resident population of stem cells1. The kinase RIPK4 and the transcription factor IRF6 are mutated in severe developmental syndromes in humans, and mice lacking these genes display epidermal hyperproliferation and soft-tissue fusions that result in neonatal lethality2-5. Our understanding of how these genes control epidermal differentiation is incomplete. Here we show that the role of RIPK4 in mouse development requires its kinase activity; that RIPK4 and IRF6 expressed in the epidermis regulate the same biological processes; and that the phosphorylation of IRF6 at Ser413 and Ser424 primes IRF6 for activation. Using RNA sequencing (RNA-seq), histone chromatin immunoprecipitation followed by sequencing (ChIP-seq) and assay for transposase-accessible chromatin using sequencing (ATAC-seq) of skin in wild-type and IRF6-deficient mouse embryos, we define the transcriptional programs that are regulated by IRF6 during epidermal differentiation. IRF6 was enriched at bivalent promoters, and IRF6 deficiency caused defective expression of genes that are involved in the metabolism of lipids and the formation of tight junctions. Accordingly, the lipid composition of the stratum corneum of Irf6-/- skin was abnormal, culminating in a severe defect in the function of the epidermal barrier. Collectively, our results explain how RIPK4 and IRF6 function to ensure the integrity of the epidermis and provide mechanistic insights into why developmental syndromes that are characterized by orofacial, skin and genital abnormalities result when this axis goes awry.


Assuntos
Diferenciação Celular , Células Epidérmicas/citologia , Epiderme/fisiologia , Fatores Reguladores de Interferon/metabolismo , Proteínas Serina-Treonina Quinases/metabolismo , Transdução de Sinais , Anormalidades Múltiplas/genética , Animais , Fenda Labial/genética , Fissura Palatina/genética , Cistos/genética , Embrião de Mamíferos/citologia , Embrião de Mamíferos/embriologia , Embrião de Mamíferos/metabolismo , Células Epidérmicas/metabolismo , Epiderme/embriologia , Anormalidades do Olho/genética , Feminino , Dedos/anormalidades , Regulação da Expressão Gênica , Fatores Reguladores de Interferon/deficiência , Fatores Reguladores de Interferon/genética , Joelho/anormalidades , Articulação do Joelho/anormalidades , Lábio/anormalidades , Metabolismo dos Lipídeos/genética , Deformidades Congênitas das Extremidades Inferiores/genética , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Fosforilação , Fosfosserina/metabolismo , Proteínas Serina-Treonina Quinases/genética , Sindactilia/genética , Anormalidades Urogenitais/genética
5.
J Hum Genet ; 64(9): 885-890, 2019 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-31270375

RESUMO

Pediatric hypertension can cause hypertensive emergencies, including hemorrhagic stroke, contributing to rare but serious childhood morbidity and mortality. Renovascular hypertension (RVH) is one of the major causes of secondary hypertension in children. Grange syndrome (MIM#602531) is a rare disease characterized by multiple stenosis or occlusion of the renal, abdominal, coronary, and cerebral arteries, which can cause phenotypes of RVH and fibromuscular dysplasia (MIM#135580). We report the case of a 7-year-old girl with Grange syndrome who showed RVH and multiple seizure episodes. At 1 year of age, she experienced seizures and sequential hemiparesis caused by a left thalamic hemorrhage without cerebral vascular anomalies. Chronic hypertension was observed, and abdominal computed tomography angiography showed characteristic bilateral renal artery stenosis. Whole-exome sequencing revealed a novel homozygous pathogenic variant in the YY1AP1 gene (NM_001198903.1: c.1169del: p.Lys390Argfs*12). Biallelic YY1AP1 mutations are known to cause Grange syndrome. Unlike previously reported patients, our patient presented with intracerebral hemorrhagic stroke without anomalous brain artery or bone fragility. The phenotype in our patient may help better understand this ultra-rare syndrome. Grange syndrome should be considered in patients presenting with childhood-onset hypertension and/or hemorrhagic stroke for early clinical intervention.


Assuntos
Sequência de Aminoácidos , Arteriopatias Oclusivas/genética , Osso e Ossos/anormalidades , Braquidactilia/genética , Proteínas de Ciclo Celular/genética , Cardiopatias Congênitas/genética , Hipertensão Renovascular/genética , Hipertensão/genética , Hemorragias Intracranianas/genética , Deleção de Sequência , Acidente Vascular Cerebral/genética , Sindactilia/genética , Fatores de Transcrição/genética , Arteriopatias Oclusivas/patologia , Arteriopatias Oclusivas/fisiopatologia , Osso e Ossos/patologia , Osso e Ossos/fisiopatologia , Braquidactilia/patologia , Braquidactilia/fisiopatologia , Criança , Feminino , Cardiopatias Congênitas/patologia , Cardiopatias Congênitas/fisiopatologia , Homozigoto , Humanos , Hipertensão/patologia , Hipertensão/fisiopatologia , Hipertensão Renovascular/patologia , Hipertensão Renovascular/fisiopatologia , Hemorragias Intracranianas/patologia , Hemorragias Intracranianas/fisiopatologia , Acidente Vascular Cerebral/patologia , Acidente Vascular Cerebral/fisiopatologia , Sindactilia/patologia , Sindactilia/fisiopatologia
6.
Eur J Med Genet ; 62(8): 103688, 2019 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-31152918

RESUMO

Mesoaxial synostotic syndactyly (MSSD) with phalangeal reduction is an uncommon congenital limb abnormality characterized by central osseous synostosis at a metacarpal level, mesoaxial reduction of the fingers, and preaxial cutaneous syndactyly in toes. In rare cases, the disease is also associated with fifth finger clinodactyly and postaxial polydactyly. It has autosomal recessive inheritance pattern caused by homozygous variants in the gene BHLHA9 mapped at chromosome 17p13.3. In the present study, a consanguineous family of Pakistani origin segregating MSSD in autosomal recessive form was characterized at clinical and genetic levels. Clinically, the diseased individuals have MSSD associated with clinodactyly and polydactyly. Homozygosity mapping followed by Sanger sequencing of BHLHA9 revealed a novel frameshift variant NM_001164405.1: c.409-409delC; p.(His137Thrfs*61) segregating with the disease phenotypes in the family. This is the second report providing evidence of association of polydactyly with MSSD caused by frameshift variant in the gene BHLHA9. The present molecular investigation will support genetic counselling of the local population carrying diseased variants.


Assuntos
Fatores de Transcrição Hélice-Alça-Hélice Básicos/genética , Dedos/anormalidades , Polidactilia/genética , Sindactilia/genética , Sinostose/genética , Dedos do Pé/anormalidades , Feminino , Falanges dos Dedos da Mão/patologia , Dedos/fisiopatologia , Mutação da Fase de Leitura/genética , Humanos , Masculino , Linhagem , Polidactilia/complicações , Polidactilia/fisiopatologia , Sindactilia/complicações , Sindactilia/fisiopatologia , Sinostose/complicações , Sinostose/fisiopatologia , Dedos do Pé/fisiopatologia
7.
Eur J Med Genet ; 62(7): 103648, 2019 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-30998997

RESUMO

CANAC1C encodes for the main cardiac L-type calcium channel and mutations on it lead to a prolonged QT interval in Timothy Syndrome (TS). We provide a new de novo constitutional heterozygote missense variation in CACNA1C in a living adult woman, also carrier of the known c.2146-1G>C heterozygous variation of PKP2 inherited from her father. To our knowledge, this patient is the first to have the two variations in these genes. Theses clinical and molecular findings expand the clinical and molecular spectrum of TS and show the interest of next generation sequencing or whole exome sequencing in rare disorders, atypical or novel phenotype.


Assuntos
Transtorno Autístico/genética , Canais de Cálcio Tipo L/genética , Síndrome do QT Longo/genética , Fenótipo , Sindactilia/genética , Adulto , Transtorno Autístico/patologia , Feminino , Heterozigoto , Humanos , Síndrome do QT Longo/patologia , Mutação , Placofilinas/genética , Sindactilia/patologia
8.
Taiwan J Obstet Gynecol ; 58(2): 292-295, 2019 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-30910156

RESUMO

OBJECTIVES: To present the prenatal findings and the molecular cytogenetic analyses of a de novo interstitial deletion of 1q23.3 encompassing PBX1 gene. CASE REPORT: A 32-year-old woman (gravida 1, para 0) underwent amniocentesis at 26 weeks' gestation because of constant small fetal kidneys on prenatal ultrasound. Chromosome microarray analysis (CMA) detected a de novo deletion of 1.871 Mb at 1q23.3. The deletion encompassed 2 genes of PBX1 and LMX1A. PBX1 haploinsufficiency had been reported to lead syndromic congenital anomalies of kidney and urinary tract (CAKUT) in humans. Furthermore, at 31 weeks' gestation, borderline oligohydramnios and restricted fetal dimensions were revealed. Ultimately, the pregnancy was terminated at 32 weeks with a 1500-g female fetus presenting polydactyl of left hand. CONCLUSIONS: The shared phenotypes between this case and the previously published prenatal cases demonstrate that loss of function mutation in PBX1 should be suspicious in fetus with bilateral renal hypoplasia, oligohydramnios and intrauterine growth retardation (IUGR).


Assuntos
Deleção Cromossômica , Haploinsuficiência/genética , Fator de Transcrição 1 de Leucemia de Células Pré-B/genética , Aborto Eugênico , Adulto , Amniocentese , Análise Citogenética , Feminino , Humanos , Rim/diagnóstico por imagem , Rim/embriologia , Gravidez , Sindactilia/genética , Ultrassonografia Pré-Natal
9.
Nat Commun ; 10(1): 1180, 2019 03 12.
Artigo em Inglês | MEDLINE | ID: mdl-30862798

RESUMO

A failure in optic fissure fusion during development can lead to blinding malformations of the eye. Here, we report a syndrome characterized by facial dysmorphism, colobomatous microphthalmia, ptosis and syndactyly with or without nephropathy, associated with homozygous frameshift mutations in FAT1. We show that Fat1 knockout mice and zebrafish embryos homozygous for truncating fat1a mutations exhibit completely penetrant coloboma, recapitulating the most consistent developmental defect observed in affected individuals. In human retinal pigment epithelium (RPE) cells, the primary site for the fusion of optic fissure margins, FAT1 is localized at earliest cell-cell junctions, consistent with a role in facilitating optic fissure fusion during vertebrate eye development. Our findings establish FAT1 as a gene with pleiotropic effects in human, in that frameshift mutations cause a severe multi-system disorder whereas recessive missense mutations had been previously associated with isolated glomerulotubular nephropathy.


Assuntos
Blefaroptose/genética , Caderinas/genética , Coloboma/genética , Nefropatias/genética , Microftalmia/genética , Organogênese/genética , Sindactilia/genética , Adolescente , Adulto , Animais , Células Cultivadas , Criança , Pré-Escolar , Análise Mutacional de DNA , Embrião de Mamíferos , Olho/embriologia , Ossos Faciais/anormalidades , Feminino , Mutação da Fase de Leitura , Humanos , Junções Intercelulares/metabolismo , Masculino , Camundongos , Camundongos Endogâmicos C57BL , Camundongos Knockout , Cultura Primária de Células , Epitélio Pigmentado da Retina/citologia , Síndrome , Sequenciamento Completo do Exoma , Adulto Jovem , Peixe-Zebra , Proteínas de Peixe-Zebra/genética
11.
Genesis ; 57(1): e23252, 2019 01.
Artigo em Inglês | MEDLINE | ID: mdl-30253032

RESUMO

The skeletal structure of the mammalian middle ear, which is composed of three endochondral ossicles suspended within a membranous air-filled capsule, plays a critical role in conducting sound. Gene mutations that alter skeletal development in the middle ear result in auditory impairment. Mutations in fibroblast growth factor receptor 2 (FGFR2), an important regulator of endochondral and intramembranous bone formation, cause a spectrum of congenital skeletal disorders featuring conductive hearing loss. Although the middle ear malformations in multiple FGFR2 gain-of-function disorders are clinically characterized, those in the FGFR2 loss-of-function disorder lacrimo-auriculo-dento-digital (LADD) syndrome are relatively undescribed. To better understand conductive hearing loss in LADD, we examined the middle ear skeleton of mice with conditional loss of Fgfr2. We find that decreased auditory function in Fgfr2 mutant mice correlates with hypoplasia of the auditory bulla and ectopic bone growth at sites of tendon/ligament attachment. We show that ectopic bone associated with the intra-articular ligaments of the incudomalleal joint is derived from Scx-expressing cells and preceded by decreased expression of the joint progenitor marker Gdf5. Together, these results identify a role for Fgfr2 in development of the middle ear skeletal tissues and suggest potential causes for conductive hearing loss in LADD syndrome.


Assuntos
Anormalidades Múltiplas/genética , Orelha Média/metabolismo , Perda Auditiva/genética , Doenças do Aparelho Lacrimal/genética , Receptor Tipo 2 de Fator de Crescimento de Fibroblastos/metabolismo , Sindactilia/genética , Anormalidades Dentárias/genética , Animais , Desenvolvimento Ósseo , Orelha Média/anormalidades , Orelha Média/embriologia , Fator 5 de Diferenciação de Crescimento/metabolismo , Mutação com Perda de Função , Camundongos , Receptor Tipo 2 de Fator de Crescimento de Fibroblastos/genética
12.
Eur J Med Genet ; 62(4): 278-281, 2019 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-30107244

RESUMO

Mesoaxial syndactyly is characterized by fusion of the central digits. The disorder segregates in autosomal recessive pattern and mapped on human chromosome 17p13.3. Homozygous missense mutations in the BHLHA9 have been reported to cause mesoaxial synostotic syndactyly with phalangeal reduction (MSSD). In the present study, we have investigated a family segregating mesoaxial synostotic syndactyly with phalangeal reduction (MSSD) in autosomal recessive manner. Genotyping using microsatellite markers followed by Sanger sequencing revealed a homozygous deletion and insertion mutation (NM_001164405: c.252_270delinsGCA; p.(Phe85Glufs*108)) in the BHLHA9 gene in affected individuals of the family. This study reports the first frameshift mutation in the BHLHA9 causing mesoaxial synostotic syndactyly and phalangeal reduction.


Assuntos
Fatores de Transcrição Hélice-Alça-Hélice Básicos/genética , Dedos/anormalidades , Mutação INDEL , Polidactilia/genética , Sindactilia/genética , Dedos do Pé/anormalidades , Adulto , Criança , Feminino , Dedos/patologia , Mutação da Fase de Leitura , Humanos , Masculino , Linhagem , Polidactilia/patologia , Sindactilia/patologia , Dedos do Pé/patologia
14.
Bone ; 116: 321-332, 2018 11.
Artigo em Inglês | MEDLINE | ID: mdl-30077757

RESUMO

Sclerosteosis (SOST) refers to two extremely rare yet similar skeletal dysplasias featuring a diffusely radiodense skeleton together with congenital syndactyly. SOST1 is transmitted as an autosomal recessive (AR) trait and to date caused by ten homozygous loss-of-function mutations within the gene SOST that encodes the inhibitor of Wnt-mediated bone formation, sclerostin. SOST2 is transmitted as an autosomal dominant (AD) or AR trait and to date caused by one heterozygous or two homozygous loss-of-function mutation(s), respectively, within the gene LRP4 that encodes the sclerostin interaction protein, low-density lipoprotein receptor-related protein 4 (LRP4). Herein, we investigated two teenagers and one middle-aged man with SOST in three families living in the state of Tamil Nadu in southern India. Next generation sequencing of their genomic DNA using our high bone density gene panel revealed SOST1 in the teenagers caused by a unique homozygous nonsense SOST mutation (c.129C > G, p.Tyr43X) and SOST2 in the man caused by homozygosity for one of the two known homozygous missense LRP4 mutations (c.3508C > T, p.Arg1170Trp). He becomes the fourth individual and the first non-European recognized with SOST2. His clinical course was milder than the life-threatening SOST1 demonstrated by the teenagers who suffered blindness, deafness, and raised intracranial pressure, yet his congenital syndactyly was more striking by featuring bony fusion of digits. All three patients were from consanguineous families and heterozygosity for the SOST mutation was documented in the mothers of both teenagers. Thus, on the endogamous genetic background of Indian Tamils, SOST1 from sclerostin deficiency compared to SOST2 from LRP4 deactivation is a more severe and life-threatening disorder featuring complications due to osteosclerosis of especially the skull. In contrast, the syndactyly of SOST2 is particularly striking by involving bony fusion of some digits. Both the SOST and LRP4 mutations in this ethnic population likely reflect genetic founders.


Assuntos
Hiperostose/patologia , Sindactilia/patologia , Adolescente , Sequência de Bases , Proteínas Morfogenéticas Ósseas/genética , Osso e Ossos/metabolismo , Análise Mutacional de DNA , Família , Feminino , Marcadores Genéticos/genética , Humanos , Hiperostose/diagnóstico por imagem , Hiperostose/genética , Índia , Proteínas Relacionadas a Receptor de LDL/genética , Masculino , Pessoa de Meia-Idade , Minerais/metabolismo , Linhagem , Sindactilia/diagnóstico por imagem , Sindactilia/genética
15.
Glia ; 66(11): 2324-2339, 2018 11.
Artigo em Inglês | MEDLINE | ID: mdl-30151840

RESUMO

To study the role of L-type voltage-gated Ca++ channels in oligodendrocyte development, we used a mouse model of Timothy syndrome (TS) in which a gain-of-function mutation in the α1 subunit of the L-type Ca++ channel Cav1.2 gives rise to an autism spectrum disorder (ASD). Oligodendrocyte progenitor cells (OPCs) isolated from the cortex of TS mice showed greater L-type Ca++ influx and displayed characteristics suggestive of advanced maturation compared to control OPCs, including a more complex morphology and higher levels of myelin protein expression. Consistent with this, expression of Cav1.2 channels bearing the TS mutation in wild-type OPCs triggered process formation and promoted oligodendrocyte-neuron interaction via the activation of Ca++ /calmodulin-dependent protein kinase II. To ascertain whether accelerated OPC maturation correlated with functional enhancements, we examined myelination in the TS brain at different postnatal time points. The expression of myelin proteins was significantly higher in the corpus callosum, cortex and striatum of TS animals, and immunohistochemical analysis for oligodendrocyte stage-specific markers revealed an increase in the density of myelinating oligodendrocytes in several areas of the TS brain. Along the same line, electron microscopy studies in the corpus callosum of TS animals showed significant increases both in the percentage of myelinated axons and in the thickness of myelin sheaths. In summary, these data indicate that OPC development and oligodendrocyte myelination is enhanced in the brain of TS mice, and suggest that this mouse model of a syndromic ASD is a useful tool to explore the role of L-type Ca++ channels in myelination.


Assuntos
Transtorno Autístico/complicações , Transtorno Autístico/patologia , Diferenciação Celular/genética , Regulação da Expressão Gênica no Desenvolvimento/genética , Síndrome do QT Longo/complicações , Síndrome do QT Longo/patologia , Proteínas da Mielina/metabolismo , Oligodendroglia/fisiologia , Sindactilia/complicações , Sindactilia/patologia , Animais , Animais Recém-Nascidos , Transtorno Autístico/genética , Proteínas Relacionadas à Autofagia , Proteínas de Bactérias/genética , Proteínas de Bactérias/metabolismo , Fatores de Transcrição Hélice-Alça-Hélice Básicos/genética , Fatores de Transcrição Hélice-Alça-Hélice Básicos/metabolismo , Cálcio/metabolismo , Canais de Cálcio Tipo L/genética , Canais de Cálcio Tipo L/metabolismo , Células Cultivadas , Córtex Cerebral/citologia , Técnicas de Cocultura , Modelos Animais de Doenças , Peptídeos e Proteínas de Sinalização Intracelular/genética , Peptídeos e Proteínas de Sinalização Intracelular/metabolismo , Síndrome do QT Longo/genética , Proteínas Luminescentes/genética , Proteínas Luminescentes/metabolismo , Camundongos , Camundongos Transgênicos , Mutação/genética , Proteínas do Tecido Nervoso/metabolismo , Neurônios/efeitos dos fármacos , Neurônios/metabolismo , Neurônios/patologia , Neurônios/ultraestrutura , Células Precursoras de Oligodendrócitos/efeitos dos fármacos , Células Precursoras de Oligodendrócitos/metabolismo , Células Precursoras de Oligodendrócitos/patologia , Oligodendroglia/patologia , Oligodendroglia/ultraestrutura , Potássio/farmacologia , Sindactilia/genética
16.
BMC Med Genet ; 19(1): 125, 2018 07 24.
Artigo em Inglês | MEDLINE | ID: mdl-30041615

RESUMO

BACKGROUND: Cenani-Lenz Syndactyly (CLS) syndrome is a rare autosomal recessive disorder characterized by syndactyly and oligodactyly of fingers and toes, disorganization and fusion of metacarpals, metatarsals and phalanges, radioulnar synostosis and mesomelic shortness of the limbs, with lower limbs usually being much less affected than upper limbs. CASE PRESENTATION: we report here two patients, born to consanguineous Sri Lankan parents, present with bilateral postaxial oligodactyly limited to upper limbs. While the proband has no noticeable facial dysmorphism, renal impairments or cognitive impairments, his affected sister displays a few mild facial dysmorphic features. Whole exome sequencing of the proband showed a novel deleterious homozygous mutation (c.1348A > G) in the LRP4 gene, resulting in an Ile450-to-Val (I450V) substitution. CONCLUSION: This recessive mutation in LRP4 confirmed the diagnosis of CLS syndrome in two patients present with isolated hand syndactyly. This is the first reported case of CLS syndrome in a family of Sri Lankan origin.


Assuntos
Rádio (Anatomia)/anormalidades , Sindactilia/genética , Sinostose/genética , Ulna/anormalidades , Adolescente , Adulto , Consanguinidade , Feminino , Dedos/anormalidades , Homozigoto , Humanos , Masculino , Mutação/genética , Linhagem , Dedos do Pé/anormalidades , Adulto Jovem
17.
JCI Insight ; 3(11)2018 06 07.
Artigo em Inglês | MEDLINE | ID: mdl-29875318

RESUMO

The WNT pathway has become an attractive target for skeletal therapies. High-bone-mass phenotypes in patients with loss-of-function mutations in the LRP5/6 inhibitor Sost (sclerosteosis), or in its downstream enhancer region (van Buchem disease), highlight the utility of targeting Sost/sclerostin to improve bone properties. Sclerostin-neutralizing antibody is highly osteoanabolic in animal models and in human clinical trials, but antibody-based inhibition of another potent LRP5/6 antagonist, Dkk1, is largely inefficacious for building bone in the unperturbed adult skeleton. Here, we show that conditional deletion of Dkk1 from bone also has negligible effects on bone mass. Dkk1 inhibition increases Sost expression, suggesting a potential compensatory mechanism that might explain why Dkk1 suppression lacks anabolic action. To test this concept, we deleted Sost from osteocytes in, or administered sclerostin neutralizing antibody to, mice with a Dkk1-deficient skeleton. A robust anabolic response to Dkk1 deletion was manifest only when Sost/sclerostin was impaired. Whole-body DXA scans, µCT measurements of the femur and spine, histomorphometric measures of femoral bone formation rates, and biomechanical properties of whole bones confirmed the anabolic potential of Dkk1 inhibition in the absence of sclerostin. Further, combined administration of sclerostin and Dkk1 antibody in WT mice produced a synergistic effect on bone gain that greatly exceeded individual or additive effects of the therapies, confirming the therapeutic potential of inhibiting multiple WNT antagonists for skeletal health. In conclusion, the osteoanabolic effects of Dkk1 inhibition can be realized if sclerostin upregulation is prevented. Anabolic therapies for patients with low bone mass might benefit from a strategy that accounts for the compensatory milieu of WNT inhibitors in bone tissue.


Assuntos
Anabolizantes/administração & dosagem , Glicoproteínas/antagonistas & inibidores , Hiperostose/tratamento farmacológico , Osteogênese/efeitos dos fármacos , Sindactilia/tratamento farmacológico , Via de Sinalização Wnt/efeitos dos fármacos , Animais , Anticorpos Neutralizantes/administração & dosagem , Proteínas Morfogenéticas Ósseas/genética , Modelos Animais de Doenças , Feminino , Fêmur/citologia , Fêmur/diagnóstico por imagem , Fêmur/patologia , Marcadores Genéticos/genética , Glicoproteínas/genética , Glicoproteínas/metabolismo , Humanos , Hiperostose/diagnóstico por imagem , Hiperostose/genética , Hiperostose/patologia , Peptídeos e Proteínas de Sinalização Intercelular/genética , Mutação com Perda de Função , Masculino , Camundongos , Osteócitos , Coluna Vertebral/citologia , Coluna Vertebral/diagnóstico por imagem , Coluna Vertebral/patologia , Sindactilia/diagnóstico por imagem , Sindactilia/genética , Sindactilia/patologia , Resultado do Tratamento , Regulação para Cima/efeitos dos fármacos , Microtomografia por Raio-X
18.
Cytogenet Genome Res ; 154(4): 181-186, 2018.
Artigo em Inglês | MEDLINE | ID: mdl-29902798

RESUMO

Oculodentodigital dysplasia (ODDD) is a rare condition characterized by a typical facial appearance and variable findings of the eyes, teeth, and fingers. ODDD is caused by mutations in the GJA1 gene in chromosome 6q22 and inherited in an autosomal dominant manner in the majority of the patients. However, in recent clinical reports, autosomal recessive ODDD cases due to by GJA1 mutations were also described. Here, we report on a 14-year-old boy with microphthalmia, microcornea, narrow nasal bridge, hypoplastic alae nasi, prominent columnella, hypodontia, dental caries, and partial syndactyly of the 2nd and 3rd toes. These clinical findings were concordant with the diagnosis of ODDD, and a novel homozygous mutation (c.442C>T, p.Arg148Ter) was determined in the GJA1 gene leading to a premature stop codon. His phenotypically normal parents were found to be carriers of the same mutation. This is the third family in the literature in which ODDD segregates in an autosomal recessive manner.


Assuntos
Anormalidades Craniofaciais/genética , Anormalidades do Olho/genética , Deformidades Congênitas do Pé/genética , Genes Recessivos , Sindactilia/genética , Anormalidades Dentárias/genética , Adolescente , Códon de Terminação/genética , Conexina 43/genética , Homozigoto , Humanos , Masculino , Mutação
19.
J Invest Dermatol ; 138(12): 2578-2588, 2018 12.
Artigo em Inglês | MEDLINE | ID: mdl-29913133

RESUMO

Variants in IRF6 can lead to Van der Woude syndrome and popliteal pterygium syndrome. Furthermore, genes upstream and downstream of IRF6, including GRHL3 and TP63, are also associated with orofacial clefting. Additionally, a variant in an enhancer (MCS9.7) that regulates IRF6 is associated with risk for isolated orofacial clefting. This variant (rs642961) abrogates AP2A protein binding at MCS9.7. Here, we found that AP2A protein regulates MCS9.7 enhancer activity in vivo and IRF6 protein expression in epidermal development. In addition, loss of IRF6 leads to supra-basal expression of AP2A protein. Finally, using an IRF6 allelic series, we found that either increasing or decreasing IRF6 protein expression can destabilize AP2A protein expression in vivo. These data suggest that IRF6 regulates AP2A protein level in epidermal development. Therefore, we conclude that IRF6 and TFAP2A are part of a genetic regulatory network that is critical in epithelial development, with implications for both orofacial and cutaneous tissues. Our work provides in vivo, functional data to explain the relationship between AP2A protein binding and the MCS9.7 enhancer in orofacial clefting. This work is important because the MCS9.7 enhancer element contains a variant that abrogates AP2A protein binding and increases risk for orofacial clefting worldwide.


Assuntos
Anormalidades Múltiplas/genética , Complexo 2 de Proteínas Adaptadoras/metabolismo , Subunidades alfa do Complexo de Proteínas Adaptadoras/metabolismo , Fenda Labial/genética , Fissura Palatina/genética , Cistos/genética , Elementos Facilitadores Genéticos/genética , Epiderme/fisiologia , Anormalidades do Olho/genética , Dedos/anormalidades , Fatores Reguladores de Interferon/genética , Articulação do Joelho/anormalidades , Lábio/anormalidades , Deformidades Congênitas das Extremidades Inferiores/genética , Sindactilia/genética , Anormalidades Urogenitais/genética , Complexo 2 de Proteínas Adaptadoras/genética , Subunidades alfa do Complexo de Proteínas Adaptadoras/genética , Alelos , Animais , Células Cultivadas , Redes Reguladoras de Genes , Humanos , Camundongos , Camundongos Transgênicos , Organogênese/genética , Polimorfismo de Nucleotídeo Único , Ligação Proteica , Estabilidade Proteica
20.
Am J Med Genet A ; 176(7): 1657-1661, 2018 07.
Artigo em Inglês | MEDLINE | ID: mdl-29736926

RESUMO

Timothy syndrome is characterized by a unique combination of a prolongation of the corrected QT interval of the electrocardiogram and bilateral cutaneous syndactyly of the fingers and the toes and is caused by heterozygous mutations in CACNA1C, a gene encoding a calcium channel. After the discovery of the CACNA1C gene as the causative gene for Timothy syndrome, patients with CACNA1C mutations with QT prolongation but without syndactyly were described. Here, we report a 5-year-old female patient with cutaneous syndactyly, developmental delay, and pulmonary hypertension. Exome analysis showed a previously undescribed de novo heterozygous mutation in the CACNA1C gene, p.Arg1024Gly. To our knowledge, this patient is the first to exhibit syndactyly and to carry a CACNA1C mutation but to not have QT prolongation, which has long been considered an obligatory feature of Timothy syndrome.


Assuntos
Transtorno Autístico/patologia , Canais de Cálcio Tipo L/genética , Deficiências do Desenvolvimento/patologia , Hipertensão Pulmonar/patologia , Síndrome do QT Longo/patologia , Mutação , Sindactilia/patologia , Transtorno Autístico/genética , Deficiências do Desenvolvimento/genética , Feminino , Humanos , Hipertensão Pulmonar/genética , Recém-Nascido , Síndrome do QT Longo/genética , Fenótipo , Sindactilia/genética
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA