Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 18.146
Filtrar
1.
Vasc Endovascular Surg ; 57(1): 79-82, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36031948

RESUMO

Malignant invasion of the inferior vena cava (IVC) often necessitates complete tumor thrombectomy and IVC reconstruction. Bovine pericardial xenografts and prosthetic grafts are frequently used for partial or entire IVC reconstruction with adequate subsequent patency and freedom from thrombosis. Cryopreserved aortic homografts represent an alternative conduit for vena cava replacement with resistance to infection in contaminated fields or following extensive retroperitoneal dissection. Specific reports of aortic homograft use for IVC reconstruction are scarce. Described are 2 cases of cryopreserved aortoiliac artery allograft use for long segment cava patch repair while avoiding extensive caval reconstruction, mobilization and the need for renal vein and hepatic vein re-implantation.


Assuntos
Neoplasias , Veia Cava Inferior , Humanos , Bovinos , Animais , Veia Cava Inferior/diagnóstico por imagem , Veia Cava Inferior/cirurgia , Resultado do Tratamento , Criopreservação , Aloenxertos
2.
Open Heart ; 9(2)2022 11.
Artigo em Inglês | MEDLINE | ID: mdl-36344108

RESUMO

BACKGROUND: Between 25% and 30% of patients hospitalised for acute heart failure (AHF) are readmitted within 90 days after discharge, mostly due to persistent congestion on discharge. However, as the optimal evaluation of decongestion is not clearly defined, it is necessary to implement new tools to identify subclinical congestion to guide treatment. OBJECTIVE: To evaluate if inferior vena cava (IVC) and lung ultrasound (CAVAL US)-guided therapy for AHF patients reduces subclinical congestion at discharge. METHODS: CAVAL US-AHF is a single-centre, single-blind randomised controlled trial designed to evaluate if an IVC and lung ultrasound-guided healthcare strategy is superior to standard care to reduce subclinical congestion at discharge. Fifty-eight patients with AHF will be randomised using a block randomisation programme that will assign to either lung and IVC ultrasound-guided decongestion therapy ('intervention group') or clinical-guided decongestion therapy ('control group'), using a quantitative protocol and will be classified in three groups according to the level of congestion observed: none or mild, moderate or severe. The treating physicians will know the result of the test and the subsequent adjustment of treatment in response to those findings guided by a customised therapeutic algorithm. The primary endpoint is the presence of more than five B-lines and/or an increase in the diameter of the IVC, with and without collapsibility. The secondary endpoints are the composite of readmission for HF, unplanned visit for worsening HF or death at 90 days, variation of pro-B-type natriuretic peptide at discharge, length of hospital stay and diuretic dose at 90 days. Analyses will be conducted as between-group by intention to treat. ETHICS AND DISSEMINATION: Ethical approval was obtained from the Institutional Review Board and registered in the PRIISA.BA platform of the Ministry of Health of the City of Buenos Aires. TRIAL REGISTRATION NUMBER: NCT04549701.


Assuntos
Insuficiência Cardíaca , Veia Cava Inferior , Humanos , Veia Cava Inferior/diagnóstico por imagem , Método Simples-Cego , Doença Aguda , Insuficiência Cardíaca/diagnóstico por imagem , Insuficiência Cardíaca/tratamento farmacológico , Pulmão/diagnóstico por imagem , Ultrassonografia de Intervenção
3.
Acta Clin Croat ; 61(1): 145-148, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-36398088

RESUMO

Left-sided inferior vena cava (IVC) is a rare congenital venous anomaly that is most frequently detected incidentally during abdominal computer tomography scanning. However, as in the case presented, the first clinical manifestation of this anomaly may be deep venous thrombosis (DVT) of lower extremities. Therefore, left-sided IVC should be kept in mind in case of inferior DVT, especially in young patients with no predisposing thrombotic risk factors.


Assuntos
Malformações Vasculares , Trombose Venosa , Humanos , Veia Cava Inferior/diagnóstico por imagem , Veia Cava Inferior/anormalidades , Trombose Venosa/complicações , Trombose Venosa/diagnóstico por imagem , Extremidade Inferior , Tomografia Computadorizada por Raios X
4.
Sensors (Basel) ; 22(21)2022 Nov 06.
Artigo em Inglês | MEDLINE | ID: mdl-36366251

RESUMO

BACKGROUND/OBJECTIVE: In recent years, treatment of heart failure patients has proved to benefit from implantation of pressure sensors in the pulmonary artery (PA). While longitudinal measurement of PA pressure profoundly improves a clinician's ability to manage HF, the full potential of central venous pressure as a clinical tool has yet to be unlocked. Central venous pressure serves as a surrogate for the right atrial pressure, and thus could potentially predict a wider range of heart failure conditions. However, it is unclear if current sensor anchoring methods, designed for the PA, are suitable to hold pressure sensors safely in the inferior vena cava. The purpose of this study was to design an anchoring system for accurate apposition in inferior vena cava and evaluate whether it is a potential site for central venous pressure measurement. MATERIALS AND METHODS: A location inferior to the renal veins was selected as an optimal site based on a CT scan analysis. Three anchor designs, a 10-strut anchor, and 5-struts with and without loops, were tested on a custom-made silicone bench model of Vena Cava targeting the infra-renal vena cava. The model was connected to a pulsatile pump system and a heated water bath that constituted an in-vitro simulation unit. Delivery of the inferior vena cava implant was accomplished using a preloaded introducer and a dilator as a push rod to deploy the device at the target area. The anchors were subjected to manual compression tests to evaluate their stability against dislodgement. Computational Fluid Dynamics (CFD) analysis was completed to characterize blood flow in the anchor's environment using pressure-based transient solver. Any potential recirculation zones or disturbances in the blood flow caused by the struts were identified. RESULTS: We demonstrated successful anchorage and deployment of the 10-strut anchor in the Vena Cava bench model. The 10-strut anchor remained stable during several compression attempts as compared with the other two 5-strut anchor designs. The 10-strut design provided the maximum number of contact points with the vessel in a circular layout and was less susceptible to movement or dislodgement during compression tests. Furthermore, the CFD simulation provided haemodynamic analysis of the optimum 10-strut anchor design. CONCLUSIONS: This study successfully demonstrated the design and deployment of an inferior vena cava anchoring system in a bench test model. The 10-strut anchor is an optimal design as compared with the two other 5-strut designs; however, substantial in-vivo experiments are required to validate the safety and accuracy of such implants. The CFD simulation enabled better understanding of the haemodynamic parameters and any disturbances in the blood flow due to the presence of the anchor. The ability to place a sensor technology in the vena cava could provide a simple and minimally invasive approach for heart failure patients.


Assuntos
Insuficiência Cardíaca , Veia Cava Inferior , Humanos , Pressão Venosa Central/fisiologia , Veia Cava Inferior/fisiologia , Hemodinâmica , Artéria Pulmonar
5.
BMC Gastroenterol ; 22(1): 451, 2022 Nov 08.
Artigo em Inglês | MEDLINE | ID: mdl-36348278

RESUMO

BACKGROUND: The aim of our study was to evaluate the curative effect and safety of stereotactic body radiation therapy (SBRT) in treating hepatocellular carcinoma (HCC) patients with inferior vena cava (IVCTT) and right atrial tumor thrombus (RATT). METHODS: This retrospective study included fifteen advanced HCC patients with IVCTT and RATT who were treated with SBRT between 2013 and 2020. The prescribed dose delivered to the tumor was 45-50 Gy/7-10 fx. We report their treatment responses according to survival time and toxicities. RESULTS: For these patients, the median follow-up time was 15 months (2-52 months). Local tumor control rates of the treated area were 80% at the time of death or at the last follow-up. The 6-month, 12-month, 18-month and 24-month OS rates were 80.0%, 60.0%, 33.3% and 26.7%, respectively. None of these patients died from the toxicity outcomes and complications of SBRT. CONCLUSION: SBRT is an effective option for advanced HCC patients with IVCTT and RATT.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , Radiocirurgia , Trombose , Humanos , Carcinoma Hepatocelular/patologia , Veia Cava Inferior/patologia , Radiocirurgia/efeitos adversos , Neoplasias Hepáticas/patologia , Estudos Retrospectivos , Resultado do Tratamento , Trombose/complicações
6.
Medicine (Baltimore) ; 101(44): e31308, 2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36343052

RESUMO

Budd-Chiari syndrome (BCS) is considered a rare but serious complication of Behçet's disease (BD). This study was performed to define the prevalence, clinical and biological features, treatment, and clinical course of BSC associated with BD in a Moroccan population. We retrospectively analyzed the medical records of 1578 patients fulfilling the international diagnostic criteria for BD, including those with BSC. Eighteen male and 3 female patients, with a mean age of 36 ± 8.6 years. The inferior vena cava was involved in 81% (n = 17) of cases. All forms of BCS were noted: the chronic form in 52.4% (n = 11), the subacute form in 38% (n = 8), and the fulminant form (2 cases). Ascites was the main clinical sign and was present in 62% of patients (n = 13). Other venous thromboses (superior vena cava and lower limbs) were associated with BSC in 52.4% of patients (n = 11). Arterial involvement was noted in 28.6% (n = 6). Cardiac manifestations were present in 19% (n = 4) of the patients. All the patients received anticoagulants associated with corticosteroids. Immunosuppressants were used in 95% (n = 20). One patient received infliximab. Severe complications were noted in 38% (n = 8) of patients (digestive bleeding, confusion, infections and liver failure). Four patients have died during the study period. BCS in patients with BD is not uncommon and can be life threatening. It is frequently associated with other vascular manifestations that can be difficult to treat, particularly in the presence of pulmonary artery aneurysms. Prognosis improved with the use of immunosuppressants. Biologics can be promising in the early stages.


Assuntos
Síndrome de Behçet , Síndrome de Budd-Chiari , Humanos , Masculino , Feminino , Adulto , Síndrome de Budd-Chiari/etiologia , Síndrome de Budd-Chiari/complicações , Síndrome de Behçet/complicações , Síndrome de Behçet/tratamento farmacológico , Síndrome de Behçet/diagnóstico , Estudos Retrospectivos , Veia Cava Superior , Marrocos/epidemiologia , Veia Cava Inferior , Imunossupressores/uso terapêutico
7.
Medicine (Baltimore) ; 101(44): e31240, 2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36343066

RESUMO

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.


Assuntos
Deficiência de Antitrombina III , Trombofilia , Trombose , Masculino , Humanos , Adolescente , Varfarina/uso terapêutico , Deficiência de Antitrombina III/complicações , Deficiência de Antitrombina III/genética , Deficiência de Antitrombina III/tratamento farmacológico , Trombofilia/tratamento farmacológico , Veia Cava Inferior , Anticoagulantes , Heparina , Mutação , Trombose/tratamento farmacológico , Antitrombinas , Antitrombina III/genética
8.
BMC Surg ; 22(1): 377, 2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36333708

RESUMO

BACKGROUND: We aimed to compare the oncological outcomes between the oblique occlusion technique and the traditional technique for robot-assisted radical nephrectomy (RARN) with inferior vena cava (IVC) thrombectomy, and to explore the safety and effectiveness of the oblique occlusion technique. METHODS: Overall, 21 patients with renal cell carcinoma (RCC) and IVC tumor thrombus (TT) were admitted to our hospital from August 2019 to June 2020. All the patients underwent RARN with IVC thrombectomy, of which the IVC oblique occlusion technique was used in 11 patients and traditional occlusion technique was used in 10 patients. The oblique occlusion technique refers to oblique blocking from the upper corner of the right renal vein to the lower corner of the left renal vein using a vessel tourniquet or a vessel clamp (left RCC with IVCTT as an example). RESULTS: Compared with patients in the traditional group, those in the oblique group had lower serum creatinine at follow-up (3 month) (95 ± 21.1 vs. 131 ± 30.7 µmol/L, P = 0.03). There was no significant difference in operation time [149 (IQR 143-245) min vs. 148 (IQR 108-261) min, p = 0.86], IVC clamping time [18 (IQR 12-20) min vs. 20 (IQR 14-23) min, p = 0.41], and estimated intraoperative blood loss [300 (IQR 100-800) mL vs. 500 (IQR 175-738) mL, p = 0.51] between both groups. During a 16-month (range, 15-23 months) follow-up period, two cases progressed in the oblique group and three cases progressed in the traditional group. CONCLUSIONS: The modified IVC oblique occlusion technique procedure is relatively safe and effective in RARN with IVC thrombectomy. The IVC oblique occlusion technique may play a role in the protection of renal function.


Assuntos
Carcinoma de Células Renais , Neoplasias Renais , Robótica , Trombose Venosa , Humanos , Veia Cava Inferior/cirurgia , Veia Cava Inferior/patologia , Carcinoma de Células Renais/cirurgia , Neoplasias Renais/cirurgia , Neoplasias Renais/patologia , Trombectomia/métodos , Nefrectomia/métodos , Trombose Venosa/cirurgia , Trombose Venosa/patologia , Estudos Retrospectivos
9.
Artigo em Inglês | MEDLINE | ID: mdl-36331045

RESUMO

The extracardiac Fontan can be completed via transcatheter perforation of the pericardial membrane created during the preparatory stage, thus establishing continuity between the inferior vena cava and the pulmonary artery. This step is followed by deployment of a covered stent to isolate the systemic and pulmonary circuits. The procedure avoids the morbidity associated with cardiac reoperation and is a safe option for patients who present late with prohibitive pulmonary artery pressures in whom primary Fontan completion may not be feasible.


Assuntos
Técnica de Fontan , Cardiopatias Congênitas , Humanos , Técnica de Fontan/métodos , Cardiopatias Congênitas/cirurgia , Artéria Pulmonar/cirurgia , Veia Cava Inferior/cirurgia , Stents , Resultado do Tratamento
10.
J Vet Med Sci ; 84(12): 1556-1562, 2022 Nov 18.
Artigo em Inglês | MEDLINE | ID: mdl-36244742

RESUMO

This study investigated the association between caudal vena cava (CVC) size and circulatory dynamics in dogs using computed tomography (CT) under general anesthesia. The subjects were 104 dogs who had undergone CT under general anesthesia in the past. The ratio of short diameter of the CVC to aortic diameter (CVCS/Ao) and the ratio of long to short diameter of the CVC (CVCL/CVCS) in the thorax and abdomen, respectively, were calculated using factors such as mean blood pressure (MBP), shock index (SI), anemia, hypoproteinemia, presence of intra-abdominal mass, and cardiac disease. There was a significant but negligible negative correlation between CVCS/Ao and MBP. In contrast, no significant correlation was found between CVC size and SI. The low MBP group had significantly higher CVCS/Ao of the thorax than the normal MBP group. The group with intra-abdominal mass had significantly lower CVCS/Ao of the abdomen than the group without intra-abdominal mass. The group with cardiac disease had significantly lower CVCL/CVCS of the thorax than the group without cardiac disease. In multiple regression analysis, low MBP, cardiac disease, intra-abdominal mass, and anemia were significant factors for CVCS/Ao of the thorax, CVCL/CVCS of the thorax, CVCS/Ao of the abdomen, and CVCL/CVCS of the abdomen, respectively. In conclusion, CVC size assessment using CT in dogs under general anesthesia is influenced by various factors.


Assuntos
Doenças do Cão , Cardiopatias , Cães , Animais , Veia Cava Inferior/diagnóstico por imagem , Anestesia Geral/veterinária , Tomografia Computadorizada por Raios X/veterinária , Pressão Sanguínea , Cardiopatias/veterinária , Doenças do Cão/diagnóstico por imagem
11.
J Vasc Interv Radiol ; 33(10): 1230-1233, 2022 10.
Artigo em Inglês | MEDLINE | ID: mdl-36182256

RESUMO

The purpose of this study was to investigate the safety and effectiveness of the transfemoral transcaval (TFTC) liver biopsy technique in patients with hepatic masses with relative contraindications to percutaneous biopsy and/or mass location abutting the inferior vena cava. The medical records of 16 patients (56% men; age range, 21-88 years) who underwent TFTC biopsy of hepatic masses (ranging in diameter from 2.1 to 13.2 cm) from September 2015 to August 2021 were reviewed. Histopathologic diagnoses were made in 15 of 17 (88%) procedures. Two adverse events were noted: worsened preexisting hemobilia requiring embolization in 1 patient, and a decrease in hematocrit level in another patient, requiring only observation. In conclusion, this report showed that the TFTC technique is a relatively safe and effective method for sampling hepatic masses in select cases.


Assuntos
Embolização Terapêutica , Fígado , Adulto , Idoso , Idoso de 80 Anos ou mais , Biópsia/efeitos adversos , Embolização Terapêutica/efeitos adversos , Embolização Terapêutica/métodos , Feminino , Humanos , Fígado/diagnóstico por imagem , Fígado/patologia , Masculino , Pessoa de Meia-Idade , Estudos Retrospectivos , Veia Cava Inferior , Adulto Jovem
12.
Am J Case Rep ; 23: e938009, 2022 Oct 27.
Artigo em Inglês | MEDLINE | ID: mdl-36301744

RESUMO

BACKGROUND Leiomyosarcoma (LMS) of the inferior vena cava (IVC) is a rare malignancy, and complete resection may provide better patient survival. Hepatectomy for intrahepatic tumor recurrence has not been previously reported. CASE REPORT A 58-year-old woman underwent resection of an IVC-LMS with en bloc nephrectomy, adrenalectomy, and retroperitoneal soft tissue resection without IVC reconstruction 3 years 8 months ago. Twenty-nine months after the primary operation, a solitary intrahepatic liver tumor was found adjacent to the right and middle hepatic veins during imaging follow-up. The patient was diagnosed with LMS recurrence. As her liver functional parameters permitted major hepatectomy, right hepatectomy combined with resection of the vena cava wall leaving a tumor-free margin and securing the confluence of the middle hepatic vein were successfully accomplished via an anterior approach, without adverse events. Intrahepatic metastasis of LMS invading the vena cava wall has been diagnosed historically. Her postoperative course was uneventful, and at 1-year follow-up after the second surgery, she was observed to have no tumor relapse without any adjuvant treatment. Previous reports have shown that IVC-LMS is often observed, and operative risk or prognosis is based on the extension of the LMS toward the hepatic veins or cardiac atrium. CONCLUSIONS Radical hepatectomy for recurrent IVC-LMS has not been previously reported, and our case experience revealed that a challenging surgical intervention resulting in complete tumor removal can provide good survival outcomes.


Assuntos
Carcinoma Hepatocelular , Leiomiossarcoma , Neoplasias Hepáticas , Neoplasias Vasculares , Feminino , Humanos , Pessoa de Meia-Idade , Leiomiossarcoma/diagnóstico por imagem , Leiomiossarcoma/cirurgia , Hepatectomia/métodos , Veia Cava Inferior/cirurgia , Veia Cava Inferior/patologia , Neoplasias Vasculares/patologia , Seguimentos , Recidiva Local de Neoplasia/cirurgia , Recidiva Local de Neoplasia/patologia , Carcinoma Hepatocelular/cirurgia , Neoplasias Hepáticas/diagnóstico por imagem , Neoplasias Hepáticas/cirurgia , Neoplasias Hepáticas/patologia
13.
J Coll Physicians Surg Pak ; 32(10): 1353-1355, 2022 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-36205287

RESUMO

Leiomyosarcoma of the inferior vena cava is an extremely rare malignancy originating from the smooth muscle of the vessel wall, with only a few hundred cases reported in the literature. There are no clear guidelines for treatment, but surgical resection is currently the only curative option. Further research is needed to better understand the disease and guide its management. We report a case of a 39-year woman who presented to the emergency room with a four-day history of nonspecific abdominal pain, nausea and fever. An abdominal computed tomography revealed a mass in relation with the inferior vena cava and hepatic nodules. Histological examination proved it to be a leiomyosarcoma of inferior vena cava with liver metastases. Key Words: Leiomyosarcoma, Inferior vena cava, Sarcoma.


Assuntos
Leiomiossarcoma , Neoplasias Vasculares , Dor Abdominal , Adulto , Feminino , Humanos , Leiomiossarcoma/diagnóstico por imagem , Leiomiossarcoma/cirurgia , Tomografia Computadorizada por Raios X , Neoplasias Vasculares/diagnóstico por imagem , Neoplasias Vasculares/cirurgia , Veia Cava Inferior/patologia
14.
Can J Urol ; 29(5): 11300-11306, 2022 10.
Artigo em Inglês | MEDLINE | ID: mdl-36245200

RESUMO

INTRODUCTION: This study examined the clinical accuracy of ultrasonography compared to magnetic resonance imaging (MRI) and intraoperative findings for evaluation of tumor thrombi level in patients with renal cell carcinoma. MATERIALS AND METHODS: We retrospectively identified 38 patients at our institution who underwent both ultrasonography and MRI before undergoing open radical nephrectomy with tumor thrombectomy between 2010 and 2019. We compared tumor thrombus level findings of both ultrasonography and MRI, as well as the diagnostic accuracy of each to intraoperative findings. Agreement between ultrasonography, MRI, and surgery was tested with kappa. Logistic regression models identified factors that predict a mismatched thrombus level between an imaging modality and surgical findings. RESULTS AND CONCLUSIONS: Tumor thrombus levels determined by ultrasonography matched with MRI in 26 (68.4%) cases. Compared to operative findings, ultrasonography accurately identified the cephalad extent of thrombi in 30 (79.0%) cases, under-staged five (13.2%) cases, and over-staged three (7.9%). Magnetic resonance imaging agreed with operative findings in 30 (79.0%) cases, under-staged five (13.2%) and over-staged three (7.9%) cases. On univariable regression assessment, M1 stage was predictive of a mismatched result between MRI and surgery (OR: 6.0, 95% CI: 1.02-35.3, p = 0.047), but this association did not hold-up in a multivariable model. Ultrasonography and magnetic resonance imaging identified the preoperative tumor thrombus level at a rate of 79%. Ultrasonography is an effective preoperative imaging modality for evaluating tumor thrombi associated with kidney cancer, notably as an adjunct to magnetic resonance imaging.


Assuntos
Carcinoma de Células Renais , Neoplasias Renais , Trombose , Carcinoma de Células Renais/diagnóstico por imagem , Carcinoma de Células Renais/cirurgia , Humanos , Neoplasias Renais/diagnóstico por imagem , Neoplasias Renais/cirurgia , Nefrectomia/métodos , Estudos Retrospectivos , Trombectomia/métodos , Trombose/diagnóstico por imagem , Trombose/etiologia , Trombose/cirurgia , Ultrassonografia , Veia Cava Inferior/diagnóstico por imagem
15.
Khirurgiia (Mosk) ; (10): 35-43, 2022.
Artigo em Russo | MEDLINE | ID: mdl-36223148

RESUMO

OBJECTIVE: To study the possibilities and results of reconstruction of caval veins. MATERIAL AND METHODS: We analyzed the results of reconstruction of caval veins in 31 patients (19 men and 12 women) including superior vena cava (SVC) in 5 cases and inferior vena cava (IVC) in 26 cases. Penetrating wounds with vascular damage were found in 8 patients. Iatrogenic damage to IVC was observed in 19 patients (nephrectomy for kidney cancer - 2, nephrectomy for secondary kidney wrinkling - 1, echinococcectomy from retroperitoneal space - 1, adrenalectomy for adrenal tumors - 5, right-sided lumbar sympathectomy - 1, resection of abdominal aortic aneurysm - 1, resection of a large retroperitoneal tumor - 6). Iatrogenic damage to SVC occurred in 2 patients during resection of mediastinal tumor. In other 4 cases, elective surgery for mediastinal tumor (1), pancreatic head cancer (2) and liver alveococcosis (1) was accompanied by resection and replacement of caval veins. RESULTS: All interventions for caval vein injury were performed under adequate infusion therapy. Seven (22.6%) patients died. One patient with blunt chest trauma and damage to SVC died during thoracotomy. In another patient, infrarenal IVC was intersected during mobilization of retroperitoneal hydatid cyst that required ligation for vital indications. High venous hypertension below the ligature led to eruption of sutures on the venous stump. The patient died from hypovolemia after additional IVC ligation. Other 5 patients died in early postoperative period without leaving the state of shock. These patients had damage to retrohepatic segment of IVC (1), vascular-organ (1) and iatrogenic (3) injuries. One patient died from pulmonary embolism, two patients - from venous bleeding between the 2nd and the 5th postoperative days. Patients died before reoperations. Two patients with postoperative bleeding underwent redo surgery with favorable outcomes. One patient underwent redo surgery for peritonitis with a favorable result. Thus, 7 (22.6%) patients with caval vein injury died in intraoperative and early postoperative period. Non-specific complications occurred in 4 (12.9%) patients. These events were corrected by conservative measures. Other 24 (77.4%) patients with traumatic and iatrogenic injuries of caval veins were discharged. CONCLUSION: Caval vein injury is less common event compared to other vascular damages. Nevertheless, this complication is accompanied by severe blood loss, shock and hypovolemia. We can only assume damage to a great vessel in patients with penetrating wounds before surgery and appropriate symptoms of internal bleeding. However, final diagnosis is made during surgery. Hemostasis is a responsible and difficult surgical stage in these patients. There is usually no alternative to reconstructive surgery in these cases. However, ligation is permissible in extremely ill patients and only in infrarenal segment of IVC. Vascular suture is a more acceptable and effective option for reconstruction. However, patch repair is advisable for large defects. In our opinion, this approach is better regarding long-term patency compared to total replacement with synthetic prostheses.


Assuntos
Neoplasias do Mediastino , Traumatismos Torácicos , Lesões do Sistema Vascular , Ferimentos não Penetrantes , Ferimentos Penetrantes , Feminino , Humanos , Hipovolemia/patologia , Doença Iatrogênica , Masculino , Veia Cava Inferior/patologia , Veia Cava Inferior/cirurgia , Veia Cava Superior/lesões
16.
Medicine (Baltimore) ; 101(40): e30808, 2022 Oct 07.
Artigo em Inglês | MEDLINE | ID: mdl-36221402

RESUMO

The aim of the study was to assess short- and long-term results following radical nephrectomy with renal vein and inferior vena cava thrombectomy in patients with renal cell cancer with venous thrombus and to investigate impact of various demographical, clinical and histological factors on overall survival (OS). The medical records of 102 adult patients with renal cell cancer with venous thrombus admitted for surgery in Department of General, Vascular and Transplant Surgery from 2012 to 2019 were retrospectively analyzed. The tumor was more frequently located on the right side compared to the left one (55 vs. 47). According to Neves Zincke classification, the levels of venous thrombus were as follows: 1 to 48 (47%), 2 to 47 (46%), 3 to 6 (6%), and 4 to 1 (1%). Postoperative complications were noted in 16 (15.7%) patients. One (3%) patient (Neves Zincke 2) died of intraoperative pulmonary embolism during hospitalization. Clear cell carcinoma was the most common pathological type reported in 92 (90.2%) patients. Thirty nine (38.2%) patients were alive at the time of last follow-up. The median OS was 21.50 (0-101.17) months. The 1-year OS was 75.5%. Significantly better OS (median 38.03 months) was noted in patients with RCC Neves Zincke 1 compared to OS (median 14.79 months) in patients with Neves Zincke 2-4 VT (P = .008). Higher tumor staging (T3 vs. T4) (P = .038), nodal staging (N0 vs. N1) (P = .0008), Fuhrman histological grading (G1-2 vs. G3-4) (P = .033) were associated with a shorter OS. Patients with renal cell cancer with venous thrombus, with an acceptable perioperative risk, should be treated surgically, because radical nephrectomy with thrombectomy performed in a high volume surgical center is a safe procedure. Neves Zincke 2-4 venous thrombus, higher tumor and nodal staging, as well higher Fuhrman histological grading are associated with a shorter OS.


Assuntos
Carcinoma de Células Renais , Neoplasias Renais , Trombose , Adulto , Carcinoma de Células Renais/complicações , Carcinoma de Células Renais/cirurgia , Humanos , Neoplasias Renais/complicações , Neoplasias Renais/cirurgia , Nefrectomia/métodos , Estudos Retrospectivos , Trombectomia/métodos , Trombose/etiologia , Resultado do Tratamento , Veia Cava Inferior/patologia , Veia Cava Inferior/cirurgia
17.
J Cardiothorac Surg ; 17(1): 261, 2022 Oct 08.
Artigo em Inglês | MEDLINE | ID: mdl-36209231

RESUMO

Post-Acute COVID-19 syndrome (PACS) is considered to be one of the least understood post-infectious syndromes. We report a case of a 21-year-old female who had a history of SARS-CoV-2 infection and presented with a right atrioventricular thrombus associated with pulmonary embolism and thrombocytopenia. At the time of admission, she was not vaccinated against SARS-CoV-2, and her serological tests for IgG and IgM antibodies against SARS-CoV-2 were positive. The size of the thrombus measured approximately 6 × 8 × 4 cm, which also led to tricuspid valve insufficiency due to mechanical dilatation of the valve's ring. The right atrioventricular thrombus also extended up to the inferior vena cava, leading to mild congestive hepatomegaly. Moreover, during thrombectomy, the mass of the thrombus was attached to the interseptal right atrial wall. The histopathological assessment of the core mass revealed that it was a right atrial myxoma hidden inside that large thrombus. We suspect that the formation and propagation of the thrombus to that size occurs as a part of Post-Acute COVID-19 syndrome (PACS). This study reviews and discusses coronavirus disease 2019-relate to thrombus formation inside cardiac chambers in case of a cardiac tumor, like myxoma in the setting of post-acute phase COVID-19 syndrome.


Assuntos
COVID-19 , Neoplasias Cardíacas , Mixoma , Trombose , Adulto , COVID-19/complicações , Feminino , Átrios do Coração/patologia , Neoplasias Cardíacas/complicações , Humanos , Imunoglobulina G , Imunoglobulina M , Mixoma/complicações , Mixoma/diagnóstico , Mixoma/cirurgia , SARS-CoV-2 , Trombose/complicações , Veia Cava Inferior , Adulto Jovem
18.
J Coll Physicians Surg Pak ; 32(8): S101-S103, 2022 Aug.
Artigo em Inglês | MEDLINE | ID: mdl-36210661

RESUMO

Interrupted inferior vena cava (IVC) is a rare disease, occurring either in isolation or in association with asplenia or polysplenia syndromes. Infrahepatic part of the IVC is absent representing the failure of fusion of the vitelline and subcardinal embryological portions of the IVC. It is replaced by an enlarged azygos or hemiazygos vein continuing into the thorax, either into the superior vena cava or into the brachiocephalic veins. We present two cases of interrupted IVC, one occurring in isolation with hemiazygos continuation and discovered incidentally, and the second one is a child with azygos continuation, associated with polysplenia syndrome. Key Words: Inferior vena cava, Polysplenia, Azygous vein, Hemiazygos vein.


Assuntos
Cardiopatias Congênitas , Esplenopatias , Malformações Vasculares , Veia Ázigos/diagnóstico por imagem , Criança , Humanos , Malformações Vasculares/diagnóstico por imagem , Veia Cava Inferior/diagnóstico por imagem , Veia Cava Superior
19.
Cardiol Rev ; 30(6): 314-317, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36201242

RESUMO

Occlusive disease of the iliac veins or major intrathoracic veins have traditionally been managed by conservative management or by major vascular reconstructive procedures. Over the past 15-20 years, these lesions have become amenable to management with venous stents. Lesions in the iliac venous system are typically due to thrombus secondary to deep vein thrombosis, and lesions in the superior vena cava are due to either malignant intrathoracic lesions, indwelling central venous catheters, pacemaker leads, or enlarged nodes due to granulomatous disease. The success rate for implantation is between 92% and 95% and associated implantation complications vary between 2% and 5%. Primary patency of iliac stents is 70-90% at three years. Venous stents have higher patency in the treatment of stenotic lesions compared to totally occlusive lesions. Primary patency of stents placed in the superior vena cava is also about 70-90% and generally lower in lesions due to malignancy likely related to life expectancy. Stents in the venous system are associated with few complications at the time of insertion and have excellent long-term patency.


Assuntos
Veia Cava Inferior , Veia Cava Superior , Constrição Patológica/etiologia , Constrição Patológica/cirurgia , Humanos , Estudos Retrospectivos , Stents , Resultado do Tratamento , Grau de Desobstrução Vascular , Veia Cava Inferior/cirurgia
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...