Your browser doesn't support javascript.
loading
Show: 20 | 50 | 100
Results 1 - 20 de 5.930
Filter
1.
Nurse Educ ; 2021 Apr 29.
Article in English | MEDLINE | ID: mdl-33950026

ABSTRACT

BACKGROUND: Global partnerships amplify nursing leadership capacity in low-resource countries through targeted education efforts. PURPOSE: We examined a nursing faculty partnership between US and Haitian universities, where Haitian faculty completed graduate-level degrees highlighting leadership and education. This marked the first time a Haitian university awarded a master's of nursing degree. METHODS: Longitudinal qualitative research data collection included interviews and observations among 28 participants. Recurrent cross-sectional analysis explored themes and perceived changes in leadership behaviors. RESULTS: Advanced professional stature, leadership as a nurse educator and in the clinical setting, transformational leadership, and challenges to leadership practice were key themes. Graduate nursing education resulted in an improved vision of nursing, increased perceptions of leadership capacities, and advanced management strategies. CONCLUSIONS: This partnership led to an Office of Nursing Education at the State University of Haiti, a milestone in the advancement of nursing in this low-resource country.

2.
Article in English | MEDLINE | ID: mdl-33797503

ABSTRACT

BACKGROUND: The Caribbean is a unique region of islands and cays home to nearly 43 million people. A significant challenge facing this population is the burden of traumatic brain injury, which disproportionately affects younger individuals and carries a significant economic burden. A preventive measure to reduce this burden is consistent wearing of helmets. This study aims to assess TBI prevention through helmet safety in Caribbean nations in order to demonstrate the regional impact of public health solutions. METHODS: We assess the member states of the Caribbean Community (CARICOM) and sought to evaluate CARICOM nations' TBI prevention through helmet safety with relation to public health, policy, laws, infrastructure, and regulations. We produced the Rolle Scoring System (RSS) to ascertain the influence of governance around helmet safety for TBI prevention. The RSS aims to provide a quantifiable method of how well a CARICOM nation is performing in efforts to reduce TBI. The RSS is broken down into 2 categories, with scores ranging from 1 (worst) to 5 (best). The range of possible scores a CARICOM nation could receive was 8 to 40. RESULTS: Fourteen CARICOM nations were ultimately incorporated into our analysis. From the initial cohort, 3 were removed. These nations were Anguilla, Saint Kitts & Nevis, and Montserrat. We analyzed values derived from the RSS, finding a mean Rolle score of 22. We further subdivided the nations into low Rolle score (8-24) and high Rolle score (>24). Trinidad and Tobago had the highest Rolle score at 29. Haiti was found to have the lowest Rolle score at 8. CONCLUSION: Several Caribbean nations have demonstrated leadership pertaining to TBI prevention through helmet safety. The regional momentum of helmet safety in the Caribbean can serve as a model for other geographical regional blocs that share interests and culture to consider comprehensive approaches to public health challenges.

3.
PLoS One ; 16(4): e0247975, 2021.
Article in English | MEDLINE | ID: mdl-33822795

ABSTRACT

BACKGROUND: In Haiti, differences in the prevalence of anemia between urban and rural areas have been observed. OBJECTIVE: To identify moderating factors that may help explain the difference in the prevalence of anemia in children from poor urban vs. rural areas of Haiti. METHODS: This cross-sectional study used secondary data from urban and rural school-based trials that assessed the effectiveness of a nutrition intervention. The study was registered at ClinicalTrials.gov as NCT02747524. A total of 300 rural- and 981 urban- children between 2.5-13 years of age were included in this analysis. Effect modification in a binary logistic generalized linear mixed model was conducted using sample weights in SPSS® version 26. Models were adjusted for age and income. School cluster was included as random effect. RESULTS: In rural areas, stunting was more prevalent in children with anemia vs. no anemia, (16.6%, and 6.3%, P = 0.008), respectively. Also, rural children with anemia lived with fewer adults vs. rural children with no anemia, ([Formula: see text] = 2.83±1.29, and 3.30±1.54, P = 0.005), respectively. In poor urban areas, helminth morbidities were more frequent in children with anemia vs. no anemia, (21.9% vs. 13.9, P = 0.011), respectively. In the combined sample, stunting, [AOR = 2.05; 95%CI (1.32-3.18)], age [AOR = 0.89; 95%CI (0.85-0.93)], and households with more adults [AOR = 0.77; 95%CI (0.67-0.87)] were associated with anemia. Effect modification by place of residence was observed in households with more adults (t = 3.83, P<0.001). No other nutritional, dietary, sanitation or morbidity factors or effect modifiers were observed. CONCLUSIONS: In this sample, factors associated with anemia differed in poor urban and rural children from Haiti including family structure and helminth morbidities. Stunting and lower age increased the odds of anemia in the combined sample. Family structure appears to have an important role in anemia, and further research understanding the influence of family structures in anemia is needed.

4.
Prehosp Disaster Med ; : 1-5, 2021 Apr 22.
Article in English | MEDLINE | ID: mdl-33883053

ABSTRACT

BACKGROUND: Prehospital care is a key component of an emergency care system. Prehospital providers initiate patient care in the field and transition it to the emergency department. Emergency Medicine (EM) specialist training programs are growing rapidly in low- and middle-income countries (LMICs), and future emergency physicians will oversee emergency care systems. Despite this, no standardized prehospital care curriculum exists for physicians in these settings. This report describes the development of a prehospital rotation for an EM residency program in Central Haiti. METHODS: Using a conceptual framework, existing prehospital curricula from high-income countries (HICs) were reviewed and adapted to the Haitian context. Didactics covering prehospital care from LMICs were also reviewed and adapted. Regional stakeholders were identified and engaged in the curriculum development. RESULTS: A one-week long, 40-hour curriculum was developed which included didactic, clinical, evaluation, and assessment components. All senior residents completed the rotation in the first year. Feedback was positive from residents, field sites, and students. CONCLUSIONS: A standardized prehospital rotation for EM residents in Haiti was successfully implemented and well-received. This model of adaptation and local engagement can be applied to other residency programs in low-income countries to increase physician engagement in prehospital care.

5.
Am J Trop Med Hyg ; 2021 Apr 05.
Article in English | MEDLINE | ID: mdl-33819177

ABSTRACT

Haiti is targeting malaria elimination by 2025. The Grand'Anse department in southwestern Haiti experiences one-third to half of all nationally reported Plasmodium falciparum cases. Although there are historical reports of Plasmodium vivax and Plasmodium malariae, today, non-falciparum infections would remain undetected because of extensive use of falciparum-specific histidine-rich protein 2 (HRP2) rapid diagnostic tests (RDT) at health facilities. A recent case-control study was conducted in Grand'Anse to identify risk factors for P. falciparum infection using HRP2-based RDTs (n = 1,107). Post hoc multiplex Plasmodium antigenemia and antibody (IgG) detection by multiplex bead assay revealed one blood sample positive for pan-Plasmodium aldolase, negative for P. falciparum HRP2, and positive for IgG antibodies to P. malariae. Based on this finding, we selected 52 samples with possible P. malariae infection using IgG and antigenemia data and confirmed infection status by species-specific PCR. We confirmed one P. malariae infection in a 6-month-old infant without travel history. Congenital P. malariae could not be excluded. However, our finding-in combination with historical reports of P. malariae-warrants further investigation into the presence and possible extent of non-falciparum malaria in Haiti. Furthermore, we showed the use of multiplex Plasmodium antigen and IgG detection in selecting samples of interest for subsequent PCR analysis, thereby reducing costs as opposed to testing all available samples by PCR. This is of specific use in low-transmission or eliminating settings where infections are rare.

6.
Am J Trop Med Hyg ; 2021 Apr 19.
Article in English | MEDLINE | ID: mdl-33872208

ABSTRACT

In 2006, Haiti committed to malaria elimination when the transmission was thought to be low, but before robust national parasite prevalence estimates were available. In 2011, the first national population-based survey confirmed the national malaria parasite prevalence was < 1%. In both 2014 and 2015, Haiti reported approximately 17,000 malaria cases identified passively at health facilities. To detect malaria transmission hotspots for targeting interventions, the National Malaria Control Program (NMCP) piloted an enhanced geographic information surveillance system in three departments with relatively high-, medium-, and low-transmission areas. From October 2014-September 2015, NMCP staff abstracted health facility records of confirmed malaria cases from 59 health facilities and geo-located patients' households. Household locations were aggregated to 1-km2 grid cells to calculate cumulative incidence rates (CIRs) per 1,000 persons. Spatial clustering of CIRs were tested using Getis-Ord Gi* analysis. Space-time permutation models searched for clusters up to 6 km in distance using a 1-month malaria transmission window. Of the 2,462 confirmed cases identified from health facility records, 58% were geo-located. Getis-Ord Gi* analysis identified 43 1-km2 hotspots in coastal and inland areas that overlapped primarily with 13 space-time clusters (size: 0.26-2.97 km). This pilot describes the feasibility of detecting malaria hotspots in resource-poor settings. More data from multiple years and serological household surveys are needed to assess completeness and hotspot stability. The NMCP can use these pilot methods and results to target foci investigations and malaria interventions more accurately.

7.
JBJS Case Connect ; 11(2)2021 04 15.
Article in English | MEDLINE | ID: mdl-33857023

ABSTRACT

CASE: We present a clinical case and technique guide demonstrating the use and effectiveness of a novel, low-cost negative pressure wound therapy (NPWT) device to achieve soft-tissue coverage in a 34-year-old patient with failed rotational flap and Masquelet technique on infected tibial nonunion. Local debridement was executed, NPWT initiated, and treatment culminated with complete wound healing. CONCLUSION: The "Turtle VAC" offers an effective low-cost alternative to commercially vacuum-assisted closure systems for post-traumatic wounds in low-resource setting of Haiti. Its use of available equipment makes NPWT accessible and can function as a bridge to definitive closure when primary wound closure is not possible and/or between debridement procedures.

8.
Transcult Psychiatry ; : 13634615211000543, 2021 Apr 09.
Article in English | MEDLINE | ID: mdl-33832369

ABSTRACT

Research on mental health in specific communities requires careful attention to cultural context and language. Studies on global mental health have increasingly analyzed idioms of distress, or culturally situated ways of conceptualizing, experiencing, and expressing distress. This study examines how idioms of distress are used and understood in Arcahaie, Haiti. The goal was to enrich current understanding of mental health conceptualization and communication by exploring the heterogeneity of common idioms of distress. Interviews with community members (N = 47) explored meanings and perceived causations of 13 idioms of distress. Major themes included pervasiveness of poverty, ruminative thinking, effects of Vodou and Christian belief systems, embodied distress, and the behavior of "crazy" people (moun fou). The findings suggest some specific pathways for potential community engagement projects, including training lay-leaders in cognitive behavioral therapy using existing socioreligious infrastructure and expanding access to social engagement activities. This research contributes to a small but growing body of literature on mental illness in Haiti and to methods for studying idioms of distress.

9.
Glob Public Health ; 16(5): 651-663, 2021 May.
Article in English | MEDLINE | ID: mdl-33904384

ABSTRACT

This special issue of Global Public Health brings together papers examining how sexuality, gender, health and human rights have become increasing visible and highly contested within global health. The papers included here question and explore the often contradictory processes through which global equity-seeking populations negotiate pleasure and danger across multiple arenas (including HIV and AIDS, LGBTQ+ health and rights, intersex rights, sex worker rights, realities of refugee and displaced persons, and gender-based violence) and in diverse geographic contexts (Afghanistan, Bangladesh, Canada, Ghana, Haiti, Kenya, Mauritania, Nigeria, Peru, Rwanda, and the USA). These papers examine emerging questions about the gaps and limits in current legal structures that do not legitimize sexual rights as fundamental human rights, the role of agency (and of bounded agency) needed to navigate constrained contexts, ways in which community-based solidarity efforts shape access to sexual rights, and how sexual pleasure and consent are experienced and negotiated in rights-constrained contexts. The interdisciplinary authors included in this collection showcase how the ranging definitions of sexual rights, their enactment, and expressions of pleasure and danger are inextricably entangled with local contexts and cultural systems that underpin not only people's lived experience but simultaneously become central topics for global health research, policy and practice.

10.
BMC Pregnancy Childbirth ; 21(1): 317, 2021 Apr 21.
Article in English | MEDLINE | ID: mdl-33882864

ABSTRACT

BACKGROUND: Obstetric haemorrhage is the leading cause of maternal death worldwide, 99% of which occur in low and middle income countries. The majority of deaths and adverse events are associated with delays in identifying compromise and escalating care. Management of severely compromised pregnant women may require transfer to tertiary centres for specialised treatment, therefore early recognition is vital for efficient management. The CRADLE vital signs alert device accurately measures blood pressure and heart rate, calculates the shock index (heart rate divided by systolic blood pressure) and alerts the user to compromise through a traffic light system reflecting previously validated shock index thresholds. METHODS: This is a planned secondary analysis of data from the CRADLE-3 trial from ten clusters across Africa, India and Haiti where the device and training package were randomly introduced. Referral data were prospectively collected for a 4-week period before, and a 4-week period 3 months after implementation. Referrals from primary or secondary care facilities to higher level care for any cause were recorded. The denominator was the number of women seen for maternity care in these facilities. RESULTS: Between April 1 2016 and Nov 30th, 2017 536,223 women attended maternity care facilities. Overall, 3.7% (n = 2784/74,828) of women seen in peripheral maternity facilities were referred to higher level care in the control period compared to 4.4% (n = 3212/73,371) in the intervention period (OR 0.89; 0.39-2.05) (data for nine sites that were able to collect denominator). Of these 0.29% (n = 212) pre-intervention and 0.16% (n = 120) post-intervention were referred to higher-level facilities for maternal haemorrhage. Although overall referrals did not significantly reduce there was a significant reduction in referrals for obstetric haemorrhage (OR 0.56 (0.39-0.65) following introduction of the device with homogeneity (i-squared 26.1) between sites. There was no increase in any bleeding-related morbidity (maternal death or emergency hysterectomy). CONCLUSIONS: Referrals for obstetric haemorrhage reduced following implementation of the CRADLE Vital Signs Alert Device, occurring without an increase in maternal death or emergency hysterectomy. This demonstrates the potential benefit of shock index in management pathways for obstetric haemorrhage and targeting limited resources in low- middle- income settings. TRIAL REGISTRATION: This study is registered with the ISRCTN registry, number ISRCTN41244132 (02/02/2016).

11.
Washington, D.C.; PAHO; 2021-04-23.
in English, Spanish | PAHO-IRIS | ID: phr-53825

ABSTRACT

In 2021, between epidemiological week (EW) 1 and EW 15, two countries have reported confirmed cases of diphtheria: the Dominican Republic with 12 confirmed cases including 9 deaths, and Haiti with 11 confirmed cases including 2 deaths. Both countries are located on the island of Hispaniola. In the Region of the Americas, between 1978 and 2019, the vaccination coverage with three and four doses of the diphtheria, tetanus, and pertussis vaccine (DTP3 and DTP4) were each below 95%. The annual DTP3 coverage since 1978 has been less than 95%, with an average of 90% between 2010 and 2019 (range: 84%-94%). Meanwhile, data on DTP4 coverage has been available since 2006, and reached a maximum coverage of 86% in 2012.


En 2021, entre la semana epidemiológica (SE) 1 y la SE 15, dos países notificaron casos confirmados: Haití con 11 casos, incluida 2 defunciones y la República Dominicana con 12 casos confirmados incluidas 10 defunciones. Ambos países ubicados en la isla La Española. En la Región de las Américas, entre 1978 y 2019, la cobertura de la tercera y cuarta dosis de la vacuna contra la difteria, el tétanos y pertusis (DPT 3 y DPT 4) se encontraron por debajo del 95%. La cobertura de DPT 3 desde 1978 se encuentra por debajo de 95% y tuvo un promedio de 90% entre 2010 y 2019 (rango: 84% - 94%), mientras que la vacunación con DPT4 cuyo registro está disponible desde el año 2006, alcanzó a un máximo de cobertura de 86% en 2012.


Subject(s)
Coronavirus Infections , Coronavirus Infections , Coronavirus , Betacoronavirus , Vaccination , Emergencies , Vaccines , International Health Regulations , Americas , Caribbean Region , Diphtheria , Coronavirus Infections , Vaccination , Vaccines , Emergencies , International Health Regulations , Diphtheria , Americas , Caribbean Region , Diphtheria-Tetanus-Pertussis Vaccine , Diphtheria-Tetanus-Pertussis Vaccine
12.
Lancet HIV ; 8(5): e266-e273, 2021 May.
Article in English | MEDLINE | ID: mdl-33891877

ABSTRACT

BACKGROUND: There are few data on life expectancy gains among people living with HIV in low-income and middle-income settings where antiretroviral therapy (ART) is increasingly available. We aimed to analyse life expectancy trends from 2003 to 2017 among people with HIV beginning treatment with ART within the Caribbean, central America, and South America. METHODS: We did a multisite retrospective cohort study and included people with HIV who had started treatment with ART and were aged 16 years or older between Jan 1, 2003, and Dec 31, 2017, from Caribbean, Central and South America network for HIV epidemiology (CCASAnet) sites in Argentina, Brazil, Chile, Haiti, Honduras, Mexico, and Peru, who contributed person-time data from the age of 20 years until date of death, last contact, database closure, or Dec 31, 2017. We used the Chiang method of abridged life tables to estimate life expectancy at age 20 years for three eras (2003-08, 2009-12, and 2013-17) overall and by demographic and clinical characteristics at ART initiation. We used Poisson regression models to weight mortality rates to account for informative censoring. FINDINGS: 30 688 people with HIV were included in the study; 17 491 (57·0%) were from the Haiti site and 13 197 (43·0%) were from all other sites. There were 2637 deaths during the study period: 1470 in Haiti and 1167 in other sites. Crude and weighted mortality rates decreased among all age groups over calendar eras. From 2003-08 to 2013-17, overall life expectancy for people with HIV at age 20 years increased from 13·9 years (95% CI 12·5-15·2) to 61·2 years (59·0-63·4) in Haiti and from 31·0 years (29·3-32·8) to 69·5 years (67·2-71·8) in other sites. Life expectancies at the end of the study period were within 10 years of those of the general population (69·9 years in Haiti and 78·0 years in all other sites in 2018). Disparities in life expectancy among people with HIV by sex or HIV transmission risk factor, CD4 cell count, level of education, and history of tuberculosis at or before ART initiation persisted across calendar eras. INTERPRETATION: Life expectancy among people with HIV receiving ART has significantly improved in Latin America and the Caribbean. Persistent disparities in life expectancy among people with HIV by demographic and clinical factors at ART initiation highlight vulnerable populations in the region. FUNDING: National Institutes of Health. TRANSLATION: For the Spanish translation of the abstract see Supplementary Materials section.

13.
J Glob Health ; 11: 04020, 2021 Apr 17.
Article in English | MEDLINE | ID: mdl-33884191

ABSTRACT

Background: The prevalence of non-communicable diseases (NCDs) is rising in low and middle-income countries (LMIC). We aimed to report on the prevalence of NCDs in pregnancy and their associated perinatal outcomes in a regional hospital in Haiti. Methods: We conducted the "Diabète et hYpertension Artéerielle et leurs issues MAternelles et Néonatales" (DYAMAN) prospective cohort study in a regional hospital in Haiti. Pregnant women presenting to care at 24-28 weeks were screened and treated for diabetes (DM) and hypertensive disorders of pregnancy (HDP) using setting-adapted protocols. Prevalence of NCDs and associated maternal-neonatal outcomes were described. Results: 715 women were included, of which 51 (7.1%) had DM, 90 (12.6%) had HDP, and 30 (4.2%) had both DM and HDP (DM/HDP). Of 422 (59%) women delivered in hospital, 58 (13.7%) had preeclampsia, including 5 (8.6%) with eclampsia. Preterm birth <32 weeks was more common in the HDP than the control, DM, and DM/HDP groups. More low birth weight babies (n = 20, 25.6%) were born to the HDP group than to the control (n = 20, 7.1%), DM (n = 1, 2.7%), and DM/HDP (n = 3, 12%) groups (P < 0.001). Macrosomia and hypoglycemia affected 5 (8%) neonates of women with DM. Perinatal mortality, affecting 36/1000 births, was mainly driven by maternal NCDs. Conclusions: NCDs in pregnancy led to adverse maternal and perinatal outcomes. This study will help to prepare future refinements aimed at optimizing the management of NCDs in pregnancy in LMIC. Research is required to understand barriers to patient attendance at antenatal follow-up, treatment escalation for hyperglycemia, and in-hospital delivery.

14.
Am J Mens Health ; 15(2): 15579883211006003, 2021.
Article in English | MEDLINE | ID: mdl-33874810

ABSTRACT

This mixed-methods study aimed to determine the level of male involvement in the prevention of mother-to-child transmission (PMTCT) services in Haiti and identify barriers and associated factors. From May to June 2018, a questionnaire was used to measure the level of male involvement. Semistructured interviews with pregnant women were also conducted. Multivariate linear regression and qualitative content analyses were performed to explore factors associated and barriers to male partners' involvement in PMTCT services. One hundred and two pregnant women living with HIV completed the questionnaire. About 47% of male partners had a high level of involvement. Specifically, 90% financially supported their spouse, and 82% knew her appointment date at the antenatal clinic (ANC). Only 25% of male partners accompanied their spouse to the ANC, and 19% routinely used a condom during sexual intercourse. Factors associated with male involvement in PMTCT were being married and sharing HIV status with the male partner. Male partners with a positive HIV status were more likely to be involved in PMTCT. Qualitative findings revealed that barriers to male involvement included the conflict between opening hours of the ANC and the male partner's schedule, waiting time at the ANC, and the perception of antenatal care as being women's business. Overall male partners' involvement in PMTCT services is moderate. Gender relations, sociocultural beliefs, and care organization are likely to hinder this involvement. Developing and implementing contextually and culturally accepted strategies for male partners of pregnant women could contribute to strengthening their involvement in the PMTCT program.

15.
Viruses ; 13(3)2021 03 18.
Article in English | MEDLINE | ID: mdl-33803868

ABSTRACT

Haïti is at risk for wild poliovirus (WPV) importation and circulation, as well as vaccine-derived poliovirus (VDPV) emergence. Environmental surveillance (ES) for polioviruses was established in Port au Prince and Gonaïves in 2016. During 2017-2019, initial ES sites were re-evaluated, and ES was expanded into Cap Haïtien and Saint Marc. Wastewater samples and data on weather, hour of collection, and sample temperature and pH were collected every 4 weeks during March 2017-December 2019 (272 sampling events) from 21 sites in Cap Haïtien, Gonaïves, Port au Prince, and Saint Marc. Samples were processed for the detection of polio and non-polio enteroviruses using the two-phase and "Concentration and Filter Elution" methodologies. Polioviruses were serotyped and underwent intra-typic characterization. No WPV or VDPVs were isolated. Sabin-like polioviruses (oral vaccine strain) of serotypes 1 and 3 were sporadically detected. Five of six (83%), one of six (17%), five of six (83%), and two of three (67%) sites evaluated in Cap Haïtien, Gonaïves, Port au Prince, and Saint Marc, respectively, had enterovirus isolation from >50% of sampling events; these results and considerations, such as watershed population size and overlap, influence of sea water, and excessive particulates in samples, were factors in site retention or termination. The evaluation of 21 ES sampling sites in four Haïtian cities led to the termination of 11 sites. Every-four-weekly sampling continues at the remaining 10 sites across the four cities as a core Global Polio Eradication Initiative activity.

16.
RECIIS (Online) ; 15(1): 249-267, jan.-mar. 2021. ilus
Article in Portuguese | LILACS | ID: biblio-1177454

ABSTRACT

Com a globalização, os fluxos migratórios intensificaram-se e as razões financeiras são umas das principais impulsionadoras de tais eventos. As populações migrantes têm diferentes necessidades, sendo o acesso à saúde algo primordial para garantir a qualidade de vida. Assim, este estudo objetivou analisar a produção científica sobre atenção à saúde de imigrantes internacionais haitianos em diferentes contextos e países, buscando compreender quais são os desafios e as perspectivas para a atenção à saúde dessa população nos contextos investigados. Trata-se de uma Revisão Integrativa de Literatura, realizada a partir de pesquisas nas bases Sistema Online de Busca e Análise de Literatura Médica (Medline/PubMed) e Scientific Electronic Library Online (SciELO), com os descritores padronizados 'Health Care' ('Public Health'), 'Haiti' e 'Emigrants and Immigrants', combinados por meio do operador booleano AND. Selecionaram-se artigos publicados no período de 2015 a 2019 que fossem em português, inglês ou espanhol e que tratassem desse tema. A partir da análise dos artigos, identificaram-se três categorias de análise temática: Impactos das regulamentações imigratórias na integração dos imigrantes haitianos; Competência intercultural para a atenção à saúde de imigrantes haitianos; e Condições de saúde e acesso a serviços por imigrantes haitianos. Destaca-se a importância da inclusão de aspectos políticos interculturais nas políticas de saúde voltadas à atenção à saúde do imigrante.


With globalization, migration flows have intensified and financial reasons are one of the main drivers of these events. Migrant populations have different needs, and access to health is essential to ensure their quality of life. Accordingly, this study aimed to analyze the scientific production on health care of international Haitian immigrants in different contexts and countries, seeking to understand what are the challenges and perspectives for the health care of this population in the investigated contexts. This is an Integrative Literature Review, performed from searches in the Medical Literature Analysis and Retrieval System Online (Medline/PubMed) and Scientific Electronic Library Online (SciELO), with the standardized descriptors 'Health Care' ('Public Health'), 'Haiti' and 'Emigrants and Immigrants', combined through the Boolean operator AND. We selected articles published in the period 2015-2019, in Portuguese, English or Spanish, that dealt with this theme. From the analysis of the articles, we identified three categories of thematic analysis: Impacts of immigration regulations on the integration of Haitian immigrants; Intercultural competency for the health care for Haitian immigrants; and Health conditions and access to services by Haitian immigrants. We should highlight the importance of including intercultural political aspects in health policies focused on the health care for immigrants.


Con la globalización, los flujos migratorios se han intensificado y las razones financieras son uno de los principales impulsores de tales eventos. Las poblaciones migrantes tienen diferentes necesidades, siendo el acceso a la salud fundamental para garantizar la calidad de vida. Así, este estudio tuvo como objetivo analizar la producción científica en salud de inmigrantes haitianos internacionales en diferentes contextos y países, buscando comprender cuáles son los desafíos y perspectivas para la atención de la salud de esta población en los contextos investigados. Se trata de una Revisión Integrativa de Literatura, realizada a partir de la investigación del Sistema de Análisis y Búsqueda de Literatura Médica en Línea (Medline / PubMed) y Biblioteca Electrónica Científica en Línea (SciELO), con los descriptores estandarizados 'Health Care' ('Salud Pública'), 'Haití' y 'Emigrantes e inmigrantes', combinados a través del operador booleano AND. Se seleccionaron artículos publicados en el período de 2015 a 2019 que estuvieran en portugués, inglés o español y abordaran este tema. Del análisis de los artículos se identificaron tres categorías de análisis temático: Impactos de las regulaciones migratorias en la integración de inmigrantes haitianos; Competencia intercultural para la atención de la salud de los inmigrantes haitianos; y Condiciones de salud y acceso a servicios de inmigrantes haitianos. Se destaca la importancia de incluir aspectos políticos interculturales en las políticas de salud dirigidas a la atención de la salud de los inmigrantes.


Subject(s)
Humans , Public Policy , Emigration and Immigration , Cultural Competency , Culturally Competent Care , Haiti , Review Literature as Topic , Social Vulnerability , Travelers' Health , Health Services Needs and Demand
17.
JAMA Netw Open ; 4(3): e210307, 2021 Mar 01.
Article in English | MEDLINE | ID: mdl-33646313

ABSTRACT

Importance: Rates of breast and ovarian cancer are high in the Caribbean; however, to date, few published data quantify the prevalence of inherited cancer in the Caribbean population. Objective: To determine whether deleterious variants in genes that characterize the hereditary breast and ovarian cancer syndrome are associated with the development of breast and ovarian cancer in the English- and Creole-speaking Caribbean populations. Design, Setting, and Participants: This multisite genetic association study used data from germline genetic test results between June 2010 and June 2018 in the Bahamas, Cayman Islands, Barbados, Dominica, Jamaica, Haiti, and Trinidad and Tobago. Next-generation sequencing on a panel of 30 genes and multiplex ligation-dependent probe amplification (BRCA1 and BRCA2) were performed. Medical records were reviewed at time of study enrollment. Women and men diagnosed with breast and ovarian cancer with at least 1 grandparent born in the participating study sites were included; 1018 individuals were eligible and consented to participate in this study. Data were analyzed from November 4, 2019, to May 6, 2020. Exposures: Breast and/or ovarian cancer diagnosis. Main Outcomes and Measures: Rate of inherited breast and ovarian cancer syndrome and spectrum and types of variants. Results: Of 1018 participants, 999 (98.1%) had breast cancer (mean [SD] age, 46.6 [10.8] years) and 21 (2.1%) had ovarian cancer (mean [SD] age, 47.6 [13.5] years). Three individuals declined to have their results reported. A total of 144 of 1015 (14.2%) had a pathogenic or likely pathogenic (P/LP) variant in a hereditary breast and ovarian cancer syndrome gene. A total of 64% of variant carriers had P/LP variant in BRCA1, 23% in BRCA2, 9% in PALB2 and 4% in RAD51C, CHEK2, ATM, STK11 and NBN. The mean (SD) age of variant carriers was 40.7 (9.2) compared with 47.5 (10.7) years in noncarriers. Individuals in the Bahamas had the highest proportion of hereditary breast and ovarian cancer (23%), followed by Barbados (17.9%), Trinidad (12%), Dominica (8.8%), Haiti (6.7%), Cayman Islands (6.3%), and Jamaica (4.9%). In Caribbean-born women and men with breast cancer, having a first- or second-degree family member with breast cancer was associated with having any BRCA1 or BRCA2 germline variant (odds ratio, 1.58; 95% CI, 1.24-2.01; P < .001). A BRCA1 vs BRCA2 variant was more strongly associated with triple negative breast cancer (odds ratio, 6.33; 95% CI, 2.05-19.54; P = .001). Conclusions and Relevance: In this study, among Caribbean-born individuals with breast and ovarian cancer, 1 in 7 had hereditary breast and ovarian cancer. The proportion of hereditary breast and ovarian cancer varied by island and ranged from 23% in the Bahamas to 4.9% in Jamaica. Each island had a distinctive set of variants.

18.
Plant Dis ; 2021 Mar 05.
Article in English | MEDLINE | ID: mdl-33673773

ABSTRACT

Rhizome rot or soft rot disease is one of the major problems in banana (Musa spp.) cultivation, as it causes germination failure and death of early stage plants. A roving survey conducted during 2017 to 2019 in the major banana growing states of India indicated a 5-30% incidence of rhizome rot in commercial cultivars. The symptoms observed were yellowing of leaves, necrotic drying with or without heart rot, and yellow or brown water soaked spots with dark brown margins in the rhizomes. Decay of tissues, cavity formation and brown ooze with foul smell, and toppling were also observed. To isolate bacteria, dissected diseased tissues were surface sterilized and plated on Crystal Violet Pectate (CVP) medium. Of 60 samples plated on CVP medium, three samples collected from cvs. NeyPoovan-AB (Karur, Tamil Nadu, 10°56'36.8"N;78°24'12.5"E), Grand Naine-AAA (Tiruchirappalli, Tamil Nadu, 10°47'26.1"N;78°34'14.8"E) and Thellachakkarakeli-AAA (East-Godavari, Andhra Pradesh, 16°51'32.1"N;81°46'08.4"E), did not yield any bacteria; however, when plated on nutrient agar, they produced whitish to dull white, mucoid, raised, round and translucent colonies, and three isolates were named as NPK-3-48, GTC-5 and 1-1B-3, respectively. Because these colonies were distinct from colonies obtained on CVP medium (which were analyzed and confirmed separately as Pectobaterium sp.) (Gokul et al. 2019), they were further characterized. Amplification of 16S rDNA genes of NPK-3-48, GTC-5 and 1-1B-3 isolates using universal primers (27F 5' - AGAGTTTGATCCTGGCTCAG - 3'; 1492 R 5' - GGTTACCTTGTTACGACTT - 3') and rpoB gene (Rosenblueth et al. 2004) was carried; the amplicons were sequenced and deposited in NCBI (Accessions MW036529-MW036531; MW497572-MW497574). Phylogenetic analysis of rpoB clearly showed that the isolates NPK-3-48, GTC-5, 1-1B-3 are Klebsiella variicola (Rosenblueth et al. 2004) Besides, biochemical tests also indicated that all three isolates were Gram negative, catalase positive, oxidase negative and able to utilize glucose, maltose and citrate (Ajayasree and Borkar 2018). Therefore, the above said morphological, molecular and biochemical analyses carried out indicated that NPK-3-48, GTC-5, 1-1B-3 are of K. variicola. Earlier, K. variicola causing soft rot has been reported on banana in China (Fan et al. 2016), plantain soft rot in Haiti (Fulton et al. 2020) and carrot soft rot in India (Chandrashekar et al. 2018). For pathogenicity tests, these three isolates were grown in nutrient broth for 48 h at 37±1°C and the cells were harvested by centrifugation. Five milliliters of the culture suspension (2×108 CFUmL-1) taken in a syringe was injected into rhizomes of three month old tissue cultured Grand Naine plants. Each bacterial isolate was injected into eight banana plants at soil level. Appropriate controls were maintained. Inoculated plants were maintained in a glasshouse at 32±2°C and after 30-35 days, rhizome rot symptoms appeared in all the three bacterial isolates inoculated plants but in none of the control plants. The Koch's postulates were proved by re-isolation and identification.To the best of our knowledge, this is the first report of K. variicola causing rhizome rot disease of banana in India.

19.
BMC Pediatr ; 21(1): 143, 2021 Mar 24.
Article in English | MEDLINE | ID: mdl-33761917

ABSTRACT

BACKGROUND: Low birthweight (LBW) infants are at higher risk of mortality and morbidity (growth, chronic disease and neurological problems) during their life. Due to the high incidence of (pre-) eclampsia in Haiti, LBW infants are common. We assessed the anthropometric growth (weight and length) and neurodevelopmental delay in LBW and normal birthweight (NBW) infants born at an obstetric emergency hospital in Port au Prince, Haiti, between 2014 and 2017. METHODS: Infants were followed at discharge and 3, 6, 12, 15, 18, 21 and 24 months of corrected gestational age. At each visit they underwent a physical checkup (weight, length, physical abnormalities, identification of morbidities). At 6, 12, 18 and 24 months they underwent a neurodevelopmental assessment using the Bayley Scale III (motor, cognitive and communication skills). We modelled the trajectories between birth and 24 months of age of NBW compared to LBW infants for weight, length, and raw scores for Bayley III assessments using mixed linear models. RESULTS: In total 500 LBW and 210 NBW infants were recruited of which 333 (46.7%) were followed up for 24 months (127 NBW; 60.5% and 206 LBW; 41.2%) and 150 died (LBW = 137 and NBW = 13). LBW and NBW babies gained a mean 15.8 g and 11.4 g per kg of weight from discharge per day respectively. The speed of weight gain decreased rapidly after 3 months in both groups. Both groups grow rapidly up to 6 months of age. LBW grew more than the NBW group during this period (22.8 cm vs. 21.1 cm). Both groups had WHZ scores <- 2 up to 15 months. At 24 months NBW babies scored significantly higher on the Bayley scales for gross motor, cognitive and receptive and expressive communication skills. There was no difference between the groups for fine motor skills. CONCLUSION: LBW babies that survive neonatal care in urban Haiti and live up to 24 months of age, perform similar to their NBW for weight, length and fine motor skills. LBW babies are delayed in gross motor, cognitive and communication skills development. Further research on the clinical significance of these findings and long term implications of this neurodevelopmental delay is needed.

20.
PLoS One ; 16(3): e0247750, 2021.
Article in English | MEDLINE | ID: mdl-33730043

ABSTRACT

BACKGROUND: On October 4, 2016, Hurricane Matthew struck southwest Haiti as a category 4 storm. The goal of this study was to evaluate the impact of the hurricane on tuberculosis (TB) services and patient outcomes in the three severely affected departments-Sud, Grand'Anse, and Nippes-of southwest Haiti. METHODS: We developed a standard questionnaire to assess a convenience sample of health facilities in the affected areas, a patient tracking form, and a line list for tracking all patients with drug-susceptible TB registered in care six months before the hurricane. We analyzed data from the national TB electronic surveillance system to determine outcomes for all patients receiving anti-TB treatment in the affected areas. We used logistic regression analysis to determine factors associated with treatment success. RESULTS: Of the 66 health facilities in the three affected departments, we assessed 31, accounting for 536 (45.7%) of 1,174 TB patients registered in care when Hurricane Matthew made landfall in Haiti. Three (9.7%) health facilities sustained moderate to severe damage, whereas 18 (58.1%) were closed for <1 week, and five (16.1%) for ≥1 week. Four weeks after the hurricane, 398 (73.1%) of the 536 patients in the assessed facilities were located. Treatment success in the affected departments one year after the hurricane was 81.4%. Receiving care outside the municipality of residence (adjusted odds ratio [aOR]: 0.46, 95% confidence interval [CI]: 0.27-0.80) and HIV positivity (aOR: 0.31, 95% CI: 0.19-0.51) or unknown HIV status (aOR: 0.49, 95% CI: 0.33-0.74) were associated with significantly lower rates of treatment success. CONCLUSIONS: Despite major challenges, a high percentage of patients receiving anti-TB treatment before the hurricane were located and successfully treated in southwest Haiti. The lessons learned and results presented here may help inform policies and guidelines in similar settings for effective TB control after a natural disaster.

SELECTION OF CITATIONS
SEARCH DETAIL
...