Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 4.097
Filtrar
1.
Molecules ; 27(7)2022 Apr 06.
Artigo em Inglês | MEDLINE | ID: mdl-35408741

RESUMO

Ephedra plants generally contain ephedrine alkaloids, which are the critical precursor compounds of methamphetamine (METH). METH could cause serious physical and mental damage, and therefore Ephedra materials are strictly in supervision internationally. However, unlawful utilization of Ephedra herbs and its products still exist. Thus, it is imperative to establish a universal method for monitoring Ephedra ingredients in complex mixtures and processed products. In this study, 224 ITS2 sequences representing 59 taxa within Ephedra were collected, and a 23-bp genus-level nucleotide signature (GTCCGGTCCGCCTCGGCGGTGCG) was developed for the identification of the whole genus. The specific primers MH-1F/1R were designed, and 125 individuals of twelve Ephedra species/varieties were gathered for applicability verification of the nucleotide signature. Additionally, seven batches of Chinese patent medicines containing Ephedra herbs were used to test the application of the nucleotide signature in complex and highly processed materials. The results demonstrated that the 23-bp molecular marker was unique to Ephedra and conserved within the genus. It can be successfully utilized for the detection of Ephedra components in complex preparations and processed products with severe DNA degradation. The method developed in this study could undoubtedly serve as a strong support for the supervision of illegal circulation of Ephedra-containing products.


Assuntos
Alcaloides , Ephedra , Metanfetamina , Alcaloides/metabolismo , Ephedra/genética , Ephedra/metabolismo , Efedrina/metabolismo , Humanos , Nucleotídeos , Extratos Vegetais
2.
Neuromuscul Disord ; 32(1): 80-83, 2022 01.
Artigo em Inglês | MEDLINE | ID: mdl-34980536

RESUMO

ALG2 mutations are extremely rare causes of congenital myasthenic syndromes (CMS). The clinical phenotype and treatment response is therefore not well described. We present the case of a baby who immediately after birth presented with pronounced truncal hypotonia, proximal muscle weakness and feeding difficulties. Single fibre electromyography showed neuromuscular transmission failure and salbutamol and ephedrine treatment improved both muscle weakness and neuromuscular transmission. Genetic analysis revealed a likely pathogenic variant c.1040del, p.(Gly347Valfs*27) in exon 2 and a variant of uncertain significance, c.239G>A, p.(Gly80Asp) in exon 1 of the ALG2 gene. Western blot in whole cell lysates of HEK293 cells transfected with p.Gly80Asp, or p.Gly347Valfs*27 expression constructs indicated that p.Gly347Valfs*27 is likely a null allele and p.Gly80Asp is pathogenic through marked reduction of ALG2 expression. This case highlights the utility of functional studies in clarifying variants of unknown significance, in suspected cases of CMS.


Assuntos
Mutação/genética , Síndromes Miastênicas Congênitas/genética , Albuterol/uso terapêutico , Eletromiografia , Efedrina/uso terapêutico , Feminino , Células HEK293 , Humanos , Recém-Nascido , Proteínas Musculares/genética , Fenótipo
3.
Spectrochim Acta A Mol Biomol Spectrosc ; 270: 120828, 2022 Apr 05.
Artigo em Inglês | MEDLINE | ID: mdl-35026529

RESUMO

A simple, rapid, accurate, and sensitive UV-Visible spectrophotometric method has been developed to estimate ephedrine hydrochloride (Eph) in pharmaceutical drugs. This method is based on preparing chelate complex through the reaction between Eph and cobalt ion (Co (II)). Ephedrine identification is done as an Eph - Co (II) complex after extraction by chloroform at λ max 389 nm. In this work, the optimum operation conditions such as pH, buffer volume, Co ion concentration, time of reaction and extraction, temperature, and water to organic volume ratio were determined. The linearity range of Eph has observed in the range between 1 and 80 ppm, at a wavelength of 387 nm with molar absorptivity range between 3.1867 × 103 to 1.6941 × 103(L·mol-1·cm-1) and metal to legend ratio of two. The results obtaind from this study are as follow: relative standard deviation (RSD) percentage is 0.303%, detection limit (D.L) = 0.94 ppm, Sandel's sensitivity (S) = 0.0135, relative error (Erel.) % = 0.039, recovery (Rec.) %=100.039. The results confirmed no interferences of excipients on the detection of Eph, and the proposed method has successfully applied for the determination of ephedrine-HCl in pure and pharmaceutical preparations. This method has several advantages, such as its low cost, high sensitivity, and ease of operation.


Assuntos
Clorofórmio , Efedrina , Excipientes , Concentração de Íons de Hidrogênio , Espectrofotometria
4.
J Sep Sci ; 45(5): 1051-1058, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-34984820

RESUMO

Ephedrae Herba is one of the most commonly used herbal medicines, and it has been shown that most of the clinical efficacy for cold and asthma is exerted by its alkaloidal components. A simple and sensitive high-performance liquid chromatography method was developed using a perfluorooctyl column for the simultaneous determination of five alkaloids (norephedrine, norpseudoephedrine, ephedrine, pseudoephedrine, and methylephedrine) in Ephedrae Herba. The mobile phase comprising acetonitrile and 15 mM ammonium trifluoroacetate was used to elute the targets in isocratic elution mode. The method was validated for linearity (R2  > 0.999), repeatability, intraday and interday precision, recoveries with trueness (93.87-110.99%), limits of detection (5.35-5.76 µg/mL), and limits of quantification (20 µg/mL). The quantitative results revealed that the developed method was precise and accurate. Then it was successfully applied to determine the difference in the contents of three batches of Ephedrae Herba from three pharmaceutical companies.


Assuntos
Alcaloides , Medicamentos de Ervas Chinesas , Cromatografia Líquida de Alta Pressão , Medicamentos de Ervas Chinesas/análise , Efedrina/análise , Pseudoefedrina/análise
5.
Rapid Commun Mass Spectrom ; 36(4): e9229, 2022 Feb 28.
Artigo em Inglês | MEDLINE | ID: mdl-34854506

RESUMO

RATIONALE: Ephedrine analogues are stimulants that are explicitly required to be quantified and characterized in the Anti-Doping Prohibited List of the World Anti-Doping Agency. Given the difficulty of distinguishing diastereoisomers, the qualitative and quantitative analyses of ephedrine diastereoisomers are difficult. METHODS: An ultra-performance liquid chromatography-tandem mass spectrometry (UHPLC/MS/MS) method was developed to detect five ephedrine analogues, and two pairs of diastereoisomers were identified using this method. The samples were analyzed qualitatively and quantitatively using a tandem mass spectrometer with an electrospray ionization source in multiple reaction detection mode after one-step dilution. RESULTS: The effective detection limits of this method were below 0.5 ng/mL. A matrix effect (range: 83.4% to 102%) was observed in quality control samples. The intra- and inter-day precision was lower than 9.16% and 8.60%, respectively, and the accuracy was within ±8.0%. CONCLUSIONS: The method is efficient, accurate, stable and sensitive, and fully meets the requirements for the detection of ephedrine substances in stimulants.


Assuntos
Cromatografia Líquida de Alta Pressão/métodos , Doping nos Esportes/métodos , Efedrina/urina , Espectrometria de Massas em Tandem/métodos , Efedrina/química , Humanos , Estrutura Molecular , Estereoisomerismo , Urina/química
6.
J Ethnopharmacol ; 285: 114837, 2022 Mar 01.
Artigo em Inglês | MEDLINE | ID: mdl-34788644

RESUMO

ETHNOPHARMACOLOGICAL RELEVANCE: The stems of Ephedra sinica and the fruits of Terminalia chebula are combined using in traditional Mongolian medicine formula "Gurigumu-7" for liver diseases. E. sinica stems contains ephedrine with broncho-dilatory activity. However, ephedrine can pass through the blood-brain barrier (BBB) and excite the central nervous system (CNS) to cause insomnia and restlessness. AIM OF THE STUDY: The present study was to investigate the structures and bioactivities of new compounds formed in vivo after co-administration of E. sinica stems and T. chebula fruits. MATERIALS AND METHODS: Pharmacokinetic investigation was carried out in rats. A parallel artificial membrane permeability measurement system was used to determine BBB permeability. Ex vivo experiments using tracheal rings of guinea pig was performed to examine the tracheal relaxation effect. In vivo hepatoprotective tests were carried out in Tg (fabp10a: dsRed) liver transgenic zebrafish. The fluorescent probe, 2,7-dichlorodihydrofluorescein diacetate, was used to measure reactive oxygen species, and UHPLC-MS was used to determine glutathione concentrations after derivatization with N-ethylmaleimide. RESULTS: New ephedrine derivatives (1 and 2) formed in vivo and reached their maximum serum concentrations at 0.5 h after administration of the two herbal drugs. Compounds 1 and 2 showed lower BBB permeability than ephedrine, suggesting that they have less adverse effects on the CNS. Compounds 1 and 2 relaxed the tracheal rings and had strong hepatoprotective effect on transgenic zebrafish with liver specific expression of RFP. Compounds 1 and 2 significantly reduced the level of reactive oxygen species while increasing that of glutathione in thioacetamide-treated zebrafish, which might be the hepatoprotective mechanism. CONCLUSION: These results provided evidences that the chemical constituents in various herbal drugs in a medicinal formula can interact to generate new compounds with fewer side effects and increased or additive bioactivity.


Assuntos
Ephedra sinica/química , Efedrina , Extratos Vegetais/farmacologia , Distúrbios do Início e da Manutenção do Sono , Terminalia/química , Animais , Barreira Hematoencefálica/efeitos dos fármacos , Broncodilatadores/farmacologia , Sistema Nervoso Central/efeitos dos fármacos , Combinação de Medicamentos , Efedrina/análogos & derivados , Efedrina/farmacocinética , Cobaias , Extratos Vegetais/química , Ratos , Distúrbios do Início e da Manutenção do Sono/induzido quimicamente , Distúrbios do Início e da Manutenção do Sono/prevenção & controle
7.
J Perioper Pract ; 32(3): 29-40, 2022 Mar.
Artigo em Inglês | MEDLINE | ID: mdl-33599544

RESUMO

The incidence rates of spinal anaesthesia-induced hypotension vary depending on the surgical procedures. This systematic review and meta-analysis evaluates the efficacy of prophylactic ondansetron in reducing the incidence of spinal anaesthesia-induced hypotension in non-caesarean delivery. Thirteen trials consisting of 1166 patients were included for analysis. Compared to placebo, there is a low quality of evidence that ondansetron was effective in reducing the incidence of spinal anaesthesia-induced hypotension (RR 0.62, 95% CI 0.44 to 0.87; p = 0.005) and bradycardia (RR 0.54, 95% CI 0.32 to 0.90; p = 0.02). We also found a moderate quality of evidence that ondansetron lowered the number of rescue ephedrine (RR 0.61, 95% CI 0.43 to 0.87; p = 0.007). Patients treated with ondansetron have higher mean arterial pressure 15 to 20 minutes after spinal anaesthesia induction and higher systolic arterial pressure 5, 10, 15 and 20 minutes after spinal anaesthesia. The evidence suggests that prophylactic administration of ondansetron results in the reduction of the incidence of spinal anaesthesia-induced hypotension, bradycardia and rescue ephedrine in patients undergoing non-caesarean delivery under spinal anaesthesia.


Assuntos
Anestesia Obstétrica , Raquianestesia , Hipotensão , Raquianestesia/efeitos adversos , Raquianestesia/métodos , Bradicardia/induzido quimicamente , Bradicardia/epidemiologia , Bradicardia/prevenção & controle , Efedrina/uso terapêutico , Humanos , Hipotensão/induzido quimicamente , Hipotensão/prevenção & controle , Incidência , Ondansetron/efeitos adversos , Ondansetron/uso terapêutico
8.
J Nucl Cardiol ; 29(2): 413-425, 2022 Apr.
Artigo em Inglês | MEDLINE | ID: mdl-34341953

RESUMO

BACKGROUND: In ischemic cardiomyopathy patients, cardiac sympathetic nervous system dysfunction is a predictor of sudden cardiac arrest (SCA). This study compared abnormal innervation and perfusion measured by [11C]meta-hydroxyephedrine (HED) vs [13N]ammonia (NH3), conventional uptake vs parametric tracer analysis, and their SCA risk discrimination. METHODS: This is a sub-study analysis of the prospective PAREPET trial, which followed ischemic cardiomyopathy patients with reduced left ventricular ejection fraction (LVEF ≤ 35%) for events of SCA. Using n = 174 paired dynamic HED and NH3 positron emission tomography (PET) scans, regional defect scores (%LV extent × severity) were calculated using HED and NH3 uptake, as well as HED distribution volume and NH3 myocardial blood flow by kinetic modeling. RESULTS: During 4.1 years follow-up, there were 27 SCA events. HED defects were larger than NH3, especially in the lowest tertile of perfusion abnormality (P < .001). Parametric defects were larger than their respective tracer uptake defects (P < .001). SCA risk discrimination was not significantly improved with parametric or uptake mismatch (AUC = 0.73 or 0.70) compared to HED uptake defect scores (AUC = 0.67). CONCLUSION: Quantification of HED distribution volume and NH3 myocardial blood flow produced larger defects than their respective measures of tracer uptake, but did not lead to improved SCA risk stratification vs HED uptake alone.


Assuntos
Cardiomiopatias , Isquemia Miocárdica , Amônia , Cardiomiopatias/diagnóstico por imagem , Morte Súbita Cardíaca , Efedrina/análogos & derivados , Coração/inervação , Humanos , Cinética , Isquemia Miocárdica/diagnóstico por imagem , Tomografia por Emissão de Pósitrons , Estudos Prospectivos , Medição de Risco , Volume Sistólico , Sistema Nervoso Simpático , Função Ventricular Esquerda
9.
J Chromatogr Sci ; 60(4): 316-323, 2022 Apr 28.
Artigo em Inglês | MEDLINE | ID: mdl-34136920

RESUMO

Ethyl acetate potentially contains formaldehyde and acetaldehyde as impurities. Ephedrines (ephedrine and pseudoephedrine) react with these aldehydes to give oxazolidines. The purpose of this study is to elucidate the effects of aldehydes in ethyl acetate on the analysis of ephedrines by gas chromatography/mass spectrometry (GC/MS). Ephedrines dissolved in a basic solution were extracted with five lots of ethyl acetate; then, injected into a GC/MS system. Acetaldehyde in ethyl acetate was determined by headspace GC/MS. Acetaldehyde-free ethyl acetate, prepared by washing with sodium bisulfite solution, was also subjected to ephedrine extraction and acetaldehyde determination. Four of the five ethyl acetate lots produced 3,4-dimethyl-5-phenyloxazolidines (formaldehyde adducts of ephedrines) and 2,3,4-trimethyl-5-phenyloxazolidines (acetaldehyde adducts of ephedrines). Acetaldehyde was detected in the range of 23-89 µL/L in four lots of ethyl acetate and not detected in one lot, and the detection of acetaldehyde was associated with oxazolidine formation. Washing with sodium bisulfite solution removed ~90% of acetaldehyde and prevented oxazolidine formation. The study indicated that ephedrines reacted with aldehydes in ethyl acetate to produce oxazolidines and washing with sodium bisulfite solution prevented it. It is necessary to exercise caution when using ethyl acetate to extract ephedrines.


Assuntos
Aldeídos , Efedrina , Acetaldeído , Acetatos , Formaldeído , Oxazóis
10.
Gene ; 806: 145921, 2022 Jan 05.
Artigo em Inglês | MEDLINE | ID: mdl-34454033

RESUMO

Maoto, a traditional Japanese medicine (Kampo), is widely used to treat upper respiratory tract infections, including influenza virus infection. Although maoto is known to inhibit pro-inflammatory responses in a rodent model of acute inflammation, its underlying mechanism remains to be determined. In this study, we investigated the involvement of immune responses and noradrenergic function in the inhibitory action of maoto. In a mouse model of polyI:C-induced acute inflammation, maoto was administered orally in conjunction with intraperitoneal injection of PolyI:C (6 mg/kg), and blood was collected after 2 h for measurement of plasma cytokines by ELISA. Maoto significantly decreased PolyI:C-induced TNF-α levels and increased IL-10 production. Neither pretreatment with IL-10 neutralizing antibodies nor T-cell deficiency using nude mice modified the inhibitory effect of maoto, indicating that the anti-inflammatory effects of maoto are independent of IL-10 and T cells. Furthermore, the inhibitory effects of maoto on PolyI:C-induced TNF-α production were not observed in ex vivo splenocytes, suggesting that maoto does not act directly on inflammatory cells. Lastly, pretreatment with a ß-adrenergic receptor antagonist partially cancelled the anti-inflammatory effects of maoto. Collectively, these results suggest that maoto mediates its anti-inflammatory effects via ß-adrenergic receptors in vivo.


Assuntos
Antagonistas Adrenérgicos beta/farmacologia , Anti-Inflamatórios/farmacologia , Inflamação/prevenção & controle , Interleucina-10/genética , Extratos Vegetais/farmacologia , Receptores Adrenérgicos beta/genética , Administração Oral , Animais , Modelos Animais de Doenças , Efedrina/farmacologia , Regulação da Expressão Gênica , Injeções Intraperitoneais , Interleucina-10/agonistas , Interleucina-10/imunologia , Japão , Masculino , Medicina Kampo/métodos , Camundongos Endogâmicos BALB C , Camundongos Nus , Poli I-C/administração & dosagem , Poli I-C/antagonistas & inibidores , Receptores Adrenérgicos beta/imunologia , Transdução de Sinais , Linfócitos T/efeitos dos fármacos , Linfócitos T/imunologia , Linfócitos T/patologia , Fator de Necrose Tumoral alfa/antagonistas & inibidores , Fator de Necrose Tumoral alfa/genética , Fator de Necrose Tumoral alfa/imunologia
11.
Int Immunopharmacol ; 103: 107842, 2022 Feb.
Artigo em Inglês | MEDLINE | ID: mdl-34953449

RESUMO

Chronic obstructive pulmonary disease (COPD) is a chronic lung disease with limited therapeutic options. Ephedrine (Eph) isolated from Ephedra exerts regulatory role in inflammatory response. However, its effects on COPD development still remain unknown. In the present study, we found that Eph significantly ameliorated apoptosis, oxidative stress and inflammatory response in cigarette smoke extract (CSE)-stimulated human bronchial epithelial cells (HBECs). Moreover, all these cellular events attenuated by Eph were closely associated with reactive oxygen species (ROS) decreasing. Furthermore, we found that the expression of endoplasmic reticulum (ER) stress-associated signaling could be down-regulated by Eph in HBECs without any stimuli. Meanwhile, ER stress was strongly induced by CSE, which was, however, effectively mitigated by Eph exposure in HBECs. Intriguingly, we found that Eph-alleviated cell death, ROS generation and inflammation were almost eliminated by the promotion of ER stress via over-expressing Bip in HBECs upon CSE stimulation. Moreover, Eph administration significantly ameliorated pulmonary indexes and histological impairments in mice with long-term CS exposure, which were largely through the suppression of inflammation, apoptosis and oxidative stress via blocking ER stress as detected in vitro. Collectively, all these findings indicated that Eph exhibited protective effects against CS-caused COPD by hindering ER stress.


Assuntos
Efedrina/farmacologia , Animais , Apoptose/efeitos dos fármacos , Regulação para Baixo , Retículo Endoplasmático/metabolismo , Estresse do Retículo Endoplasmático , Células Epiteliais/metabolismo , Humanos , Pulmão/efeitos dos fármacos , Camundongos , Estresse Oxidativo/efeitos dos fármacos , Doença Pulmonar Obstrutiva Crônica/metabolismo , Espécies Reativas de Oxigênio/metabolismo , Transdução de Sinais , Fumaça , Tabaco
12.
Biol Pharm Bull ; 44(11): 1781-1789, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34719654

RESUMO

Dried terrestrial stems of Ephedra sinica are known as 'Ephedra herb.' The pharmacological effects are mainly related to two major ingredients, (-)-ephedrine and (+)-pseudoephedrine (total alkaloids which are defined in Japanese Pharmacopoeia, TA). In this study, in order to aid in cultivation and breeding, the stability of TA content and stem dry weight of 46 E. sinica genets was evaluated from the first year of transplantation to the sixth year. TA content and composition ratio of these genets were stable after the second year, and dry weight was stable after the fourth year. These traits showed high inter-genet variability but low annual variability for each genet. Additionally, rank correlation coefficients of each trait among the genets were high. There was no significant correlation between these traits. Furthermore, to assess the reproducibility of these traits in clones, we evaluated TA content and dry weight of three clonal lines with high TA contents. TA content and composition ratio of the clonal lines were also stable after the second year of transplantation, and dry weight of the clonal lines was also stable after the fourth year. Moreover, TA content and composition ratio in each clonal line were comparable with those of each original genet after the second year. These results suggested that ephedrine alkaloids content and dry weight of E. sinica plants are stable, and that these traits are highly reproducible in clones. Therefore, selection breeding of E. sinica using vegetative propagation can be effective for high and stable quality of Ephedra herb.


Assuntos
Alcaloides/análise , Ephedra sinica/química , Caules de Planta/química , Efedrina/análise , Pseudoefedrina/análise , Reprodutibilidade dos Testes
13.
Molecules ; 26(22)2021 Nov 19.
Artigo em Inglês | MEDLINE | ID: mdl-34834083

RESUMO

A sensitive and reproducible liquid chromatography-tandem mass spectrometry (LC-MS/MS) system was developed and fully validated for the simultaneous determination of ephedrine and pseudoephedrine in human plasma after oral administration of the herbal prescription Ojeok-san (OJS); 2-phenylethylamine was used as the internal standard (IS). Both compounds presented a linear calibration curve (r2 ≥ 0.99) over a concentration range of 0.2-50 ng/mL. The developed method was fully validated in terms of selectivity, lower limit of quantitation, precision, accuracy, recovery, matrix effect, and stability, according to the regulatory guidelines from the U.S. Food and Drug Administration and the Korea Ministry of Food and Drug Safety. This validated method was successfully applied for the pharmacokinetic assessment of ephedrine and pseudoephedrine in 20 healthy Korean volunteers administered OJS.


Assuntos
Efedrina , Extratos Vegetais/administração & dosagem , Pseudoefedrina , Espectrometria de Massas em Tandem , Administração Oral , Cromatografia Líquida , Efedrina/administração & dosagem , Efedrina/farmacocinética , Feminino , Humanos , Masculino , Pseudoefedrina/administração & dosagem , Pseudoefedrina/farmacocinética , República da Coreia
14.
Pak J Pharm Sci ; 34(4(Supplementary)): 1549-1554, 2021 Jul.
Artigo em Inglês | MEDLINE | ID: mdl-34799331

RESUMO

Ephedra, natural flora has been used traditionally to treat rheumatism since decades. The scientific evidence of anti-rheumatic effect of this plant has also been reported. But the anti-rheumatic activity of major constituent of this plant (ephedrine) has not been evaluated. Based on this, the current study was aimed to assess anti-arthritic activity of ephedrine by using in vitro and in vivo approaches. Correspondingly, enzyme linked immunosorbent assay was performed for the estimation of prostaglandins E2 (PGE2) and tumor necrosis factor-α (TNF-α) in serum of formaldehyde-induced arthritic animals. The results elaborated significant reduction in albumin denaturation and remarkable progress on stabilization of red blood cells outer membrane at higher concentration during in vitro experiments. The ephedrine (40mg/kg) revealed noteworthy (p<0.001) inhibition in paw swelling in animals intoxicated with albumin as well as formaldehyde as compared to animals of control group by in vivo results. In this assay, ephedrine (20 & 40 mg/kg orally) significantly suppressed the level of these inflammatory markers (PGE2 & TNF-α). Ephedrine exhibited anti-arthritic effect by decreasing pro-inflammatory cytokines (PGE2 & TNF-α). This experimental work pharmacologically supports the use of ephedrine as anti-rheumatic drug but limited to evaluate in immunological arthritic model.


Assuntos
Artrite Reumatoide/tratamento farmacológico , Efedrina/uso terapêutico , Albuminas/química , Albuminas/toxicidade , Animais , Artrite Reumatoide/induzido quimicamente , Bovinos , Dinoprostona/sangue , Relação Dose-Resposta a Droga , Edema/induzido quimicamente , Efedrina/administração & dosagem , Efedrina/química , Membrana Eritrocítica/efeitos dos fármacos , Humanos , Inflamação/induzido quimicamente , Inflamação/tratamento farmacológico , Ratos , Fator de Necrose Tumoral alfa/sangue
15.
Hum Exp Toxicol ; 40(12_suppl): S540-S552, 2021 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-34715758

RESUMO

Ischemic stroke is a leading cause of death and long-term disability worldwide. The aim of this study is to explore the potential function of ephedrine in ischemic stroke and the underlying molecular mechanism. A middle cerebral artery occlusion (MCAO) rat model was established. The potential effects of ephedrine on MCAO rats and LPS-stimulated BV2 microglial cells were evaluated. Ephedrine reduced the infarct volume, cell apoptosis, brain water content, neurological score, and proinflammatory cytokines (TNF-α and IL-1ß) production in MCAO rats. Ephedrine treatment also suppressed TNF-α and IL-1ß production and NOD-like receptor pyrin domain 3 (NLRP3) inflammasome activation in BV2 microglial cells. The expression of NLRP3, caspase-1, and IL-1ß was suppressed by ephedrine. Moreover, ephedrine treatment increased the phosphorylation of Akt and GSK3ß and nuclear NRF2 levels in LPS-treated BV2 microglial cells. Meanwhile, LY294002 attenuated the inhibitory effects of ephedrine on NLRP3 inflammasome activation and TNF-α and IL-1ß production. In addition, the level of pAkt was increased, while NLRP3, caspase-1, and IL-1ß were decreased by ephedrine treatment in MCAO rats. In conclusion, ephedrine ameliorated cerebral ischemia injury via inhibiting NLRP3 inflammasome activation through the Akt/GSK3ß/NRF2 pathway. Our results revealed a potential role of ephedrine in ischemic stroke treatment.


Assuntos
Isquemia Encefálica/prevenção & controle , Efedrina/farmacologia , Glicogênio Sintase Quinase 3 beta/metabolismo , Inflamassomos/metabolismo , Fator 2 Relacionado a NF-E2/metabolismo , Proteínas Proto-Oncogênicas c-akt/metabolismo , Domínio Pirina , Animais , Isquemia Encefálica/metabolismo , Masculino , Fosforilação , Ratos , Ratos Sprague-Dawley
16.
J Zoo Wildl Med ; 52(3): 1054-1060, 2021 Sep.
Artigo em Inglês | MEDLINE | ID: mdl-34687524

RESUMO

Hypotension is a common adverse effect of general anesthesia that has historically been difficult to measure in pinniped species due to technical challenges. A retrospective case review found seven pinniped cases that demonstrated anesthesia-associated hypotension diagnosed by direct blood pressure measurements during general anesthesia at The Marine Mammal Center (Sausalito, CA) between 2017 and 2019. Cases included five California sea lions (CSL: Zalophus californianus), one Hawaiian monk seal (HMS: Neomonachus schauinslandi), and one northern elephant seal (NES: Mirounga angustirostris). Patients were induced using injectable opioids, benzodiazepines, and anesthetics including propofol and alfaxalone. Excluding the HMS, all patients required supplemental isoflurane with a mask to achieve an anesthetic plane allowing for intubation. Each patient was maintained with inhalant isoflurane in oxygen for the duration of the anesthetic event. Each patient was concurrently administered continuous IV fluids and four patients received fluid boluses prior to administration of ephedrine. All hypotensive anesthetized patients were treated with IV ephedrine (0.05-0.2 mg/kg). The average initial systolic (SAP) and mean (MAP) arterial blood pressures for the CSL prior to ephedrine administration were 71 ± 14 mmHg and 48 ± 12 mmHg respectively. The average SAP and MAP for the CSL increased to 119 ± 32 mmHg and 90 ± 34 mmHg respectively within 5 m of ephedrine administration. The NES initial blood pressure measurement was 59/43 (50) (SAP/diastolic [MAP]) mmHg and increased to 80/51 (62) mmHg within 5 m. The initial HMS blood pressure was 79/68 (73) mmHg and increased to 99/78 (85) mmHg within 5 m following ephedrine administration. All patients recovered from anesthesia. These results support the efficacy of IV ephedrine for the treatment of anesthesia-associated hypotension in pinnipeds.


Assuntos
Efedrina , Hipotensão , Anestesia Geral/efeitos adversos , Anestesia Geral/veterinária , Animais , Pressão Sanguínea , Caniformia , Efedrina/uso terapêutico , Frequência Cardíaca , Hipotensão/induzido quimicamente , Hipotensão/tratamento farmacológico , Hipotensão/veterinária , Estudos Retrospectivos
18.
Food Funct ; 12(20): 9563-9582, 2021 Oct 19.
Artigo em Inglês | MEDLINE | ID: mdl-34533553

RESUMO

Ephedrine, a sympathomimetic amine that exhibits several adrenaline actions, is a plant alkaloid that is a common ingredient in several cold, asthma and narcolepsy treatment preparations, and in obesity management and sport medicine. Its principal action mechanism relies on its direct adrenergic actions as well as indirect role that involves the release of epinephrine and norepinephrine, thus increasing the activity of epinephrine and norepinephrine at the postsynaptic α and ß receptors. Nevertheless, its serious side effects, including stroke, heart attack, drug abuse and interactions, have never been comprehensively reviewed. We conducted a systematic review of data on ephedrine, including its occurrence in functional foods, pharmacological aspects, metabolism, pharmaco/toxicokinetics and clinical features. Furthermore, a review of ephedrine natural structural analogues with regards to their differential adrenergic receptor binding affinities, food interaction, and their impact on the pharmacokinetics and effects relative to ephedrine are presented for the first time, and in comparison to its action when present in herbs.


Assuntos
Adrenérgicos/farmacologia , Efedrina/farmacologia , Alimento Funcional , Preparações de Plantas , Adrenérgicos/efeitos adversos , Adrenérgicos/química , Efedrina/efeitos adversos , Efedrina/química , Interações Alimento-Droga , Humanos
19.
Yakugaku Zasshi ; 141(8): 1041-1048, 2021.
Artigo em Japonês | MEDLINE | ID: mdl-34334549

RESUMO

Some controlled substances, such as stimulants and narcotics, have asymmetric carbons in their molecules. Because the enantiomers do not always show the same pharmacological effects, and there are substances with different controls due to differences in their stereochemistry, a simple and unambiguous method for assessment of the composition of enantiomers is necessary. In this study, to develop a simple and rapid stereoscopic identification method for methamphetamine and its raw materials (ephedrine and pseudoephedrine), the 1H-NMR method was studied using three commercially available chiral solvating agents (CSAs); 1,1'-bi(2-naphthol)(BINOL), 2,2,2-trifluoro-1-(9-anthryl)ethanol (TFAE) and α-methoxy-α-(trifluoromethyl)phenylacetic acid (MTPA). In addition, the accuracy of the optical purity, which was measured using samples mixed with enantiomers in various ratios, was investigated. The NMR peaks of the enantiomers were separated by adding (R)- or (S)-form of BINOL, TFAE or MTPA to the chloroform-d solution of methamphetamine, ephedrine or pseudoephedrine. A sufficient discrimination of enantiomers was obtained by adding about 10 equal amounts of each CSA to the solutions. With regard to the optical purity, it was possible to determine accurately the mixing of small amounts of enantiomers of about 5% even if the NMR peaks did not reach the baseline separation, when impurity peaks do not overlap. This method will be one of the useful techniques for the rapid and simple discrimination of enantiomers of illegal methamphetamine and its raw materials.


Assuntos
Controle de Medicamentos e Entorpecentes/métodos , Éteres , Drogas Ilícitas/química , Drogas Ilícitas/isolamento & purificação , Espectroscopia de Ressonância Magnética/métodos , Metanfetamina/química , Metanfetamina/isolamento & purificação , Naftóis , Fenilacetatos , Clorofórmio/química , Efedrina/química , Éteres/química , Naftóis/química , Fenilacetatos/química , Pseudoefedrina/química , Solventes , Estereoisomerismo
20.
J Clin Pharm Ther ; 46(6): 1680-1686, 2021 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-34409620

RESUMO

WHAT IS KNOWN AND OBJECTIVE: Prior to nasotracheal intubation (NTI), topical nasal vasoconstrictors are used to prevent NTI-related epistaxis (NTIRE). Since we learned that there is no significant increase in NTIRE among hypertensive patients undergoing NTI with adequate lubrication but without vasoconstrictors, we initiated this randomized controlled study to assess the necessity of vasoconstrictor use in reducing NTIRE. METHODS: Patients with the American Society of Anesthesiologists Physical Status Classification 1 and normal coagulation function, planned to undergo maxillofacial surgery with NTI were enrolled. Patients were randomly (1:1) assigned to each of the treatment groups: nasal treatment using pure oxybuprocaine gel with adequate lubrication (group G) or 1% ephedrine in addition to oxybuprocaine gel with adequate lubrication (group EG). In addition, the incidence and severity of NTIRE and intubation adjustments were studied. RESULTS: A total of 844 patients, 429 and 415 (groups G and EG, respectively), were included in the analysis. No significant differences were observed in the NTIRE incidence rates in groups G (28%) and EG (27%; p = 0.75, relative risk [RR] = 0.95, 95% confidence interval [CI] 0.70-1.29). No significant differences in the NTIRE incidence rates between the two nostrils were observed in both groups (group G: left, 27.9% vs. right, 28% [p = 0.98, RR = 1.01, 95% CI 0.67-1.51]; group EG: left, 25.8% vs. right, 27.9% [p = 0.63, RR = 1.12, 95% CI 0.72-1.73]. No significant difference was observed in the severity of NTIRE (p = 0.74). In case of difficult advancement of the endotracheal tube, NTIRE incidence was 71% vs. 12% with smooth intubation (p < 0.01, RR = 18.33, 95% CI 12.55-26.77). WHAT IS NEW AND CONCLUSION: Well-lubricated nasotracheal intubation does not require pretreatment with ephedrine to reduce NTIRE.


Assuntos
Efedrina/administração & dosagem , Epistaxe/etiologia , Epistaxe/prevenção & controle , Intubação Intratraqueal/efeitos adversos , Vasoconstritores/administração & dosagem , Adulto , Feminino , Humanos , Lubrificação , Masculino , Cirurgiões Bucomaxilofaciais
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...