Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 5.330
Filtrar
1.
Medicine (Baltimore) ; 100(41): e27535, 2021 Oct 15.
Artigo em Inglês | MEDLINE | ID: mdl-34731149

RESUMO

ABSTRACT: Enhancer RNAs (eRNAs), a subclass of lncRNAs, are derived from enhancer regions. The function of eRNAs has been reported by many previous studies. However, the role of eRNAs in gastric cancer, especially the prognosis-associated eRNAs, has not been studied yet.In this study, we have used a novel approach to screened key eRNAs in gastric cancer. Kaplan-Meier correlation analysis and Co-expression analysis were used to find the most significant survival-associated eRNAs. Enrichment analysis is applied to explore the key functions and pathways of screened eRNAs. The correlation and survival analysis are used to evaluate targeted genes in the pan-cancer analysisA total of 63 prognostic-associated eRNAs in gastric cancer were identified, the top 6 eRNAs were LINC01714, ZNF192P1, AC079760.2, LINC01645, EMX2OS, and AC114489.2. The correlation analysis demonstrated the top 10 screened eRNAs and their targeted genes. The results demonstrated that EMX2OS was ranked as the top eRNA according to the results of the Kaplan-Meier analysis. The correlation analysis demonstrated that eRNA EMX2OS is correlated with age, grade, stage, and cancer status. The pan-cancer analysis demonstrated that EMX2OS was associated with poor survival outcomes in adrenocortical carcinoma, cervical squamous cell carcinoma and endocervical adenocarcinoma, kidney renal clear cell carcinoma, stomach adenocarcinoma, and uveal melanoma.In this study, survival-related eRNAs were screened and the correlation between survival-related eRNAs and their targeted genes was demonstrated. EMX2OS plays a prognosis-associated eRNA role in gastric cancer, which might be a novel therapeutic target in clinical practice.


Assuntos
Adenocarcinoma/genética , Proteínas de Homeodomínio/genética , RNA Longo não Codificante/genética , Neoplasias Gástricas/genética , Fatores de Transcrição/genética , Adenocarcinoma/diagnóstico , Idoso , Biomarcadores Tumorais/genética , Elementos Facilitadores Genéticos/genética , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Estimativa de Kaplan-Meier , Masculino , Pessoa de Meia-Idade , Estadiamento de Neoplasias/métodos , Prognóstico , RNA Antissenso/genética , Neoplasias Gástricas/mortalidade , Neoplasias Gástricas/patologia , Análise de Sobrevida
2.
Zhonghua Zhong Liu Za Zhi ; 43(10): 1054-1061, 2021 Oct 23.
Artigo em Chinês | MEDLINE | ID: mdl-34695895

RESUMO

Objective: To investigate the effects of tumor protein translation control antisense RNA1 (TPT1-AS1) on the radiosensitivity, cell proliferation, migration and invasion of hepatocellular carcinoma cells by targeting microRNA-30c-5p (miR-30c-5p). Methods: Thirty-four cases of liver cancer tissues and adjacent normal tissues were derived from liver cancer patients who were admitted to Shanxi Provincial People's Hospital from March 2016 to March 2018. Liver cancer HepG2 cell was transfected with negative control siRNA (si-NC group), si-TPT1-AS1 (si-TPT1-AS1 group), pcDNA3.1 (pcDNA3.1 group), pcDNA3.1-TPT1-AS1 (pcDNA3.1-TPT1-AS1 group), si-TPT1-AS1 and anti-miR-NC (si-TPT1-AS1+ anti-miR-NC group), si-TPT1-AS1 and anti-miR-30c-5p (si-TPT1-AS1+ anti-miR-30c-5p group), respectively. Real-time quantitative reverse transcription polymerase chain reaction (qPCR) was used to detect the transcription levels of TPT1-AS1 and miR-30c-5p in normal tissues adjacent to cancer and liver cancer tissues, the clone formation test was used to test the radiosensitivity of HepG2 cells, and the Methyl Thiazolyl Tetrazolium (MTT) test was used to test the proliferation of HepG2 cells. Cell cycle distribution was detected by flow cytometry, Transwell array was used to detect the migration and invasion ability of HepG2 cells, dual luciferase reporter array was used to verify the targeting relationship of TPT1-AS1 and miR-30c-5p, western blot was used to detect the expressions of proliferation, migration and invasion-related proteins. Results: The expression levels of TPT1-AS1 and miR-30c-5p in liver cancer tissues were 0.84±0.08 and 0.13±0.01, statistically different from 0.31±0.03 and 0.50±0.05 in normal tissues adjacent to cancer (P<0.05). When the cells were treated with 2, 4, 6, 8 Gy irradiation, the cell survival scores of the si-TPT1-AS1 group were 0.280±0.040, 0.069±0.011, 0.020±0.003 and 0.005±0.001, respectively, lower than 0.648±0.070, 0.348±0.080, 0.130±0.020 and 0.060±0.009 of the si-NC group (P<0.05), the radiosensitization ratio of the si-TPT1-AS1 group was 1.672. The number of cell migration and invasion in the si-TPT1-AS1 group were (50.00±4.36) and (44.00±4.03), respectively, which were lower than (109.00±8.68) and (94.00±7.49) in the si-NC group (P<0.05), the cell absorbance (A) values at 24, 48 and 72 hours were 0.28±0.03, 0.43±0.04 and 0.68±0.07, respectively, lower than 0.46±0.04, 0.87±0.08 and 1.35±0.13 of the si-NC group (P<0.05), the protein expression levels of Cyclin D1, p21, E-cadherin and MMP-2 were 0.25±0.02, 0.65±0.06, 0.68±0.07 and 0.27±0.03, respectively, statistically different from 0.88±0.08, 0.17±0.02, 0.14±0.01 and 0.89±0.09 of si-NC group (P<0.05), the proportions of S phase and G(2) phase in the si-TPT1-AS1 group were (17.82±1.03)% and (34.15±2.29)%, respectively, significantly different from (35.14±2.61)% and (16.84±1.21)% in the si-NC group (P<0.05). The luciferase activity of cells in the WT-TPT1-AS1+ miR-30c-5p group was 0.26±0.02, lower than 0.92±0.09 in the WT-TPT1-AS1+ miR-NC group (P<0.05). The cell survival scores in the si-TPT1-AS1+ anti-miR-30c-5p group were 0.450±0.081, 0.200+ 0.045, 0.070±0.010, 0.026±0.004 after treatment with 2, 4, 6, 8 Gy irradiation, higher than 0.285±0.043, 0.075±0.014, 0.028±0.004, 0.006±0.001 of si-TPT1-AS1+ anti-miR-NC group (P<0.05). The radiosensitization ratio of the si-TPT1-AS1+ anti-miR-30c-5p group was 0.694. The number of migration and invasion in the si-TPT1-AS1+ anti-miR-30c-5p group were 79.00±6.65 and 68.00±6.33, higher than (52.00±4.41) and (46.00±4.06) of si-TPT1-AS1+ anti-miR-NC Group (P<0.05), the A values at 24, 48 and 72 hours were 0.37±0.03, 0.64±0.06 and 0.96±0.09, respectively, higher than 0.26±0.03, 0.41±0.04, and 0.65±0.06 of si-TPT1-AS1+ anti-miR-NC group (P<0.05), the expression levels of Cyclin D1, p21, E-cadherin and MMP-2 protein were 0.57±0.06, 0.43±0.04, 0.43±0.04 and 0.64±0.06, statistically different from 0.24±0.02, 0.66±0.06, 0.65±0.06 and 0.28±0.03 of the si-TPT1-AS1+ anti-miR-NC group (P<0.05). Conclusions: The expression of TPT1-AS1 up-regulates in the liver cancer tissues. TPT1-AS1 may down-regulate miR-30c-5p expression, reduce the radiosensitivity of liver cancer cells, and promote the proliferation, migration and invasion of liver cancer cells.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , MicroRNAs , RNA Antissenso/genética , Biomarcadores Tumorais , Carcinoma Hepatocelular/genética , Linhagem Celular Tumoral , Movimento Celular , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Células Hep G2 , Humanos , Neoplasias Hepáticas/genética , MicroRNAs/genética , Biossíntese de Proteínas , Tolerância a Radiação/genética
3.
Biol Res ; 54(1): 33, 2021 Oct 19.
Artigo em Inglês | MEDLINE | ID: mdl-34666824

RESUMO

BACKGROUND: The antisense noncoding mitochondrial RNAs (ASncmtRNAs) derive from the mitochondrial 16S gene. Knockdown of these transcripts with chemically-modified antisense oligonucleotides induces proliferative arrest, apoptosis and invasiveness reduction in tumor but not normal cells. One of these transcripts, ASncmtRNA-2, contains the complete and identical sequence of hsa-miR-4485-3p and, upon knockdown of this transcript, there is a strong increase in levels of this miRNA, suggesting ASncmtRNA-2 as a source for miR-4485-3p, which is supported by several evidences from our group and others, in the ex vivo setting. RESULTS: Here we show that incubation of in vitro-transcribed ASncmtRNA-2 with recombinant Dicer produces RNA fragments corresponding to hsa-miR-4485-3p, showing that Dicer binds to and processes ASncmtRNA-2, strongly supporting the hypothesis that ASncmtRNA-2 acts as a precursor for miR-4485-3p. CONCLUSION: The in vitro results presented here strengthen the hypothesis that miR-4485-3p is derived from ASncmtRNA-2 by Dicer processing. Since miR-4485-3p is classified as a tumor suppressor miRNA, this evidence strengthens the application of ASncmtRNA knockdown for cancer therapy.


Assuntos
MicroRNAs , RNA Longo não Codificante , Linhagem Celular Tumoral , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , MicroRNAs/genética , RNA Antissenso/genética , RNA Mitocondrial/genética
4.
Molecules ; 26(19)2021 Sep 25.
Artigo em Inglês | MEDLINE | ID: mdl-34641347

RESUMO

Glioblastoma (GBM) is the most common primary and aggressive tumour in brain cancer. Novel therapies, despite achievements in chemotherapy, radiation and surgical techniques, are needed to improve the treatment of GBM tumours and extend patients' survival. Gene delivery therapy mostly uses the viral vector, which causes serious adverse events in gene therapy. Graphene-based complexes can reduce the potential side effect of viral carries, with high efficiency of microRNA (miRNA) or antisense miRNA delivery to GBM cells. The objective of this study was to use graphene-based complexes to induce deregulation of miRNA level in GBM cancer cells and to regulate the selected gene expression involved in apoptosis. The complexes were characterised by Fourier transform infrared spectroscopy (FTIR), scanning transmission electron microscopy and zeta potential. The efficiency of miRNA delivery to the cancer cells was analysed by flow cytometry. The effect of the anticancer activity of graphene-based complexes functionalised by the miRNA sequence was analysed using 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxyanilide salt (XTT) assays at the gene expression level. The results partly explain the mechanisms of miRNA deregulation stress, which is affected by graphene-based complexes together with the forced transport of mimic miR-124, miR-137 and antisense miR-21, -221 and -222 as an anticancer supportive therapy.


Assuntos
Neoplasias Encefálicas/terapia , Glioblastoma/terapia , Grafite/química , MicroRNAs/antagonistas & inibidores , RNA Antissenso/administração & dosagem , RNA Antissenso/química , Neoplasias Encefálicas/genética , Neoplasias Encefálicas/patologia , Sobrevivência Celular , Sistemas de Liberação de Medicamentos , Glioblastoma/genética , Glioblastoma/patologia , Humanos , MicroRNAs/administração & dosagem , Células Tumorais Cultivadas
5.
Adv Clin Exp Med ; 30(10): 1043-1050, 2021 Oct.
Artigo em Inglês | MEDLINE | ID: mdl-34610219

RESUMO

BACKGROUND: A growing number of studies have shown that long-chain non-coding RNA (lncRNA) plays an important role in the progression of non-small cell lung cancer (NSCLC). OBJECTIVES: To explore the role and potential molecular mechanism of lncRNA PSMA3-AS1 in promoting the proliferation, migration and invasion of NSCLC. MATERIAL AND METHODS: The expression of PSMA3-AS1, miR-17-5p and PD-L1 in a human bronchial epithelial cell line, BEAS-2B, and NSCLC cell lines, H226 and A549, were detected with quantitative real-time polymerase chain reaction (qRT-PCR) or western blot. The PSMA3-AS1 shRNA transfection was used to reduce the expression of PSMA3-AS1. Double fluorescent enzyme reporting was used to detect the relationship between PSMA3-AS1, miR-17-5p and PD-L1. Cell Counting Kit-8 (CCK-8), wound-healing and transwell assays, as well as western blot, were used to detect the expression of proliferation, migration, invasion, and epithelial-mesenchymal transition (EMT)-related proteins in lung cancer cells. RESULTS: The expression of PSMA3-AS1 in NSCLC cells was significantly higher than in human bronchial epithelial cells. The PSMA3-AS1 knockdown significantly reduced the proliferation, migration and invasion of lung cancer cells. In addition, double fluorescent enzyme results showed that PSMA3-AS1 could competitively bind miR-17-5p to PD-L1. The expression of miR-17-5p is low in lung cancer cells, while the expression of PD-L1 in them is high. Overexpression of PD-L1 reversed the inhibitory effect of PSMA3-AS1 knockdown on the proliferation, migration and invasion of lung cancer cells. CONCLUSIONS: Generally speaking, PSMA3-AS1 is highly expressed in NSCLC. The PSMA3-AS1 can promote the proliferation, migration and invasion of NSCLC cells by regulating miR-17-5p/PD-L1.


Assuntos
Carcinoma Pulmonar de Células não Pequenas , Neoplasias Pulmonares , MicroRNAs , RNA Longo não Codificante , Antígeno B7-H1 , Carcinoma Pulmonar de Células não Pequenas/genética , Movimento Celular , Proliferação de Células , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Pulmonares/genética , MicroRNAs/genética , Complexo de Endopeptidases do Proteassoma , RNA Antissenso , RNA Longo não Codificante/genética
6.
Leuk Res ; 110: 106706, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34563944

RESUMO

Chronic lymphocytic leukemia (CLL) is a malignant disorder of mature B lymphocytes, and the precise pathogenesis is largely unknown at present. This study set out to screen the differential expression profile of long non-coding RNA (lncRNA) by microarray and explore the underlying mechanism, biological function, and clinical significance of lncRNA in CLL cells. Compared to the lncRNA expression profiles of the control group, we picked lncRNA LEF1-AS1 for further exploration. By quantitative real-time polymerase chain reaction (qRT-PCR), we validated that primary CLL cells harbor higher lncRNA LEF1-AS1 levels than normal B cells. In the two cell lines with stable overexpression of LEF1-AS1, expression of LEF1 elevated on RNA and protein level, proliferation rates increased, and apoptosis rates decreased. In primary CLL cells, mRNA expression of LEF1 decreased by qRT-PCR after negatively regulating the expression of LEF1-AS1. RNA Binding Protein Immunoprecipitation and RNA pull-down demonstrated that LncRNA LEF1-AS1 and LEF1 protein could combine especially. This thesis concludes LEF1-AS1 may be an oncogenic lncRNA that regulates the target gene LEF1 by interacting with protein LEF1. However, the prognostic significance of lncRNA LEF1-AS1 in CLL patients is still unclear.


Assuntos
Biomarcadores Tumorais/metabolismo , Regulação Neoplásica da Expressão Gênica , Leucemia Linfocítica Crônica de Células B/patologia , Fator 1 de Ligação ao Facilitador Linfoide/metabolismo , RNA Antissenso/genética , RNA Longo não Codificante/genética , Idoso , Biomarcadores Tumorais/genética , Sobrevivência Celular , Feminino , Humanos , Leucemia Linfocítica Crônica de Células B/genética , Leucemia Linfocítica Crônica de Células B/metabolismo , Fator 1 de Ligação ao Facilitador Linfoide/genética , Masculino , Células Tumorais Cultivadas
7.
J Biol Chem ; 297(4): 101225, 2021 10.
Artigo em Inglês | MEDLINE | ID: mdl-34562449

RESUMO

The norovirus genome consists of a single positive-stranded RNA. The mechanism by which this single-stranded RNA genome is replicated is not well understood. To reveal the mechanism underlying the initiation of the norovirus genomic RNA synthesis by its RNA-dependent RNA polymerase (RdRp), we used an in vitro assay to detect the complementary RNA synthesis activity. Results showed that the purified recombinant RdRp was able to synthesize the complementary positive-sense RNA from a 100-nt template corresponding to the 3'-end of the viral antisense genome sequence, but that the RdRp could not synthesize the antisense genomic RNA from the template corresponding to the 5'-end of the positive-sense genome sequence. We also predicted that the 31 nt region at the 3'-end of the RNA antisense template forms a stem-loop structure. Deletion of this sequence resulted in the loss of complementary RNA synthesis by the RdRp, and connection of the 31 nt to the 3'-end of the inactive positive-sense RNA template resulted in the gain of complementary RNA synthesis by the RdRp. Similarly, an electrophoretic mobility shift assay further revealed that the RdRp bound to the antisense RNA specifically, but was dependent on the 31 nt at the 3'-end. Therefore, based on this observation and further deletion and mutation analyses, we concluded that the predicted stem-loop structure in the 31 nt end and the region close to the antisense viral genomic stem sequences are both important for initiating the positive-sense human norovirus genomic RNA synthesis by its RdRp.


Assuntos
Genoma Viral , Proteínas de Neoplasias/química , Norovirus/química , Conformação de Ácido Nucleico , RNA Antissenso/química , RNA Viral/química , RNA Polimerase Dependente de RNA/química , Humanos , Proteínas de Neoplasias/genética , Proteínas de Neoplasias/metabolismo , Norovirus/genética , RNA Antissenso/genética , RNA Antissenso/metabolismo , RNA Viral/biossíntese , RNA Viral/genética , RNA Polimerase Dependente de RNA/genética , RNA Polimerase Dependente de RNA/metabolismo
8.
PLoS One ; 16(8): e0256378, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34403446

RESUMO

Saliva is a matrix which may act as a vector for pathogen transmission and may serve as a possible proxy for SARS-CoV-2 contagiousness. Therefore, the possibility of detection of intracellular SARS-CoV-2 in saliva by means of fluorescence in situ hybridization is tested, utilizing probes targeting the antisense or sense genomic RNA of SARS-CoV-2. This method was applied in a pilot study with saliva samples collected from healthy persons and those presenting with mild or moderate COVID-19 symptoms. In all participants, saliva appeared a suitable matrix for the detection of SARS-CoV-2. Among the healthy, mild COVID-19-symptomatic and moderate COVID-19-symptomatic persons, 0%, 90% and 100% tested positive for SARS-CoV-2, respectively. Moreover, the procedure allows for simultaneous measurement of viral load ('presence', sense genomic SARS-CoV-2 RNA) and viral replication ('activity', antisense genomic SARS-CoV-2 RNA) and may yield qualitative results. In addition, the visualization of DNA in the cells in saliva provides an additional cytological context to the validity and interpretability of the test results. The method described in this pilot study may be a valuable diagnostic tool for detection of SARS-CoV-2, distinguishing between 'presence' (viral load) and 'activity' (viral replication) of the virus. Moreover, the method potentially gives more information about possible contagiousness.


Assuntos
COVID-19/diagnóstico , Hibridização in Situ Fluorescente/métodos , RNA Viral/análise , SARS-CoV-2/genética , Saliva/virologia , COVID-19/patologia , COVID-19/virologia , Estudos de Casos e Controles , Genômica , Humanos , RNA Antissenso/genética , RNA Antissenso/metabolismo , RNA Viral/genética , RNA Viral/metabolismo , SARS-CoV-2/isolamento & purificação , SARS-CoV-2/fisiologia , Índice de Gravidade de Doença , Carga Viral , Replicação Viral
9.
J Biotechnol ; 340: 75-101, 2021 Nov 10.
Artigo em Inglês | MEDLINE | ID: mdl-34371054

RESUMO

Non-coding natural antisense transcripts (ncNATs) are regulatory RNA molecules that are overlapping with as well as complementary to other transcripts. These transcripts are implicated in a broad variety of biological and pathological processes, including tumorigenesis and oncogenic progression. With this complex field still in its infancy, annotations, expression profiling and functional characterisations of ncNATs are far less comprehensive than those for protein-coding genes, pointing out substantial gaps in the analysis and characterisation of these regulatory transcripts. In this review, we discuss ncNATs from an analysis perspective, in particular regarding the use of high-throughput sequencing strategies, such as RNA-sequencing, and summarize the unique challenges of investigating the antisense transcriptome. Finally, we elaborate on their potential as biomarkers and future targets for treatment, focusing on cancer.


Assuntos
RNA Antissenso , Transcriptoma , Sequência de Bases , Sequenciamento de Nucleotídeos em Larga Escala , RNA Antissenso/genética , Análise de Sequência de RNA , Transcriptoma/genética
10.
Science ; 373(6558): 984-991, 2021 08 27.
Artigo em Inglês | MEDLINE | ID: mdl-34446600

RESUMO

Protein kinase activity must be precisely regulated, but how a cell governs hyperactive kinases remains unclear. In this study, we generated a constitutively active mitogen-activated protein kinase DYF-5 (DYF-5CA) in Caenorhabditis elegans that disrupted sensory cilia. Genetic suppressor screens identified that mutations of ADR-2, an RNA adenosine deaminase, rescued ciliary phenotypes of dyf-5CA We found that dyf-5CA animals abnormally transcribed antisense RNAs that pair with dyf-5CA messenger RNA (mRNA) to form double-stranded RNA, recruiting ADR-2 to edit the region ectopically. RNA editing impaired dyf-5CA mRNA splicing, and the resultant intron retentions blocked DYF-5CA protein translation and activated nonsense-mediated dyf-5CA mRNA decay. The kinase RNA editing requires kinase hyperactivity. The similar RNA editing-dependent feedback regulation restricted the other ciliary kinases NEKL-4/NEK10 and DYF-18/CCRK, which suggests a widespread mechanism that underlies kinase regulation.


Assuntos
Proteínas de Caenorhabditis elegans/genética , Proteínas de Caenorhabditis elegans/metabolismo , Caenorhabditis elegans/enzimologia , Cílios/metabolismo , Proteínas Quinases Ativadas por Mitógeno/genética , Proteínas Quinases Ativadas por Mitógeno/metabolismo , Edição de RNA , Adenosina Desaminase/genética , Adenosina Desaminase/metabolismo , Animais , Caenorhabditis elegans/genética , Núcleo Celular/metabolismo , Cílios/enzimologia , Ativação Enzimática , Fenótipo , Biossíntese de Proteínas , Proteínas Serina-Treonina Quinases/metabolismo , Precursores de RNA/genética , Precursores de RNA/metabolismo , Splicing de RNA , Estabilidade de RNA , RNA Antissenso/genética , RNA Antissenso/metabolismo , RNA de Cadeia Dupla/genética , RNA de Cadeia Dupla/metabolismo , RNA de Helmintos/genética , RNA de Helmintos/metabolismo , RNA Mensageiro/genética , RNA Mensageiro/metabolismo , Transdução de Sinais , Transcrição Genética
11.
World J Surg Oncol ; 19(1): 213, 2021 Jul 13.
Artigo em Inglês | MEDLINE | ID: mdl-34256796

RESUMO

BACKGROUND: Long non-coding RNA (lncRNA) MCM3AP-AS1 plays an oncogenic role in several malignancies, but its role in endometrioid carcinoma (EC) is unclear. This study was carried out to explore the role of MCM3AP-AS1 in EC. METHODS: A total of 60 EC patients were enrolled in this study. Expression levels of MCM3AP Antisense RNA 1 (MCM3AP-AS1), microRNA-126 (miR-126), and vascular endothelial growth factor (VEGF) in tissues and transfetced cells were measured by RT-qPCR. Cell transfections were performed to explore the interaction among MCM3AP-AS1, miR-126 and VEGF. Transwell assays were perfromed to evaluate the invasion and migration abilities of HEC-1 cells after transfection. RESULTS: MCM3AP-AS1 was upregulated in EC and predicted poor survival. MCM3AP-AS1 directly interacted with miR-126. In EC cells, overexpression of MCM3AP-AS1 and miR-126 did not significantly affect the expression of each other. In addition, overexpression of MCM3AP-AS1 increased the expression levels of VEGF, a target of miR-126. Moreover, overexpression of MCM3AP-AS1 and VEGF increased the migration and invasion rates of EC cells, while overexpression of miR-126 suppressed these cell behaviors. Overexpression of MCM3AP-AS1 attenuated the role of miR-126 in cell invasion and migration. CONCLUSIONS: Therefore, MCM3AP-AS1 may serve as a competing endogenous RNA (ceRNA) of miR-126 to upregulate VEGF, thereby regulating cancer cell behaviors in EC.


Assuntos
Carcinoma Endometrioide , MicroRNAs , RNA Longo não Codificante , Fator A de Crescimento do Endotélio Vascular , Acetiltransferases/genética , Feminino , Regulação Neoplásica da Expressão Gênica , Humanos , Peptídeos e Proteínas de Sinalização Intracelular , MicroRNAs/genética , Invasividade Neoplásica , Prognóstico , RNA Antissenso
12.
Aging (Albany NY) ; 13(13): 17285-17301, 2021 07 02.
Artigo em Inglês | MEDLINE | ID: mdl-34226297

RESUMO

LncRNAs play an important role in a variety of biological processes, such as cancer pathogenesis. The lncRNA zinc ribbon domain containing 1 antisense RNA 1 (ZNRD1-AS1) is a natural antisense transcript of ZNRD1. In this study, we found that ZNRD1-AS1 levels were significantly upregulated in gastric cancer tissues compared to those in adjacent healthy gastric tissues. ZNRD1-AS1 levels were correlated with lymph node metastasis, distal metastasis, and TNM stage, but were not correlated with age and sex. ZNRD1-AS1 knockdown suppressed cell proliferation, migration, and invasion, and promoted apoptosis. ZNRD1-AS1 overexpression had the opposite effect. ZNRD1-AS1 knockdown suppressed tumor growth and pulmonary metastasis in a nude mouse model ZNRD1-AS1 can bind to miR-9-5p and ZNRD1-AS1 knockdown can decrease the protein level of heat shock protein 90 alpha family class A member 1 (HSP90AA1), which is the target of miR-9-5p. The miR-9-5p inhibitor rescued the effect of ZNRD1-AS1 knockdown, and the mutant of miR-9-5p binding site on ZNRD1-AS1 sequence blocked the effect of ZNRD1-AS1 overexpression. In conclusion, ZNRD1-AS1 levels were upregulated in gastric cancer tissues, and knockdown of ZNRD1-AS1 suppressed gastric cancer cell proliferation and metastasis by targeting the miR-9-5p/HSP90AA1 axis. Our findings provide novel insights into the mechanism underlying the role of ZNRD1-AS1 in gastric cancer.


Assuntos
Proteínas de Choque Térmico HSP90/genética , Antígenos de Histocompatibilidade Classe I/genética , MicroRNAs/genética , Metástase Neoplásica/genética , RNA Antissenso/genética , Transdução de Sinais/genética , Neoplasias Gástricas/genética , Animais , Apoptose/genética , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células , Regulação Neoplásica da Expressão Gênica/genética , Técnicas de Silenciamento de Genes , Humanos , Camundongos , Camundongos Nus , Neoplasias Gástricas/patologia , Ensaios Antitumorais Modelo de Xenoenxerto
13.
Gene ; 800: 145839, 2021 Oct 20.
Artigo em Inglês | MEDLINE | ID: mdl-34274470

RESUMO

COVID-19 was first reported in Wuhan, China, in December 2019. It is widely accepted that the world will not return to its prepandemic normality until safe and effective vaccines are available and a global vaccination program has been successfully implemented. Antisense RNAs are single-stranded RNAs that occur naturally or are synthetic and enable hybridizing and protein-blocking translation. Therefore, the main objective of this study was to identify target markers in the RNA of the severe acute respiratory syndrome coronavirus, or SARS-CoV-2, with a length between 21 and 28 bases that could enable the development of vaccines and therapies based on antisense RNA. We used a search algorithm in C language to compare 3159 complete nucleotide sequences from SARS-CoV-2 downloaded from the repository of the National Center for Biotechnology Information. The objective was to verify whether any common sequences were present in all 3159 strains of SARS-CoV-2. In the first of three datasets (SARS-CoV-2), the algorithm found two sequences each of 21 nucleotides (Sequence 1: CTACTGAAGCCTTTGAAAAAA; Sequence 2: TGTGGTTATACCTACTAAAAA). In the second dataset (SARS-CoV) and third dataset (MERS-CoV), no sequences of size N between 21 and 28 were found. Sequence 1 and Sequence 2 were input into BLAST® ≫ blastn and recognized by the platform. The gene identified by the sequences found by the algorithm was the ORF1ab region of SARS-CoV-2. Considerable progress in antisense RNA research has been made in recent years, and great achievements in the application of antisense RNA have been observed. However, many mechanisms of antisense RNA are not yet understood. Thus, more time and money must be invested into the development of therapies for gene regulation mediated by antisense RNA to treat COVID-19 as no effective therapy for this disease has yet been found.


Assuntos
COVID-19/genética , RNA Antissenso/genética , SARS-CoV-2/genética , Algoritmos , COVID-19/virologia , Simulação por Computador , Regulação Viral da Expressão Gênica , Humanos
14.
BMC Cancer ; 21(1): 844, 2021 Jul 22.
Artigo em Inglês | MEDLINE | ID: mdl-34294084

RESUMO

BACKGROUND: Glioma is a common type of brain tumor and is classified as low and high grades according to morphology and molecules. Growing evidence has proved that long non-coding RNAs (lncRNAs) play pivotal roles in numerous tumors or diseases including glioma. Proteasome 20S subunit alpha 3 antisense RNA 1 (PSMA3-AS1), as a member of lncRNAs, has been disclosed to play a tumor-promoting role in cancer progression. However, the role of PSMA3-AS1 in glioma remains unknown. Therefore, we concentrated on researching the regulatory mechanism of PSMA3-AS1 in glioma. METHODS: PSMA3-AS1 expression was detected using RT-qPCR. Functional assays were performed to measure the effects of PSMA3-AS1 on glioma progression. After that, ENCORI ( http://starbase.sysu.edu.cn/ ) database was used to predict potential genes that could bind to PSMA3-AS1, and miR-411-3p was chosen for further studies. The interaction among PSMA3-AS1, miR-411-3p and homeobox A10 (HOXA10) were confirmed through mechanism assays. RESULTS: PSMA3-AS1 was verified to be up-regulated in glioma cells and promote glioma progression. Furthermore, PSMA3-AS1 could act as a competitive endogenous RNA (ceRNA) for miR-411-3p to regulate HOXA10 and thus affecting glioma progression. CONCLUSION: PSMA3-AS1 stimulated glioma progression via the miR-411-3p/HOXA10 pathway, which might offer a novel insight for the therapy and treatment of glioma.


Assuntos
Glioma/genética , Glioma/metabolismo , Proteínas Homeobox A10/metabolismo , MicroRNAs/metabolismo , RNA Antissenso/genética , RNA Longo não Codificante/genética , Regiões 3' não Traduzidas , Apoptose/genética , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Progressão da Doença , Regulação Neoplásica da Expressão Gênica , Glioma/patologia , Proteínas Homeobox A10/genética , Humanos , Complexo de Endopeptidases do Proteassoma/genética , Interferência de RNA , Transdução de Sinais
15.
Liver Int ; 41(11): 2788-2800, 2021 11.
Artigo em Inglês | MEDLINE | ID: mdl-34328265

RESUMO

BACKGROUND & AIMS: Noncoding RNAs (ncRNAs) play critical roles in hepatocellular carcinoma (HCC) progression. Here, by performing RNA-sequencing (RNA-Seq) profiling, we sought to identify novel ncRNAs that potentially drive the heterogeneous progression of liver cancers. METHODS: RNA-Seq profiles were obtained from 68 HCC specimens and 10 samples of adjacent non-tumour liver tissues. The functional significance of the potential driver ncRNAs was evaluated by cell experiments. RESULTS: TPRG1-AS1 was identified as a potential driver noncoding RNA that promotes heterogeneous liver cancer progression. TPRG1-AS1 induced tumour suppressor RNA-binding motif protein 24 (RBM24), suppressing tumour growth by activating apoptotic tumour cell death. In addition, we report that TPRG1-AS1 acts as a competing endogenous RNA (ceRNA) for RBM24, sponging miR-4691-5p and miR-3659 to interfere with their binding to RBM24. CONCLUSIONS: We suggest that TPRG1-AS1 is a novel ceRNA sponging miR-4691-5p and miR-3659, resulting in RBM24 expression and suppression of liver cancer growth. Our results provide new insights into the functions of ncRNAs in heterogeneous HCC progression.


Assuntos
Carcinoma Hepatocelular , Neoplasias Hepáticas , MicroRNAs , RNA Antissenso/genética , Proteínas de Ligação a RNA , Carcinoma Hepatocelular/genética , Linhagem Celular Tumoral , Proliferação de Células , Progressão da Doença , Regulação Neoplásica da Expressão Gênica , Humanos , Neoplasias Hepáticas/genética , MicroRNAs/genética , Proteínas de Ligação a RNA/genética , Proteínas de Ligação a RNA/metabolismo
16.
BMC Cancer ; 21(1): 820, 2021 Jul 16.
Artigo em Inglês | MEDLINE | ID: mdl-34271873

RESUMO

BACKGROUND: MCM3AP-AS1 is a recently characterized lncRNA playing an oncogenic role in several cancers. However, its role in lung cancer remains unknown. Here, we aimed to explore the functions of MCM3AP-AS1 in small cell lung cancer (SCLC) and the possible underlying mechanisms. METHODS: MCM3AP-AS1 and ROCK1 levels in SCLC patients were analyzed by qPCR. RNA pull-down and luciferase assays were performed to analyze the interaction between MCM3AP-AS1 and miR-148a. ROCK1 mRNA and protein levels were detected by qPCR and Western blot, respectively. Cell invasion and migration were analyzed by Transwell assays. RESULTS: MCM3AP-AS1 was upregulated in patients with SCLC, and a high MCM3AP-AS1 level was accompanied by a low survival rate. The binding of MCM3AP-AS1 to miR-148a predicted by bioinformatics analysis was verified by RNA pull-down and luciferase assays. However, MCM3AP-AS1 and miR-148a did not affect each other's expression. ROCK1 was upregulated in SCLC tissues and positively correlated with MCM3AP-AS1. In SCLC cells, MCM3AP-AS1 overexpression increased ROCK1 and promoted cancer cell invasion and migration, while miR-148a overexpression showed the opposite effects and attenuated the effects of MCM3AP-AS1 overexpression on ROCK1 expression and cell behaviors. CONCLUSIONS: MCM3AP-AS1 sponges miR-148a, thereby increasing SCLC cell invasion and migration via upregulating ROCK1 expression.


Assuntos
Acetiltransferases/genética , Peptídeos e Proteínas de Sinalização Intracelular/genética , Neoplasias Pulmonares/metabolismo , MicroRNAs/metabolismo , RNA Longo não Codificante/metabolismo , Carcinoma de Pequenas Células do Pulmão/metabolismo , Movimento Celular/fisiologia , Humanos , Neoplasias Pulmonares/genética , Neoplasias Pulmonares/patologia , MicroRNAs/genética , Invasividade Neoplásica , RNA Antissenso/genética , RNA Antissenso/metabolismo , RNA Longo não Codificante/genética , Carcinoma de Pequenas Células do Pulmão/genética , Carcinoma de Pequenas Células do Pulmão/patologia , Transfecção
17.
PLoS Pathog ; 17(7): e1009762, 2021 07.
Artigo em Inglês | MEDLINE | ID: mdl-34297775

RESUMO

Pathogens integrate multiple environmental signals to navigate the host and control the expression of virulence genes. In this process, small regulatory noncoding RNAs (sRNAs) may function in gene expression as post-transcriptional regulators. In this study, the sRNA Xonc3711 functioned in the response of the rice pathogen, Xanthomonas oryzae pv. oryzicola (Xoc), to oxidative stress. Xonc3711 repressed production of the DNA-binding protein Xoc_3982 by binding to the xoc_3982 mRNA within the coding region. Mutational analysis showed that regulation required an antisense interaction between Xonc3711 and xoc_3982 mRNA, and RNase E was needed for degradation of the xoc_3982 transcript. Deletion of Xonc3711 resulted in a lower tolerance to oxidative stress due to the repression of flagella-associated genes and reduced biofilm formation. Furthermore, ChIP-seq and electrophoretic mobility shift assays showed that Xoc_3982 repressed the transcription of effector xopC2, which contributes to virulence in Xoc BLS256. This study describes how sRNA Xonc3711 modulates multiple traits in Xoc via signals perceived from the external environment.


Assuntos
Estresse Oxidativo/fisiologia , RNA Antissenso/metabolismo , Xanthomonas/patogenicidade , Oryza/parasitologia , Doenças das Plantas/genética , Pequeno RNA não Traduzido , Virulência/genética , Xanthomonas/genética , Xanthomonas/metabolismo
18.
Mol Cell Biol ; 41(10): e0011521, 2021 09 24.
Artigo em Inglês | MEDLINE | ID: mdl-34309414

RESUMO

Long noncoding RNAs (lncRNAs) have key functions in modulating cervical cancer (CC) genesis and progression. This work focused on exploring lncRNA HNRNPU-AS1's function in CC and the underlying mechanism. HNRNPU-AS1, AXIN2, and microRNA 205-5p (miR-205-5p) levels in CC cases were measured through reverse transcription-quantitative PCR. The relationship between miR-205-5p and AXIN2 or HNRNPU-AS1 was validated through a dual-luciferase assay. Cell proliferation was examined by CCK-8 and cell apoptosis by colony formation and flow cytometry analysis. HNRNPU-AS1 expression loss could be observed in CC patients and cell lines, which predicted the dismal prognosis of CC cases. Moreover, it was identified that the miR-205-5p level was upregulated, which acted as an inhibitory target of HNRNPU-AS1 and AXIN2. HNRNPU-AS1 inhibited cell proliferation and promoted apoptosis. As revealed by Kaplan-Meier curve, CC cases showing low HNRNPU-AS1, high miR-205-5p, and low AXIN2 levels had the poorest prognosis. AXIN2 reversed the CC cell proliferation-promoting, apoptosis-inhibiting, and Wnt/ß-catenin signaling-activating behavior mediated by miR-205-5p or HNRNPU-AS1 knockout. In conclusion, the overexpression of lncRNA HNRNPU-AS1 suppressed CC progression by inhibiting the Wnt/ß-catenin pathway through the miR-205-5p/AXIN2 axis.


Assuntos
Proteína Axina/genética , Ribonucleoproteínas Nucleares Heterogêneas Grupo U/genética , MicroRNAs/genética , Apoptose/genética , Linhagem Celular Tumoral , Movimento Celular/genética , Proliferação de Células/genética , Feminino , Expressão Gênica/genética , Regulação Neoplásica da Expressão Gênica/genética , Humanos , Prognóstico , RNA Antissenso/genética , RNA Longo não Codificante/genética , Neoplasias do Colo do Útero/genética , Neoplasias do Colo do Útero/metabolismo , Neoplasias do Colo do Útero/fisiopatologia , Via de Sinalização Wnt/genética , beta Catenina/genética
19.
Genes (Basel) ; 12(5)2021 05 17.
Artigo em Inglês | MEDLINE | ID: mdl-34067766

RESUMO

The leukocyte common antigen CD45 is a transmembrane phosphatase expressed on all nucleated hemopoietic cells, and the expression levels of its splicing isoforms are closely related to the development and function of lymphocytes. PEBP1P3 is a natural antisense transcript from the opposite strand of CD45 intron 2 and is predicted to be a noncoding RNA. The genotype-tissue expression and quantitative PCR data suggested that PEBP1P3 might be involved in the regulation of expression of CD45 splicing isoforms. To explore the regulatory mechanism of PEBP1P3 in CD45 expression, DNA methylation and histone modification were detected by bisulfate sequencing PCR and chromatin immunoprecipitation assays, respectively. The results showed that after the antisense RNA PEBP1P3 was knocked down by RNA interference, the DNA methylation of CD45 intron 2 was decreased and histone H3K9 and H3K36 trimethylation at the alternative splicing exons of CD45 DNA was increased. Knockdown of PEBP1P3 also increased the binding levels of chromatin conformation organizer CTCF at intron 2 and the alternative splicing exons of CD45. The present results indicate that the natural antisense RNA PEBP1P3 regulated the alternative splicing of CD45 RNA, and that might be correlated with the regulation of histone modification and DNA methylation.


Assuntos
Processamento Alternativo , Metilação de DNA , Código das Histonas , Antígenos Comuns de Leucócito/genética , RNA Antissenso/genética , Fator de Ligação a CCCTC/metabolismo , Humanos , Células Jurkat , Antígenos Comuns de Leucócito/metabolismo , Ligação Proteica , Pseudogenes , RNA Antissenso/metabolismo
20.
Methods Mol Biol ; 2323: 233-247, 2021.
Artigo em Inglês | MEDLINE | ID: mdl-34086285

RESUMO

Knockdown or silencing of a specific gene presents a powerful strategy for elucidating gene function in a variety of organisms. To date, efficient silencing methods have been established in eukaryotes, but not bacteria. In this chapter, an efficient and versatile gene silencing method using artificial small RNA (afsRNA) is described. For this purpose, target-recognizing sequences were introduced in specially designed RNA scaffolds to exist as single-stranded stretches in afsRNA. The translation initiation region of target genes was used as the sequence for afsRNA recognition, based on the theory that this site is usually highly accessible to ribosomes, and therefore, possibly, afsRNA. Two genes transcribed as monocistrons were tested with our protocol. Both genes were effectively silenced by their cognate afsRNAs.


Assuntos
Escherichia coli/genética , Regulação Bacteriana da Expressão Gênica/genética , Técnicas de Silenciamento de Genes , Interferência de RNA , RNA Antissenso/genética , RNA Interferente Pequeno/genética , Sequência de Bases , Regulação Bacteriana da Expressão Gênica/efeitos dos fármacos , Conformação de Ácido Nucleico , Iniciação Traducional da Cadeia Peptídica , Fosforilação , Plasmídeos/genética , Reação em Cadeia da Polimerase em Tempo Real/métodos , Transformação Bacteriana
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...