Your browser doesn't support javascript.
loading
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 7.660
Filtrar
1.
J Trauma Acute Care Surg ; 94(2): 212-219, 2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36694332

RESUMO

INTRODUCTION: Thromboelastography (TEG)-derived maximum amplitude-reaction time (MA-R) ratio that accounts for both hypocoagulable and hypercoagulable changes in coagulation is associated with poor outcomes in adults. The relationship between these TEG values and outcomes has not been studied in children. METHODS: In a retrospective cohort study, a level I pediatric trauma center database was queried for children younger than 18 years who had a TEG assay on admission between 2016 and 2020. Demographics, injury characteristics, and admission TEG values were recorded. The MA-R ratio was calculated and divided into quartiles. Main outcomes included mortality, transfusion within 24 hours of admission, and thromboembolism. A logistic regression model was generated adjusting for age, Injury Severity Score, injury mechanism, admission shock, and Glasgow Coma Scale. RESULTS: In total, 657 children were included, of which 70% were male and 75% had blunt mechanism injury. The median (interquartile range) age was 11 (4-14) years, the median (interquartile range) Injury Severity Score was10 (5-22), and in-hospital mortality was 7% (n = 45). Of these patients, 17% (n = 112) required transfusion. Most R and MA values were within normal limits. On unadjusted analysis, the lowest MA-R ratio quartile was associated with increased mortality (15% vs. 4%, 5%, and 4%, respectively; p < 0.001) and increased transfusion need (26% vs. 12%, 16%, and 13%, respectively; p = 0.002) compared with higher quartiles. In the logistic regression models, a low MA-R ratio was independently associated with increased in-hospital mortality (odds ratio [95% confidence interval], 4.4 [1.9-10.2]) and increased need for transfusion within 24 hours of admission (odds ratio [95% confidence interval], 2.0 [1.2-3.4]) compared with higher MA-R ratio. There was no association between MA-R ratio and venous thromboembolic events (venous thromboembolic event rate by quartile: 4%, 2%, 1%, and 3%). CONCLUSION: Although individual admission TEG values are not commonly substantially deranged in injured children, the MA-R ratio is an independent predictor of poor outcome. Maximum amplitude-reaction time ratio may be a useful prognostic tool in pediatric trauma; validation is necessary. LEVEL OF EVIDENCE: Therapeutic/Care Management; Level III.


Assuntos
Transtornos da Coagulação Sanguínea , Trombofilia , Tromboembolia Venosa , Ferimentos e Lesões , Adulto , Humanos , Masculino , Criança , Adolescente , Feminino , Tromboelastografia , Estudos Retrospectivos , Tempo de Reação , Trombofilia/complicações , Escala de Gravidade do Ferimento , Ferimentos e Lesões/complicações , Ferimentos e Lesões/diagnóstico , Ferimentos e Lesões/terapia , Transtornos da Coagulação Sanguínea/etiologia , Transtornos da Coagulação Sanguínea/complicações
2.
Artigo em Inglês | MEDLINE | ID: mdl-36673963

RESUMO

Recurrent pregnancy loss (RPL) is one of the most challenging and difficult areas of reproductive treatment due to the immense emotional suffering inflicted on families and couples affected by RPL. As a result, it is predicted that couples experiencing recurrent pregnancy loss would have an increase in marital problems, stress levels, and anxiety, preventing them from achieving their family goals. The current cross-sectional study aimed to target pregnant women with thrombophilia with a history of RPL to observe their intimacy problems, stress levels, and couple satisfaction by completing a series of digital questionnaires. These patients were considered as the reference group, while the control group was formed by other women with thrombophilia and a history of RPL who eventually achieved pregnancy and gave birth. A total of 238 complete questionnaires were recorded (157 in the reference group and 81 in the control group). It was observed that women in the reference group who did not give birth had a significantly higher proportion of three or more pregnancy attempts (54.1% vs. 39.5%) and a significantly higher proportion of three more pregnancy losses (68.8% vs. 55.6%). It was observed that patients in the reference group were more likely to be emotion-oriented (42.7% vs. 27.2%). Also, women in the reference group had higher levels of dissatisfaction and lower levels of self-acceptance, pleasure, and marital quality scores. The total SII and DSCS scores were significantly lower than women with thrombophilia with a history of RPL who eventually gave birth. Women from the reference group had significantly greater intimacy problems and stress levels while having lower openness scores and self-esteem scores than women in the control group. It is possible that women with thrombophilia and recurrent pregnancy loss are more dissatisfied with their marriages than those who subsequently had one child. Since the financial status of those who achieved pregnancy was observed to be higher, it is likely that they achieved pregnancy by ART interventions, as they reported in questionnaires. It is important to target families afflicted by thrombophilia and other reasons for infertility to ease their access to ART therapies. By achieving their objectives, affected families will minimize dissatisfaction, divorce rates, and stress.


Assuntos
Aborto Habitual , Aborto Induzido , Trombofilia , Criança , Humanos , Gravidez , Feminino , Estudos Transversais , Trombofilia/epidemiologia , Aborto Habitual/epidemiologia , Aborto Habitual/psicologia , Parto
3.
PLoS One ; 18(1): e0269738, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36607961

RESUMO

INTRODUCTION: Abnormal coagulation and inflammation are hallmarks of SARs-COV-19. Stratifying affected patients on admission to hospital may help identify those who at are risk of developing severe disease early on. Rotational Thromboelastometry (ROTEM) is a point of care test that can be used to measure abnormal coagulation and calprotectin is a measure of inflammation. AIM: Assess if ROTEM can measure hypercoagulability on admission and identify those who will develop severe disease early on. Assess if calprotectin can measure inflammation and if there is a correlation with ROTEM and calprotectin. METHODS: COVID-19 patients were recruited on admission and ROTEM testing was undertaken daily for a period of 7 days. Additionally inflammatory marker calprotectin was also tested for the same period. RESULTS: 33 patients were recruited to the study out of which 13 were admitted to ITU and 20 were treated on the ward. ROTEM detected a hypercoagulable state on admission but did not stratify between those admitted to a ward or escalated to ITU. Calprotectin levels were raised but there was no statistical difference (p = 0.73) between patients admitted to a ward or escalated to ITU. Significant correlations were observed between FIBA5 (r = 0.62; p<0.00), FIBCFT (r = -0.57; p<0.00), FIBMCF (r = 0.64; p<0.00) and INMCF (r = 0.57; p<0.00) and calprotectin. CONCLUSION: COVID-19 patients were hypercoagulable on admission. The correlations between ROTEM and calprotectin underline the interactions between inflammation and coagulation.


Assuntos
COVID-19 , Trombofilia , Humanos , Tromboelastografia , COVID-19/complicações , COVID-19/diagnóstico , Projetos Piloto , Trombofilia/diagnóstico , Inflamação
4.
Pediatr Infect Dis J ; 42(2): 143-145, 2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36638401

RESUMO

In patients with SarS-CoV2 and chronic Hepatitis B (HBV) co-infection liver injury is associated with a worse prognosis. We report a case of acute chronic liver failure (ACLF) with encephalopathy due to HBV reactivation during COVID-19 with undetectable INR. Thromboelastography showed a profile consistent with a prothrombotic state so INR was not a reliable marker of liver function until plasma infusion. After plasma infusion, indeed, an imbalance of hepatic function was shown by an underlying INR prolongation that was consistent with an ACLF.


Assuntos
Insuficiência Hepática Crônica Agudizada , COVID-19 , Hepatite B Crônica , Hepatite B , Trombofilia , Feminino , Humanos , Adolescente , Hepatite B Crônica/complicações , RNA Viral , Insuficiência Hepática Crônica Agudizada/complicações , COVID-19/complicações , SARS-CoV-2 , Hepatite B/complicações , Prognóstico , Vírus da Hepatite B , Trombofilia/complicações
5.
J Trauma Acute Care Surg ; 94(2): 179-186, 2023 Feb 01.
Artigo em Inglês | MEDLINE | ID: mdl-36694329

RESUMO

BACKGROUND: Sex dimorphisms in coagulation are well established, with female-specific hypercoagulability conferring a survival benefit in the setting of trauma-induced coagulopathy (TIC). The mechanism behind these phenomena remains to be elucidated. We hypothesize that estradiol provokes a hypercoagulable profile and alters clot proteomics and fibrin crosslinking. METHODS: Whole blood was collected from healthy adult volunteers (n = 30). A battery of thrombelastography (TEG) assays (native, kaolin, platelet-mapping, functional fibrinogen), whole blood thrombin generation, proteomics, and clot structure architecture (via analysis of fibrin crosslinks and fluorescent fibrinogen-visualized clots) were performed after pre-treatment of the blood with physiologic concentrations of beta-estradiol. In addition, a prospective study of coagulation through the menstrual cycle was conducted by collecting blood from women on peak and nadir estrogen days in the standard 28-day menstrual cycle. RESULTS: On TEG, in females, estradiol provoked a hypercoagulable phenotype, specifically a shorter time to clot formation and greater thrombin generation, greater rate of clot propagation and functional fibrinogen, higher clot strength, and diminished clot fibrinolysis. In both males and females, estradiol increased platelet hyperactivity. Similar changes were seen in time to clot formation and clot strength in vivo during peak estrus of the menstrual cycle. On proteomic analysis, in both males and females, estradiol was associated with increases in abundance of several procoagulant and antifibrinolytic proteins. Crosslinking mass spectrometry analysis showed addition of estradiol increased the abundance of several FXIII crosslinks within the FIBA alpha chain in both sexes. Fluorescent fibrinogen analysis revealed a trend toward increased fiber resolvability index after addition of estradiol. CONCLUSION: Estradiol provokes a hypercoagulable phenotype, affecting time to clot formation, clot propagation, clot strength, clot fibrinolysis, and clot structure. In sum, these data highlight the role of estradiol is driving female-specific hypercoagulability and highlights its potential role as a therapeutic adjunct in resuscitation of TIC.


Assuntos
Transtornos da Coagulação Sanguínea , Trombofilia , Trombose , Masculino , Feminino , Humanos , Fibrina , Estradiol , Trombina , Caracteres Sexuais , Estudos Prospectivos , Proteômica , Tromboelastografia/métodos , Fibrinogênio/metabolismo , Trombofilia/etiologia
6.
J Thromb Haemost ; 21(1): 164-174, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36695379

RESUMO

Activated protein C resistance (APC-R) due to the single-nucleotide polymorphism factor V Leiden (FVL) is the most common cause of hereditary thrombophilia. It is found predominantly in Caucasians and is uncommon or absent in other populations. Although FVL is responsible for >90% of cases of hereditary APC-R, a number of other F5 variants that also confer various degrees of APC-R and thrombotic risk have been described. Acquired APC-R due to increased levels of coagulation factors, reduced levels of inhibitors, or the presence of autoantibodies occurs in a variety of conditions and is an independent risk factor for thrombosis. It is common for thrombophilia screening protocols to restrict assessment for APC-R to demonstrating the presence or absence of FVL. The aim of this Scientific and Standardisation Committee communication is to detail the causes of FVL-independent APC-R to widen the diagnostic net, particularly in situations in which in vitro APC-R is encountered in the absence of FVL. Predilution clotting assays are not FVL specific and are used to detect clinically significant F5 variants conferring APC-R, whereas different forms of acquired APC-R are preferentially detected using the classical activated partial thromboplastin time-based APC-R assay without predilution and/or endogenous thrombin potential APC-R assays. Resource-specific recommendations are given to guide the detection of FVL-independent APC-R.


Assuntos
Resistência à Proteína C Ativada , Trombofilia , Trombose , Humanos , Resistência à Proteína C Ativada/diagnóstico , Resistência à Proteína C Ativada/genética , Fator V/genética , Fator V/metabolismo , Trombofilia/diagnóstico , Coagulação Sanguínea
9.
J Thromb Haemost ; 21(1): 47-56, 2023 Jan.
Artigo em Inglês | MEDLINE | ID: mdl-36695395

RESUMO

BACKGROUND: Unprovoked venous thromboembolism (VTE) is rare in pediatrics. Current recommendations for anticoagulation duration after unprovoked VTE differ for pediatric and adult populations. OBJECTIVES: This single-center, retrospective cohort study aimed to determine the incidence rate of recurrent VTE in children and adolescents with unprovoked VTE, evaluate the potential risk factors for recurrence, and describe the anticoagulation regimens and bleeding in this population. METHODS: Children with an index, unprovoked VTE at the age of 1 to <21 years between 2003 and 2021 were included. The time to recurrent VTE and anticoagulation duration were summarized using Kaplan-Meier estimators. Clinical covariates were assessed for association with recurrence using stratified Kaplan-Meier curves and univariate Cox proportional hazards regression. RESULTS: Eighty-five children met the inclusion criteria, and there were 26 recurrent events in 250 person-years of follow-up (incidence rate = 104 [95% CI, 71-153] per 1000 person-years). An age of ≥12 years at index VTE (hazard ratio [HR], 7.56; 95% CI, 1.60-35.83) and inherited thrombophilia (HR, 2.28; 95% CI, 1.05-4.95) were significantly associated with recurrent VTE. Female sex had a nonstatistically significant decreased hazard of recurrence (HR, 0.56; 95% CI, 0.25-1.27). Duration of anticoagulation was variable, with a median duration of 274 days (IQR, 101-2357) for outpatient therapeutic anticoagulation. Twelve of the 26 (46%) recurrent events occurred while anticoagulation was prescribed. CONCLUSION: The incidence rate of recurrent VTE in pediatric patients with a prior unprovoked VTE is high, particularly for adolescents and those with inherited thrombophilia. Therefore, future research should focus on the efficacy of prolonged anticoagulation for this population.


Assuntos
Trombofilia , Tromboembolia Venosa , Adulto , Humanos , Feminino , Adolescente , Criança , Lactente , Tromboembolia Venosa/diagnóstico , Tromboembolia Venosa/tratamento farmacológico , Tromboembolia Venosa/epidemiologia , Anticoagulantes/uso terapêutico , Estudos Retrospectivos , Coagulação Sanguínea , Fatores de Risco , Trombofilia/complicações , Trombofilia/diagnóstico , Trombofilia/tratamento farmacológico , Recidiva
10.
Clin Appl Thromb Hemost ; 29: 10760296221151166, 2023.
Artigo em Inglês | MEDLINE | ID: mdl-36650707

RESUMO

BACKGROUND: Legg-Calvé-Perthes disease (LCPD) is a pediatric disorder that occurs due to the avascular necrosis of the femoral head and affects the range of motion of the hip in various degrees. Its etiology is still unknown, although it has been associated with coagulation abnormalities, however, the lack of reproducibility in the results in various studies has created a controversy as to whether hemostasis disorders are related to LCPD. On the other hand, there is little information on laboratory studies that could facilitate the diagnosis and treatment of LCPD. METHODS: Blood and plasma samples were tested from 25 patients with LCPD and 50 healthy controls, matched by sex and age. Cellular markers were evaluated through complete blood count, as well as coagulation times, coagulation factors activity, antithrombotic proteins, and homocysteine concentration. RESULTS: After assessing activity value frequencies in each group, the results showed more significant activity in some of the biological risk markers of thrombophilia, presenting a substantial difference in prothrombin time↘, FV↗, FVIII↗, FIX↗, and Hcy↗. These values imply that there may be hypercoagulable states in patients, which can cause thrombotic events. CONCLUSIONS: Diminished prothrombin time and increase in FV activity, FVIII, FIX, and Hcy concentration support the hypothesis that microthrombi formation in small-caliber vessels could be causing avascularity and femoral necrosis, which are traits of LCPD. In addition, based on our results, we believe that the laboratory studies carried out are very useful in the diagnosis and treatment of LCPD.


Assuntos
Transtornos da Coagulação Sanguínea , Hemostáticos , Doença de Legg-Calve-Perthes , Trombofilia , Criança , Humanos , Doença de Legg-Calve-Perthes/diagnóstico , Doença de Legg-Calve-Perthes/etiologia , Fator IX , Tempo de Protrombina , Reprodutibilidade dos Testes , Trombofilia/complicações , Transtornos da Coagulação Sanguínea/complicações , Hemostasia
11.
Artigo em Inglês | MEDLINE | ID: mdl-36554381

RESUMO

Recurrent Pregnancy Loss (RPL) affects between 1% to 5% of women of reproductive age. It is widely believed that RPL is a complex disorder that is influenced by chromosomal abnormalities, genetic mutations, uterine anatomic deformity, endocrine dysfunction, immunologic factors, infections, and the environment. Thrombotic disorders are a frequent cause of RPL, accounting for almost half of all cases; however, in the rest of the cases, the cause of RPL remains unclear. Therefore, in this study, it was planned to determine the genetic mutations involved in RPL during the first and second trimester of pregnancy. An observational retrospective cohort study was conducted in 2021, collecting data from 157 first trimester miscarriages and 54 s trimester pregnancies. All patients with a panel of laboratory and genetic analysis for thrombophilia were included for data analysis. It was observed that four factors were significantly more prevalent in one of the groups. Factor V Leiden (FVL) homozygosity and antiphospholipid syndrome (APS) antibodies were statistically significantly more common in pregnant women who suffered first trimester pregnancy losses. On the other hand, Protein C deficiency and Glycoprotein Ia polymorphism were statistically significantly more frequent in the second trimester group. The strongest independent risk factors for first trimester pregnancy loss were FVL and prothrombin (PT) compound mutations (OR = 3.11), followed by FVL homozygous mutation (OR = 3.66), and APS antibodies (OR = 4.47). Regarding second trimester pregnancy loss risk factors, the strongest were FVL and PT compound (OR = 3.24), followed by Glycoprotein Ia polymorphism (OR = 3.61), and respectively, APS antibodies (OR = 3.85). Numerous thrombophilic risk factors for early and late pregnancy loss have been found, including several mutations that seem to occur more often either during the first or the second trimester. Even though we are aware of risk-free and efficient diagnostics for thrombophilia abnormalities, no intervention has been proved to be clearly successful after the detection of these variables.


Assuntos
Aborto Habitual , Trombofilia , Feminino , Humanos , Gravidez , Aborto Habitual/genética , Glicoproteínas , Mutação , Segundo Trimestre da Gravidez , Gestantes , Estudos Retrospectivos , Trombofilia/epidemiologia , Trombofilia/genética , Trombofilia/complicações
12.
Viruses ; 14(12)2022 Dec 09.
Artigo em Inglês | MEDLINE | ID: mdl-36560757

RESUMO

Because of the interface between coagulation and the immune response, it is expected that COVID-19-associated coagulopathy occurs via activated protein C signaling. The objective was to explore putative changes in the expression of the protein C signaling network in the liver, peripheral blood mononuclear cells, and nasal epithelium of patients with COVID-19. Single-cell RNA-sequencing data from patients with COVID-19 and healthy subjects were obtained from the COVID-19 Cell Atlas database. A functional protein-protein interaction network was constructed for the protein C gene. Patients with COVID-19 showed downregulation of protein C and components of the downstream protein C signaling cascade. The percentage of hepatocytes expressing protein C was lower. Part of the liver cell clusters expressing protein C presented increased expression of ACE2. In PBMC, there was increased ACE2, inflammatory, and pro-coagulation transcripts. In the nasal epithelium, PROC, ACE2, and PROS1 were expressed by the ciliated cell cluster, revealing co-expression of ACE-2 with transcripts encoding proteins belonging to the coagulation and immune system interface. Finally, there was upregulation of coagulation factor 3 transcript in the liver and PBMC. Protein C could play a mechanistic role in the hypercoagulability syndrome affecting patients with severe COVID-19.


Assuntos
COVID-19 , Trombofilia , Humanos , COVID-19/genética , Leucócitos Mononucleares/metabolismo , SARS-CoV-2/genética , Proteína C/genética , Proteína C/metabolismo , Regulação para Baixo , Transcriptoma , Enzima de Conversão de Angiotensina 2/genética , Enzima de Conversão de Angiotensina 2/metabolismo , Peptidil Dipeptidase A/metabolismo , Trombofilia/genética
13.
Artigo em Inglês | MEDLINE | ID: mdl-36532100

RESUMO

Despite the increase in assisted reproductive technologies, the high rates of infertility and pregnancy complications are a major concern to infertility specialists worldwide. Infertility may be attributed to pregnancy complications like thrombophilia, preeclampsia and fibrin-induced recurrent pregnancy loss (RPL). Renin-angiotensin-aldosterone system (RAAS) directly or indirectly causes preeclampsia and thrombophilia through the fibrinolytic pathway that ultimately leads to RPL or infertility. The underlying mechanisms of this interaction are still unclear. The present comprehensive review is intended to demonstrate the role and interaction of RAAS and fibrinolytic pathways in pregnancy complications. How this interaction can induce pregnancy complications, and ultimately infertility, is also discussed in the light of current evidence. This study also presents common markers that link RAAS and fibrinolytic processes in developing thrombophilia, preeclampsia and RPL. The common link in these pathways is ACE gene I/D polymorphism. Apart from ACE, PAI-1, VIIa, XIIa, AT1R, AT1AA, and TF are common molecules that can delineate the underlying causes of pregnancy complications and infertility.


Assuntos
Infertilidade , Pré-Eclâmpsia , Trombofilia , Feminino , Humanos , Gravidez , Peptidil Dipeptidase A/genética , Pré-Eclâmpsia/genética , Sistema Renina-Angiotensina/genética , Trombofilia/complicações , Trombofilia/genética
14.
BMC Pregnancy Childbirth ; 22(1): 944, 2022 Dec 16.
Artigo em Inglês | MEDLINE | ID: mdl-36526982

RESUMO

BACKGROUND: Thrombophilia is a group of disorders that result in a blood hypercoagulable state and induce thrombosis, which was found widely existed in recurrent pregnancy loss (RPL). More and more research about thrombophilia has been conducted but the association between thrombophilia and RPL remains uncertain. Thus, it's necessary to combine relevant literature to find the research hotspots and analyze the internal link between different study points, and then predict the development trend in RPL with thrombophilia. METHODS: Relevant articles between 1970 and 2022 were obtained from the Web of Science (WoS) database. Software VOSviewer and CiteSpace were used to perform the analysis and conduct visualization of scientific productivity and emerging trends. RESULTS: Seven hundred twenty-five articles published in recent 30 years by 3205 authors from 1139 organizations and 68 countries were analyzed. 37authors, 38 countries, and 53 organizations published papers ≥5. The United States was the most productive country and Univ Amsterdam was the most productive institution. Journal thrombosis and haemostasis had the most total citations. In keyword and clusters, factor-v-Leiden, inherited thrombophilia, activated protein-c, low-dose aspirin, molecular-weigh heparin, polymorphism had high-frequency focus on its etiology, diagnostics, and therapeutics. The strongest keyword bursts showed the research hotspots changed over time. CONCLUSIONS: There could be differences in the clinical relevance of different type of thrombophilia, as well as single and multiple thrombophilic factors. Anticoagulation and immunotherapy are currently the main treatment options. More clinical trials and basic research are expected and we should attach more attention to the whole management of in-vitro fertilization in the future.


Assuntos
Aborto Habitual , Trombofilia , Trombose , Gravidez , Feminino , Humanos , Estados Unidos , Trombofilia/tratamento farmacológico , Aborto Habitual/epidemiologia , Aborto Habitual/etiologia , Bibliometria
15.
Hamostaseologie ; 42(6): 370-380, 2022 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-36549289

RESUMO

Thrombophilia leads to an increased risk of venous thromboembolism. Widely accepted risk factors for thrombophilia comprise deficiencies of protein C, protein S, and antithrombin, as well as the factor V "Leiden" mutation, the prothrombin G20210A mutation, dysfibrinogenemia, and, albeit less conclusive, increased levels of factor VIII. Besides these established markers of thrombophilia, risk factors of unclear significance have been described in the literature. These inherited risk factors include deficiencies or loss-of-activity of the activity of ADAMTS13, heparin cofactor II, plasminogen, tissue factor pathway inhibitor (TFPI), thrombomodulin, protein Z (PZ), as well as PZ-dependent protease inhibitor. On the other hand, thrombophilia has been linked to the gain-of-activity, or elevated levels, of α2-antiplasmin, angiotensin-converting enzyme, coagulation factors IX (FIX) and XI (FXI), fibrinogen, homocysteine, lipoprotein(a), plasminogen activator inhibitor-1 (PAI-1), and thrombin-activatable fibrinolysis inhibitor (TAFI). With respect to the molecular interactions that may influence the thrombotic risk, more complex mechanisms have been described for endothelial protein C receptor (EPCR) and factor XIII (FXIII) Val34Leu. With focus on the risk for venous thrombosis, the present review aims to give an overview on the current knowledge on the significance of the aforementioned markers for thrombophilia screening. According to the current knowledge, there appears to be weak evidence for a potential impact of EPCR, FIX, FXI, FXIII Val34Leu, fibrinogen, homocysteine, PAI-1, PZ, TAFI, and TFPI on the thrombotic risk.


Assuntos
Trombofilia , Trombose , Humanos , Inibidor 1 de Ativador de Plasminogênio/genética , Receptor de Proteína C Endotelial , Trombose/etiologia , Fator IX/metabolismo , Fibrinogênio
16.
Isr Med Assoc J ; 25(12): 847-850, 2022 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-36573782

RESUMO

BACKGROUND: Data regarding risk factors for superficial thrombophlebitis (STP) cases presenting to a hospital is limited. OBJECTIVES: To investigate and stratify clinical and laboratory risk factors for STP. METHODS: We conducted a retrospective case control study comparing patients presenting to the emergency department with STP and age- and gender-matched controls. We collected data on multiple risk factors and five blood indices. RESULTS: The study comprised 151 patients and matched controls. Patients with STP were more likely to have varicose veins (43.7% vs. 5.3%, P < 0.001), recent immobilization (14.6% vs. 1.3%, P < 0.001), obesity (36.4% vs. 18.5%, P = 0.001), a history of venous thromboembolism (VTE) or STP (27.2% vs. 0.7%, P < 0.001), and inherited thrombophilia (9.3% vs. 1.3%, P = 0.002). Following multivariate analysis, all five risk factors remained significant, with a history of VTE or STP associated with the largest risk (odds ratio [OR] 35.7), followed by immobilization (OR 22.3), varicose veins (OR 12.1), inherited thrombophilia (OR 6.1), and obesity (OR 2.7). Mean platelet volume was higher (8.5 vs 7.9 fl, P = 0.003) in STP cases. CONCLUSIONS: A history of VTE or STP, immobilization, varicose veins, inherited thrombophilia, and obesity serve as independent clinical risk factors for STP presenting to hospital.


Assuntos
Trombofilia , Tromboflebite , Varizes , Tromboembolia Venosa , Humanos , Estudos Retrospectivos , Estudos de Casos e Controles , Tromboembolia Venosa/epidemiologia , Tromboembolia Venosa/etiologia , Tromboflebite/etiologia , Tromboflebite/complicações , Fatores de Risco , Varizes/epidemiologia , Varizes/complicações , Obesidade/complicações , Obesidade/epidemiologia , Trombofilia/complicações , Trombofilia/epidemiologia
17.
Vnitr Lek ; 68(8): 488-492, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36575065

RESUMO

Venous thromboembolism (VTE) is still a serious medical problem with the non-decreasing incidence of new cases despite prophylaxis in risky situations. It is a multifactorial disease, in which the hereditary component is also significantly involved. The aim of the current research is to search for new polymorphisms that are involved in thrombogenesis in addition to classical thrombophilia (deficiency of natural coagulation inhibitors and FVL and FII prothrombin mutations). The article provides an overview of the results of already performed genome-wide association studies of VTE and their use for the calculation of the so-called polygenic risk score, which could be used for individualized prevention of VTE after standardization of the method.


Assuntos
Trombofilia , Tromboembolia Venosa , Humanos , Tromboembolia Venosa/genética , Tromboembolia Venosa/prevenção & controle , Estudo de Associação Genômica Ampla , Fator V/genética , Trombofilia/genética , Fatores de Risco
18.
Medicine (Baltimore) ; 101(44): e31240, 2022 Nov 04.
Artigo em Inglês | MEDLINE | ID: mdl-36343066

RESUMO

RATIONALE: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia. PATIENT CONCERNS: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain. DIAGNOSES: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4). INTERVENTIONS: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy. OUTCOMES: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed. LESSONS: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.


Assuntos
Deficiência de Antitrombina III , Trombofilia , Trombose , Masculino , Humanos , Adolescente , Varfarina/uso terapêutico , Deficiência de Antitrombina III/complicações , Deficiência de Antitrombina III/genética , Deficiência de Antitrombina III/tratamento farmacológico , Trombofilia/tratamento farmacológico , Veia Cava Inferior , Anticoagulantes , Heparina , Mutação , Trombose/tratamento farmacológico , Antitrombinas , Antitrombina III/genética
19.
PLoS One ; 17(11): e0277544, 2022.
Artigo em Inglês | MEDLINE | ID: mdl-36417476

RESUMO

OBJECTIVE: COVID 19 is often associated with hypercoagulability and thromboembolic (TE) events. The aim of this study was to assess the characteristics of hypercoagulability and its relationship with new-onset TE events and the composite outcome of need for intubation and/or death in intensive care unit (ICU) patients admitted for COVID. DESIGN: Prospective observational study. SETTING: Monocentric, intensive care, University Hospital of Clermont Ferrand, France. PATIENTS: Patients admitted to intensive care from January 2020 to May 2021 for COVID-19 pneumonia. INTERVENTIONS: Standard hemostatic tests and rotational thromboelastometry (ROTEM) were performed on admission and on day 4. Hypercoagulability was defined by at least one of the following criteria: D-dimers > 3000 µg/dL, fibrinogen > 8 g/L, EXTEM CFT below the normal range, EXTEM A5, MCF, Li 60 above the normal range, and EXTEM G-score ((5000 x MCF) / (100-MCF)) ≥ 11 dyne/cm2. MEASUREMENTS AND MAIN RESULTS: Of the 133 patients included, 17 (12.7%) developed new-onset TE events, and 59 (44.3%) required intubation and/or died in the ICU. ROTEM was performed in 133 patients on day 1 and in 67 on day 4. Hypercoagulability was present on day 1 in 115 (86.4%) patients. None of the hypercoagulability indices were associated with subsequent new-onset TE events on days 1 and 4 nor with the need for intubation and/or ICU death. Hyperfibrinogenemia > 8g/dL, higher D-dimers and higher EXTEM Li 60 on day 4 were predictive of need for intubation and/or of ICU death. CONCLUSIONS: Our study confirmed that most COVID-19 ICU patients have hypercoagulability on admission and almost all on day 4. Hyperfibrinogenemia or fibrinolysis shutdown on day 4 were associated with unfavorable outcome.


Assuntos
Transtornos da Coagulação Sanguínea , COVID-19 , Hemostáticos , Tromboembolia , Trombofilia , Humanos , Estudos Prospectivos , Estado Terminal , COVID-19/complicações , Trombofilia/complicações , Tromboelastografia
20.
J Reprod Immunol ; 154: 103760, 2022 Dec.
Artigo em Inglês | MEDLINE | ID: mdl-36395545

RESUMO

The efficacy of low molecular weight heparin (LMWH) is well-established in patients with obstetric antiphospholipid syndrome (O-APS). Their role in women with unexplained recurrent pregnancy loss (U-RPL) and late obstetrical complications (intrauterine growth restriction, IUGR and preeclampsia) is controversial. Here we compared rates of miscarriage and late obstetrical complications in RPL patients diagnosed with O-APS (n = 57) or hereditary thrombophilia (n = 25) (both assuming LMWH from the beginning of pregnancy) and in patients with a history of U-RPL (n = 118), assuming or not LMWH, followed at the 'Pregnancy at risk' and 'Recurrent pregnancy loss' outpatient clinics at the San Raffaele Hospital from April 2010 to April 2020. Patients with systemic autoimmune diseases other than primary O-APS were excluded. We tested for bivariate or multivariate associations among adverse pregnancy outcomes, the presence of thrombophilia and LMWH use by using chi-square test, Anova, propensity score adjusted univariate logistic regression and multivariate analysis as appropriate. U-RPL patients assuming LMWH from the beginning of pregnancy (group A) had a significantly lower rate of miscarriage compared to U-RPL patients who were not treated with LMWH (group B) (13 % vs. 41 % respectively, p 0.001) and similar pregnancy rates compared to both O-APS patients with a history of RPL taking LMWH (group C, 18 %) and RPL patients with thrombophilia and treated with LMWH (group D, 16 %). Our data highlight a protective effect of LMWH on miscarriage in patients with a history of U-RPL. In these patients, LMWH seems as effective as in O-APS and hereditary thrombophilia in reducing RPL.


Assuntos
Aborto Espontâneo , Síndrome Antifosfolipídica , Trombofilia , Gravidez , Humanos , Feminino , Síndrome Antifosfolipídica/tratamento farmacológico , Estudos Retrospectivos , Pontuação de Propensão , Trombofilia/tratamento farmacológico , Heparina de Baixo Peso Molecular/uso terapêutico , Retardo do Crescimento Fetal
SELEÇÃO DE REFERÊNCIAS
DETALHE DA PESQUISA
...