A FOXO1-induced oncogenic network defines the AML1-ETO preleukemic program.

Understanding and blocking the self-renewal pathway of preleukemia stem cells could prevent acute myeloid leukemia (AML) relapse. In this study, we show that increased FOXO1 represents a critical mechanism driving aberrant self-renewal in preleukemic cells expressing the t(8;21)-associated oncogene AML1-ETO (AE). Although generally considered as a tumor suppressor, FOXO1 is consistently upregulated in t(8;21) AML. Expression of FOXO1 in human CD34+ cells promotes a preleukemic state with enhanced self-renewal and dysregulated differentiation. The DNA binding domain of FOXO1 is essential for these functions. FOXO1 activates a stem cell molecular signature that is also present in AE preleukemia cells and preserved in t(8;21) patient samples. Genome-wide binding studies show that AE and FOXO1 share the majority of their binding sites, whereby FOXO1 binds to multiple crucial self-renewal genes and is required for their activation. In agreement with this observation, genetic and pharmacological ablation of FOXO1 inhibited the long-term proliferation and clonogenicity of AE cells and t(8;21) AML cell lines. Targeting of FOXO1 therefore provides a potential therapeutic strategy for elimination of stem cells at both preleukemic and leukemic stages.

Analysis and expansion of the eosinophilic esophagitis transcriptome by RNA sequencing.

Eosinophilic esophagitis (EoE) is an allergic inflammatory disorder of the esophagus that is compounded by genetic predisposition and hypersensitivity to environmental antigens. Using high-density oligonucleotide expression chips, a disease-specific esophageal transcript signature was identified and was shown to be largely reversible with therapy. In an effort to expand the molecular signature of EoE, we performed RNA sequencing on esophageal biopsies from healthy controls and patients with active EoE and identified a total of 1607 significantly dysregulated transcripts (1096 upregulated, 511 downregulated). When clustered by raw expression levels, an abundance of immune cell-specific transcripts are highly induced in EoE but expressed at low (or undetectable) levels in healthy controls. Moreover, 66% of the gene signature identified by RNA sequencing was previously unrecognized in the EoE transcript signature by microarray-based expression profiling and included several long non-coding RNAs (lncRNA), an emerging class of transcriptional regulators. The lncRNA BRAF-activated non-protein coding RNA (BANCR) was upregulated in EoE and induced in interleukin-13 (IL-13)-treated primary esophageal epithelial cells. Repression of BANCR significantly altered the expression of IL-13-induced proinflammatory genes. Together, these data comprise new potential biomarkers of EoE and demonstrate a novel role for lncRNAs in EoE and IL-13-associated responses.

Clusterin contributes to caspase-3-independent brain injury following neonatal hypoxia-ischemia.

Clusterin, also known as apolipoprotein J, is a ubiquitously expressed molecule thought to influence a variety of processes including cell death. In the brain, it accumulates in dying neurons following seizures and hypoxic-ischemic (H-I) injury. Despite this, in vivo evidence that clusterin directly influences cell death is lacking. Following neonatal H-I brain injury in mice (a model of cerebral palsy), there was evidence of apoptotic changes (neuronal caspase-3 activation), as well as accumulation of clusterin in dying neurons. Clusterin-deficient mice had 50% less brain injury following neonatal H-I. Surprisingly, the absence of clusterin had no effect on caspase-3 activation, and clusterin accumulation and caspase-3 activation did not colocalize to the same cells. Studies with cultured cortical neurons demonstrated that exogenous purified astrocyte-secreted clusterin exacerbated oxygen/glucose-deprivation-induced necrotic death. These results indicate that clusterin may be a new therapeutic target to modulate non-caspase-dependent neuronal death following acute brain injury.

Identification of a Sacral, Visceral Sensory Transcriptome in Embryonic and Adult Mice.

Visceral sensory neurons encode distinct sensations from healthy organs and initiate pain states that are resistant to common analgesics. Transcriptome analysis is transforming our understanding of sensory neuron subtypes but has generally focused on somatic sensory neurons or the total population of neurons in which visceral neurons form the minority. Our aim was to define transcripts specifically expressed by sacral visceral sensory neurons, as a step towards understanding the unique biology of these neurons and potentially leading to identification of new analgesic targets for pelvic visceral pain. Our strategy was to identify genes differentially expressed between sacral dorsal root ganglia (DRG) that include somatic neurons and sacral visceral neurons, and adjacent lumbar DRG that comprise exclusively of somatic sensory neurons. This was performed in adult and E18.5 male and female mice. By developing a method to restrict analyses to nociceptive Trpv1 neurons, a larger group of genes were detected as differentially expressed between spinal levels. We identified many novel genes that had not previously been associated with pelvic visceral sensation or nociception. Limited sex differences were detected across the transcriptome of sensory ganglia, but more were revealed in sacral levels and especially in Trpv1 nociceptive neurons. These data will facilitate development of new tools to modify mature and developing sensory neurons and nociceptive pathways.

Coordinate developmental regulation of purine catabolic enzyme expression in gastrointestinal and postimplantation reproductive tracts.

Using histochemical detection, we have visualized in situ the complete metabolic pathway for the degradation of purine nucleotides. From the tongue to the ileum, diverse epithelial cell types lining the lumen of the mouse gastrointestinal (GI) tract strongly coexpress each of the five key purine catabolic enzymes. Dramatic increases in the expression of each enzyme occurred during postnatal maturation of the GI tract. Using in situ hybridization, an intense accumulation of adenosine deaminase (ADA) mRNA was detected only within GI epithelial cells undergoing postmitotic differentiation. In a similar manner, at the developing maternal-fetal interface, high level expression of the purine catabolic pathway also occurred in a unique subset of maternal decidual cells previously known to express high levels of alkaline phosphatase and ADA. This induction occurred almost immediately after implantation in the periembryonic maternal decidual cells, shortly thereafter in antimesometrial decidual cells, and later in cells of the placental decidua basalis: all of which contain cell types thought to be undergoing programmed cell death. The expression of the pathway at the site of embryo implantation appears to be critical because its pharmacologic inhibition during pregnancy has been found to be embryolethal or teratogenic. Purine destruction at these nutritional interfaces (placenta and gastrointestinal tract) seem to override any potential economy of purine salvage, and may represent biochemical adaptation to nucleic acid breakdown occurring in the context of dietary digestion or extensive programmed cell death.

mTOR kinase inhibition reduces tissue factor expression and growth of pancreatic neuroendocrine tumors.

Essentials Tissue factor (TF) isoforms are expressed in pancreatic neuroendocrine tumors (pNET). TF knockdown inhibits proliferation of human pNET cells in vitro. mTOR kinase inhibitor sapanisertib/MLN0128 suppresses TF expression in human pNET cells. Sapanisertib suppresses TF expression and activity and reduces the growth of pNET tumors in vivo. SUMMARY: Background Full-length tissue factor (flTF) and alternatively spliced TF (asTF) contribute to growth and spread of pancreatic ductal adenocarcinoma. It is unknown, however, if flTF and/or asTF contribute to the pathobiology of pancreatic neuroendocrine tumors (pNETs). Objective To assess TF expression in pNETs and the effects of mTOR complex 1/2 (mTORC1/2) inhibition on pNET growth. Methods Human pNET specimens were immunostained for TF. Human pNET cell lines QGP1 and BON were evaluated for TF expression and responsiveness to mTOR inhibition. shRNA were used to knock down TF in BON. TF cofactor activity was assessed using a two-step FXa generation assay. TF promoter activity was assessed using transient transfection of human TF promoter-driven reporter constructs into cells. Mice bearing orthotopic BON tumors were treated with the mTORC1/2 ATP site competitive inhibitor sapanisertib/MLN0128 (3 mg kg-1 , oral gavage) for 34 days. Results Immunostaining of pNET tissue revealed flTF and asTF expression. BON and QGP1 expressed both TF isoforms, with BON exhibiting higher levels. shRNA directed against TF suppressed BON proliferation in vitro. Treatment of BON with sapanisertib inhibited mTOR signaling and suppressed TF levels. BON tumors grown in mice treated with sapanisertib had significantly less TF protein and cofactor activity, and were smaller compared with tumors grown in control mice. Conclusions TF isoforms are expressed in pNETs. Sapanisertib suppresses TF mRNA and protein expression as well as TF cofactor activity in vitro and in vivo. Thus, further studies are warranted to evaluate the clinical utility of TF-suppressing mTORC1/2 inhibitor sapanisertib in pNET management.

Loss of the retinoblastoma tumor suppressor: differential action on transcriptional programs related to cell cycle control and immune function.

Functional inactivation of the retinoblastoma tumor suppressor gene product (RB) is a common event in human cancers. Classically, RB functions to constrain cellular proliferation, and loss of RB is proposed to facilitate the hyperplastic proliferation associated with tumorigenesis. To understand the repertoire of regulatory processes governed by RB, two models of RB loss were utilized to perform microarray analysis. In murine embryonic fibroblasts harboring germline loss of RB, there was a striking deregulation of gene expression, wherein distinct biological pathways were altered. Specifically, genes involved in cell cycle control and classically associated with E2F-dependent gene regulation were upregulated via RB loss. In contrast, a program of gene expression associated with immune function and response to pathogens was significantly downregulated with the loss of RB. To determine the specific influence of RB loss during a defined period and without the possibility of developmental compensation as occurs in embryonic fibroblasts, a second system was employed wherein Rb was acutely knocked out in adult fibroblasts. This model confirmed the distinct regulation of cell cycle and immune modulatory genes through RB loss. Analyses of cis-elements supported the hypothesis that the majority of those genes upregulated with RB loss are regulated via the E2F family of transcription factors. In contrast, those genes whose expression was reduced with the loss of RB harbored different promoter elements. Consistent with these analyses, we found that disruption of E2F-binding function of RB was associated with the upregulation of gene expression. In contrast, cells harboring an RB mutant protein (RB-750F) that retains E2F-binding activity, but is specifically deficient in the association with LXCXE-containing proteins, failed to upregulate these same target genes. However, downregulation of genes involved in immune function was readily observed with disruption of the LXCXE-binding function of RB. Thus, these studies demonstrate that RB plays a significant role in both the positive and negative regulations of transcriptional programs and indicate that loss of RB has distinct biological effects related to both cell cycle control and immune function.

H3K9 methyltransferases and demethylases control lung tumor-propagating cells and lung cancer progression.

Epigenetic regulators are attractive anticancer targets, but the promise of therapeutic strategies inhibiting some of these factors has not been proven in vivo or taken into account tumor cell heterogeneity. Here we show that the histone methyltransferase G9a, reported to be a therapeutic target in many cancers, is a suppressor of aggressive lung tumor-propagating cells (TPCs). Inhibition of G9a drives lung adenocarcinoma cells towards the TPC phenotype by de-repressing genes which regulate the extracellular matrix. Depletion of G9a during tumorigenesis enriches tumors in TPCs and accelerates disease progression metastasis. Depleting histone demethylases represses G9a-regulated genes and TPC phenotypes. Demethylase inhibition impairs lung adenocarcinoma progression in vivo. Therefore, inhibition of G9a is dangerous in certain cancer contexts, and targeting the histone demethylases is a more suitable approach for lung cancer treatment. Understanding cellular context and specific tumor populations is critical when targeting epigenetic regulators in cancer for future therapeutic development.

Apolipoprotein J/clusterin limits the severity of murine autoimmune myocarditis.

Apolipoprotein J/clusterin (apoJ/clusterin), an intriguing protein with unknown function, is induced in myocarditis and numerous other inflammatory injuries. To test its ability to modify myosin-induced autoimmune myocarditis, we generated apoJ-deficient mice. ApoJ-deficient and wild-type mice exhibited similar initial onset of myocarditis, as evidenced by the induction of two early markers of the T cell-mediated immune response, MHC-II and TNF receptor p55. Furthermore, autoantibodies against the primary antigen cardiac myosin were induced to the same extent. Although the same proportion of challenged animals exhibited some degree of inflammatory infiltrate, inflammation was more severe in apoJ-deficient animals. Inflammatory lesions were more diffuse and extensive in apoJ-deficient mice, particularly in females. In marked contrast to wild-type animals, the development of a strong generalized secondary response against cardiac antigens in apoJ-deficient mice was predictive of severe myocarditis. Wild-type mice with a strong Ab response to secondary antigens appeared to be protected from severe inflammation. After resolution of inflammation, apoJ-deficient, but not wild-type, mice exhibited cardiac function impairment and severe myocardial scarring. These results suggest that apoJ limits progression of autoimmune myocarditis and protects the heart from postinflammatory tissue destruction.

A central role for a single c-Myb binding site in a thymic locus control region.

Locus control regions (LCRs) are powerful assemblies of cis elements that organize the actions of cell-type-specific trans-acting factors. A 2.3-kb LCR in the human adenosine deaminase (ADA) gene first intron, which controls expression in thymocytes, is composed of a 200-bp enhancer domain and extended flanking sequences that facilitate activation from within chromatin. Prior analyses have demonstrated that the enhancer contains a 28-bp core region and local adjacent augmentative cis elements. We now show that the core contains a single critical c-Myb binding site. In both transiently cotransfected human cells and stable chromatin-integrated yeast cells, c-Myb strongly transactivated reporter constructs that contained polymerized core sequences. c-Myb protein was strongly evident in T lymphoblasts in which the enhancer was active and was localized within discrete nuclear structures. Fetal murine thymus exhibited a striking concordance of endogenous c-myb expression with that of mouse ADA and human ADA LCR-directed transgene expression. Point mutation of the c-Myb site within the intact 2.3-kb LCR severely attenuated enhancer activity in transfections and LCR activity in transgenic thymocytes. Within the context of a complex enhancer and LCR, c-Myb can act as an organizer of thymocyte-specific gene expression via a single binding site.

Functional analysis of the human adenosine deaminase gene thymic regulatory region and its ability to generate position-independent transgene expression.

We previously observed that human ADA gene expression, required for the intrathymic maturation of T cells, is controlled by first-intron sequences. Used as a cis activator, the intron generates copy-dependent reporter expression in transgenic thymocytes, and we here dissect its critical determinants. Of six DNase I-hypersensitive sites (HS sites) in the intron, only HS III was a transfection-active classic enhancer in T cells. The enhancer contains a critical core region, ACATGGCAGTTGGTGGTGGAGGGGAACA, that interacts with at least two factors, ADA-NF1 and ADA-NF2. Activity of the core is strongly augmented by adjacent elements contained within a 200-bp domain corresponding to the limits of HS III hypersensitivity. These core-adjacent sequences include consensus matches for recognition by the AP-1, TCF-1 alpha, mu E, and Ets transcription factor families. In contrast, considerably more extensive sequences flanking the enhancer domain were required for position-independent and copy-proportional expression in transgenic mouse thymocytes. The additionally required upstream segment encompassed the nonenhancer HS II site. The required downstream segment, composed largely of Alu-repetitive DNA, was non-DNase I hypersensitive. Transgenes that lacked either segment were subject to strong positional effects. Among these variably expressing lines, the expression level correlated with the degree of hypersensitivity at HS III. This finding suggests that formation of hypersensitivity is normally facilitated by the flanking segments. These results delineate a complex thymic regulatory region within the intron and indicate that a series of interactions is necessary for the enhancer domain to function consistently within chromatin.

Dissecting a locus control region: facilitation of enhancer function by extended enhancer-flanking sequences.

Using transgenic mice, we have defined novel gene regulatory elements, termed "facilitators." These elements bilaterally flank, by up to 1 kb, a 200-bp T-cell-specific enhancer domain in the human adenosine deaminase (ADA) gene. Facilitators were essential for gene copy-proportional and integration site-independent reporter expression in transgenic thymocytes, but they had no effect on the enhancer in transfected T cells. Both segments were required. Individual segments had no activity. A lack of facilitator function caused positional susceptibility and prevented DNase I-hypersensitive site formation at the enhancer. The segments were required to be at opposed ends of the enhancer, and they could not be grouped together. Reversing the orientation of a facilitator segment caused a partial loss of function, suggesting involvement of a stereospecific chromatin structure. trans-acting factor access to enhancer elements was modeled by exposing nuclei to a restriction endonuclease. The enhancer domain was accessible to the 4-cutter DpnII in a tissue- and cell-type-specific fashion. However, unlike DNase I hypersensitivity and gene expression, accessibility to the endonuclease could occur without the facilitator segments, suggesting that an accessible chromatin domain is an intermediate state in the activational pathway. These results suggest that facilitators (i) are distinct from yet positionally constrained to the enhancer, (ii) participate in a chromatin structure transition that is necessary for the DNase I hypersensitivity and the transcriptional activating function of the enhancer, and (iii) act after cell-type-specific accessibility to the enhancer sequences is established by factors that do not require the facilitators to be present.

Diverse developing mouse lineages exhibit high-level c-Myb expression in immature cells and loss of expression upon differentiation.

The c-myb gene encodes a sequence specific transactivator that is required for fetal hematopoiesis, but its potential role in other tissues is less clear because of the early fetal demise of mice with targeted deletions of the c-myb gene and incomplete of knowledge about c-myb's expression pattern. In the hematopoietic system, c-Myb protein acts on target genes whose expression is restricted to individual lineages, despite Myb's presence and role in multiple immature lineages. This suggests that c-Myb actions within different cell type-specific contexts are strongly affected by combinatorial interactions. To consider the possibility of similar c-Myb actions could extend into non-hematopoietic systems in other cell and tissue compartments, we characterized c-myb expression in developing and adult mice using in situ hybridization and correlated this with stage-specific differentiation and mitotic activity. Diverse tissues exhibited strong c-myb expression during development, notably tooth buds, the thyroid primordium, developing trachea and proximal branching airway epithelium, hair follicles, hematopoietic cells, and gastrointestinal crypt epithelial cells. The latter three of these all maintained high expression into adulthood, but with characteristic restriction to immature cell lineages prior to their terminal differentiation. In all sites, during fetal and adult stages, loss of c-Myb expression correlated strikingly with the initiation of terminal differentiation, but not the loss of mitotic activity. Based on these data, we hypothesize that c-Myb's function during cellular differentiation is both an activator of immature gene expression and a suppressor of terminal differentiation in diverse lineages.

Microarray analysis of trophoblast differentiation: gene expression reprogramming in key gene function categories.

Placental development results from a highly dynamic differentiation program. We used DNA microarray analysis to characterize the process by which human cytotrophoblast cells differentiate into syncytiotrophoblast cells in a purified cell culture system. Of 6,918 genes analyzed, 141 genes were induced and 256 were downregulated by more than 2-fold. Dynamically regulated genes were divided by the K-means algorithm into 9 kinetic pattern groups, then by biologic classification into 6 overall functional categories: cell and tissue structural dynamics, cell cycle and apoptosis, intercellular communication, metabolism, regulation of gene expression, and expressed sequence tag (EST) and function unknown. Gene expression changes within key functional categories were tightly coupled to morphological changes. In several key gene function categories, such as cell and tissue structure, many gene members of the category were strongly activated while others were strongly repressed. These findings suggest that differentiation is augmented by "categorical reprogramming" in which the function of induced genes is enhanced by preventing the further synthesis of categorically related gene products.

Gene induction and categorical reprogramming during in vitro human endometrial fibroblast decidualization.

Gene induction and categorical reprogramming during in vitro human endometrial fibroblast decidualization. Physiol Genomics 7: 135-148, 2001. First published September 21, 2001; 10.1152/physiolgenomics.00061.2001.-Human decidual fibroblasts undergo a differentiative commitment to the acquisition of endocrine, metabolic, and structural cell functions in a process known as decidualization. Decidualization is critical for embryo implantation and placental function. We characterized gene expression pattern kinetics during decidual fibroblast differentiation by microarray analysis. Of 6,918 genes analyzed, 121 genes were induced by more than twofold, 110 were downregulated, and 50 showed biphasic behavior. Dynamically regulated genes were could be fit into nine K-means algorithm-based kinetic pattern groups, and by biologic classification, into five categories: cell and tissue function, cell and tissue structure, regulation of gene expression, expressed sequence tag (EST), and "function unknown." Reprogramming of genes within specific functional groups and gene families was a prominent feature that consisted of simultaneous induction and downregulation of a set of genes with related function. We previously observed a conceptually similar process during fetal trophoblast differentiation, in which the same phenomena applied to different genes. Of the 569 dynamically regulated genes regulated by either model, only 81 of these were in common. These results suggest that reprogramming of gene expression within focused functional categories represents a fundamental aspect of cellular differentiation.

Divergent transcriptional responses to independent genetic causes of cardiac hypertrophy.

To define molecular mechanisms of cardiac hypertrophy, genes whose expression was perturbed by any of four different transgenic mouse hypertrophy models [protein kinase C-epsilon activation peptide (PsiepsilonRACK), calsequestrin (CSQ), calcineurin (CN), and Galpha(q)] were compared by DNA microarray analyses using the approximately 8,800 genes present on the Incyte mouse GEM1. The total numbers of regulated genes (tens to hundreds) correlated with phenotypic severity of the model (Galpha(q) > CN > CSQ > PsiepsilonRACK), but demonstrated that no single gene was consistently upregulated. Of the three models exhibiting pathological hypertrophy, only atrial natriuretic peptide was consistently upregulated, suggesting that transcriptional alterations are highly specific to individual genetic causes of hypertrophy. However, hierarchical-tree and K-means clustering analyses revealed that subsets of the upregulated genes did exhibit coordinate regulatory patterns that were unique or overlapping across the different hypertrophy models. One striking set consisted of apoptotic genes uniquely regulated in the apoptosis-prone Galpha(q) model. Thus, rather than identifying a single common hypertrophic cardiomyopathy gene program, these data suggest that extensive groups of genes may be useful for the prediction of specific underlying genetic determinants and condition-specific therapeutic approaches.

Clusterin shortens the incubation and alters the histopathology of bovine spongiform encephalopathy in mice.

Clusterin accumulates in significant quantity in prion protein lesions associated with bovine spongiform encephalopathy (BSE) and we therefore sought to elucidate its ability to alter BSE pathogenesis and incubation time by comparison of wild type C57BL/6J mice and clusterin knock out (ko) mice. The ko mice had a 40 day increase in mean incubation time compared to wild type mice. PrP deposition in the medulla was less aggregated in clusterin knock out mice when compared to wild type BSE infected mice and a more marked astrocytosis, as determined by GFAP staining, was evident. The vacuolation profiles did not differ between the two strains of mice. Taken together these results suggest that clusterin alters the extracellular deposition of PrP(BSE) and accelerates BSE pathogenesis.

Functional genomics of oxidant-induced lung injury.

In summary, acute lung injury is a severe (>40% mortality) respiratory disease associated with numerous precipitating factors. Despite extensive research since its initial description over 30 years ago, questions remain about the basic pathophysiological mechanisms and their relationship to therapeutic strategies. Histopathology reveals surfactant disruption, epithelial perturbation and sepsis, either as initiating factors or as secondary complications, which in turn increase the expression of cytokines that sequester and activate inflammatory cells, most notably, neutrophils. Concomitant release of reactive oxygen and nitrogen species subsequently modulates endothelial function. Together these events orchestrate the principal clinical manifestations of the syndrome, pulmonary edema and atelectasis. To better understand the gene-environmental interactions controlling this complex process, we examined the relative sensitivity of inbred mouse strains to acute lung injury induced by ozone, ultrafine PTFE, or fine particulate NiSO4 (0.2 microm MMAD, 15-150 microg/m3). Measuring survival time, protein and neutrophils in bronchoalveolar lavage, lung wet: dry weight, and histology, we found that these responses varied between inbred mouse strains, and susceptibility is heritable. To assess the molecular progression of NiSO4-induced acute lung injury, temporal relationships of 8734 genes and expressed sequence tags were assessed by cDNA microarray analysis. Clustering of co-regulated genes (displaying similar temporal expression patterns) revealed the altered expression of relatively few genes. Enhanced expression occurred mainly in genes associated with oxidative stress, anti-proteolytic function, and repair of the extracellular matrix. Concomitantly, surfactant proteins and Clara cell secretory protein mRNA expression decreased. Genome wide analysis of 307 mice generated from the backcross of resistant B6xA F1 with susceptible A strain identified significant linkage to a region on chromosome 6 (proposed as Aliq4) and suggestive linkages on chromosomes 1, 8, and 12. Combining of these QTLs with two additional possible modifying loci (chromosome 9 and 16) accounted for the difference in survival time noted in the A and B6 parental strains. Combining these findings with those of the microarray analysis has enabled prioritization of candidate genes. These candidates, in turn, can be directed to the lung epithelium in transgenic mice or abated in inducible and constitutive gene-targeted mice. Initial results are encouraging and suggest that several of these mice vary in their susceptibility to oxidant-induced lung injury. Thus, these combined approaches have led to new insights into functional genomics of lung injury and diseases.

Pathogenomic mechanisms for particulate matter induction of acute lung injury and inflammation in mice.

To begin identifying genes controlling individual susceptibility to particulate matter, responses of inbred mouse strains exposed to nickel sulfate (NiSO4*) were compared with those of mice exposed to ozone (O3) or polytetrafluoroethylene (PTFE). The A strain was sensitive to NiSO4-induced lung injury (quantified by survival time), the C3H/He (C3) strain and several other strains were intermediate in their responses, and the C57BL/6 (B6) strain was resistant. The strains showed a pattern of response similar to the patterns of response to O3 and PTFE. The phenotype of A x B6 offspring (B6AF1) resembled that of the resistant B6 parental strain, with strains exhibiting sensitivity in the order A > C3 > B6 = B6AF1. Pathology was comparable for the A and B6 mice, and exposure to NiSO4 at 15 microg/m3 produced 20% mortality in A mice. Strain sensitivity for the presence of protein or neutrophils in lavage fluid differed from strain sensitivity for survival time, suggesting that they are not causally linked but are controlled by an independent gene or genes. In the B6 strain, exposure to nickel oxide (NiO) by instillation (40 to 1000 nm) or inhalation (50 nm) produced no changes, whereas inhalation of NiSO4 (60 or 250 nm) increased lavage proteins and neutrophils. Complementary DNA (cDNA) microarray analysis with 8,734 sequence-verified clones revealed a temporal pattern of increased oxidative stress, extracellular matrix repair, cell proliferation, and hypoxia, followed by a decrease in surfactant-associated proteins (SPs). Certain expressed sequence tags (ESTs), clustered with known genes, suggest possible coregulation and novel roles in pulmonary injury. Finally, locus number estimation (Wright equation) and a genomewide analysis suggested 5 genes could explain the survival time and identified significant linkage for a quantitative trait locus (QTL) on chromosome 6, Aliq4 (acute lung injury QTL4). Haplotype analysis identified an allelic combination of 5 QTLs that could explain the difference in sensitivity to acute lung injury between parental strains. Positional candidate genes for Aliq4 include aquaporin-1 (Aqp1), SP-B, and transforming growth factor-alpha (TGF-alpha). Transgenic mice expressing TGF-alpha were rescued from NiSO4 injury (that is, they had diminished SP-B loss and increased survival time). These findings suggest that NiSO4-induced acute lung injury is a complex trait controlled by at least 5 genes (all possibly involved in cell proliferation and surfactant function). Future assessment of these susceptibility genes (including evaluations of human synteny and function) could provide valuable insights into individual susceptibility to the adverse effects of particulate matter.

MiR-375 is downregulated in epithelial cells after IL-13 stimulation and regulates an IL-13-induced epithelial transcriptome.

Interleukin 13 (IL-13)-induced epithelial gene and protein expression changes are central to the pathogenesis of multiple allergic diseases. Herein, using human esophageal squamous and bronchial columnar epithelial cells, we identified microRNAs (miRNAs) that were differentially regulated after IL-13 stimulation. Among the IL-13-regulated miRNAs, miR-375 showed a conserved pattern of downregulation. Furthermore, miR-375 was downregulated in the lung of IL-13 lung transgenic mice. We subsequently analyzed miR-375 levels in a human disease characterized by IL-13 overproduction--the allergic disorder eosinophilic esophagitis (EE)--and observed downregulation of miR-375 in EE patient samples compared with control patients. MiR-375 expression levels reflected disease activity, normalized with remission, and inversely correlated with the degree of allergic inflammation. Using a lentiviral strategy and whole-transcriptome analysis in epithelial cells, miR-375 overexpression was sufficient to markedly modify IL-13-associated immunoinflammatory pathways in epithelial cells in vitro, further substantiating interactions between miR-375 and IL-13. Taken together, our results support a key role of miRNAs, particularly miR-375, in regulating and fine-tuning IL-13-mediated responses.